Application of soybean GmAGL1 gene in changing soybean grain protein components and increasing sulfur-containing amino acid content

Abstract

The invention discloses application of soybean GmAGL1 in changing soybean grain protein components and increasing sulfur-containing amino acid content. The nucleotide sequence of the transcription factor coding gene GmAGL1 of the soybean MADS box is as shown in SEQ ID NO. 1. The constructed plant overexpression vector pBA002-GmAGL1 is subjected to agrobacterium tumefaciens-mediated soybean genetic transformation to obtain a soybean receptor variety Jack, and it is found that compared with a receptor control group, the 7S component content and the sulfur-containing amino acid content in seeds of an overexpression transgenic soybean plant are increased, and the quality of the seeds of an overexpression transgenic soybean line is improved. Therefore, the gene can be introduced into plants as a target gene to improve the sulfur-containing amino acid content of soybean seeds. Therefore, a new function of the transcription factor coding gene GmAGL1 of the soybean MADS box in soybean plants is found, and protein components are changed through genetic engineering, so that the application in the aspect of transgenic soybean grain quality is influenced.

Description

Technical Field

[0001] The present invention relates to the application of the transcription factor encoding gene GmAGL1 of soybean MADS box, belonging to the field of genetic engineering. Background Art

[0002] Plants provide approximately 70% of edible oil and 50% of dietary protein for humans, and soybeans play an important role (Duan et al. 2023). Soybean seeds contain eighteen amino acids, including ten essential amino acids. The contents of two sulfur-containing amino acids, methionine (Met) and cysteine (Cys), are relatively low (Zhang et al., 2018), seriously affecting the nutritional balance of soybeans. Therefore, increasing the content of sulfur-containing amino acids can improve the nutritional value of soybean meal (Panthee et al., 2004), contributing to solving the problem of malnutrition.

[0003] Globulin (11S) and β-globulin (7S) are the main storage proteins in soybean protein, accounting for about 70% of the total protein (Jufang and Yetong et al., 2014). The amino acid compositions and molecular structures of 11S and 7S are different, determining the different physicochemical properties of soybean storage proteins. Among them, the sulfur-containing amino acid content of 11S is 3-4 times that of 7S (Kitamura 1988). At the same time, the ratio of 11S to 7S (RGC) affects the nutritional value of soybean seeds and the physicochemical properties of soybean storage proteins.

[0004] The "MADS" in MADS-box comes from MCM1 (yeast), AG (Arabidopsis), DEFICIENS (snapdragon), and SRF (mammal), which are the first four proteins found in the MADS transcription factor family (Shore et al., 1995). MIKC-type MADS-box proteins can be further divided into two categories: MIKC c type and MIKC* type proteins. The I domain in MIKC c type proteins is encoded by only one exon, while the I domain in MIKC* type proteins is longer and has four or five exons (Becker et al., 2003; Zhao et al., 2006). MADS-box proteins bind to the cis-acting element CArG (C-A / T-rich-G) motif to regulate downstream gene transcription (Dolan and Fields, 1991; Treisman, 1992).

[0005] The GmAGL1 gene encodes a MADS-box transcription factor. In soybeans, MADS-box transcription factors are usually related to flowering and usually exert downstream functions by forming homodimers (Tsai et al., 2008) or heterodimers (Honma and Goto, 2001; de Folter et al., 2005). Overexpression of the MADS-box transcription factor family gene GmFULa in soybeans increased the carbon assimilation and transport capacities of soybean plants and improved soybean yield without changing the flowering time at maturity (Yue et al., 2021). Different alleles of Tof5 (named GmFULc) were selected in parallel in wild and cultivated soybeans, enhancing the adaptation of wild and cultivated soybeans to high latitudes. Research has shown that tof5 CR plants showed significant delays in flowering and maturity ((Dong et al., 2021). Currently, there is no report on the effect of the GmAGL1 gene on protein components and sulfur amino acid content in soybeans. We used molecular means to construct an overexpression PBA002 vector for soybean genetic transformation and found that the protein components of the overexpressed materials changed and the sulfur amino acid content increased significantly. Summary of the Invention

[0006] The purpose of the present invention is to disclose the application of a soybean nutritional improvement genetic engineering of a MADS-box transcription factor encoding gene GmAGL1 in soybeans. The protein components of the overexpressed transgenic soybean seeds are changed and the sulfur amino acid content is significantly increased.

[0007] The purpose of the present invention can be achieved by the following technical solutions:

[0008] The soybean GmAGL1 encoding gene, whose nucleotide sequence is: SEQ ID NO.1.

[0009] The soybean GmAGL1 protein, whose amino acid sequence is: SEQ ID NO.2.

[0010] A recombinant expression vector containing the MADS-box transcription factor encoding gene GmAGL1 of the present invention.

[0011] The recombinant expression vector containing the soybean MADS-box transcription factor encoding gene GmAGL1 is obtained by inserting the transcription factor encoding gene GmAGL1 between MluI and SacI of the pBA002 vector.

[0012] When constructing a plant expression vector using GmAGL1, any enhancer promoter or inducible promoter can be added before the transcriptional start nucleotide. For the convenience of identifying and screening transgenic plant cells or plants, the used plant expression vector can be processed, such as adding a selectable marker gene (GUS gene, luciferase gene, etc.) to the plant. Considering the safety of transgenic plants, no selectable marker gene can be added, and the transformed plants can be directly screened by phenotypic traits.

[0013] Use of soybean GmAGL1 in genetically engineering to change the protein components of soybean seeds and increase the content of sulfur-containing amino acids.

[0014] Use of the recombinant expression vector of soybean GmAGL1 in genetically engineering to change the protein components of soybean seeds and increase the content of sulfur-containing amino acids.

[0015] Beneficial effects

[0016] Tissue expression analysis shows that GmAGL1 is expressed in flowers, pods, and developing seeds, and its expression level gradually increases with the growth and development of seeds ( Figure 2 ). The subcellular localization vector pFGC5941-GmAGL1 was constructed, and it and the empty vector were respectively transformed into tobacco leaves by injection. The results show that the GmAGL1 protein is localized on the nucleus and cell membrane ( Figure 3 ). The plant overexpression vector pBA002-GmAGL1 was constructed and overexpressed in the soybean variety Jack. The qRT-PCR results show that the transcriptional level of this gene was significantly increased in the overexpressed soybean. The protein components of the T3 generation seeds of transgenic soybeans were measured using 11S and 7S ELISA kits, and the content of β-globulin (7S) was significantly increased ( Figure 5 ). The near-infrared measurement of the T3 generation seeds of transgenic soybeans shows that the content of sulfur-containing amino acids was significantly increased compared with the control ( Figure 6 ). It shows that this gene can be introduced into soybeans as a target gene to change the protein components of soybean seeds and increase the content of sulfur-containing amino acids. Description of the drawings

[0017] Figure 1 . PCR amplification result of GmAGL1. M is Marker ( DNA Marker); the target band of GmAGL1 is in lane 2, and its size is about 729 bp. The sizes of the Marker bands from top to bottom are: 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp.

[0018] Figure 2. Analysis of the tissue expression level of GmAGL1. Root: root tissue, Stem: stem tissue, Leave: leaf tissue, Flower: flower tissue, Pod: pod, 15DAF Seed: seeds at 15 days after flowering, 25DAF Seed: seeds at 25 days after flowering, 35DAF Seed: seeds at 35 days after flowering, 40DAF Seed: seeds at 40 days after flowering.

[0019] Figure 3 . Subcellular localization results of the GmAGL1 gene.

[0020] Figure 4 . Expression patterns of the overexpressed GmAGL1 gene in various tissues of two homozygous transgenic lines and WT. Error bars represent mean ± SD. Statistical analysis was performed using a two-tailed T-test. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

[0021] Figure 5 . Determination of protein components in T3 generation GmAGL1 overexpressing transgenic soybeans. Statistical analysis was performed using a two-tailed T-test. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

[0022] Figure 6 . Determination of protein content in T3 generation GmAGL1 overexpressing transgenic soybeans. Statistical analysis was performed using a two-tailed T-test. *, P < 0.05; **, P < 0.01; ***, P < 0.001. Detailed implementation manners

[0023] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0024] Unless otherwise specified, the methods used in the following embodiments are all conventional methods.

[0025] Example 1

[0026] 1) Cloning of the coding gene of the MADS-box transcription factor GmAGL1

[0027] Using the soybean variety Jack as the material, its leaf tissue was taken, ground with liquid nitrogen, and the powder was placed in a 1.5 ml EP tube. 1 ml of lysis buffer was added, and it was vortexed to mix evenly. Then, extraction was carried out according to the kit (Total RNA Kit, Tiangen, Beijing, China). The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis, and the RNA content was measured with a spectrophotometer. Using the obtained total RNA as a template, reverse transcription was carried out according to the instructions of the reverse transcription kit provided by Vazyme Biotech Co., Ltd. (Vazyme HiScript 1st Strand cDNA Synthesis Kit, Nanjing). After obtaining the first strand of cDNA, PCR amplification was performed. The PCR program was as follows: pre-denaturation at 95 °C for 3 minutes, denaturation at 95 °C for 15 seconds, annealing at 58 °C for 15 seconds, extension at 72 °C for 30 seconds, for a total of 35 cycles. Finally, incubation at 72 °C for 5 minutes, followed by constant temperature at 4 °C for half an hour to obtain the cDNA of Jack material.

[0028] From the NCBI database and the Phytozome v13 soybean database, the gene corresponding to GmAGL1 (Glyma.14G027251, GeneID: 100792224) was found. According to the nucleotide sequence provided by the database, specific amplification primers were designed at the UTR end. The cloning primer sequences were F1: GCTAGACACACACCCCTTGT and R1: CACACCACTTGAAAGGCTGC. Using the cDNA of the soybean variety Jack as a template, the gene was cloned, and after gel cutting, the PCR product was purified, ligated to the T-vector plasmid and transformed. Positive monoclonal colonies were picked for sequencing. After sequencing, the mRNA sequence of the soybean GmAGL1 gene with a complete coding region was obtained. The length of the mRNA sequence was 1200 bp, and the size of the CDS coding region sequence was 729 bp ( Figure 1 ), and this bacterial solution was named T-GmAGL1.

[0029] 2) Tissue expression analysis of GmAGL1 gene

[0030] To identify the expression levels of GmAGL1 in different tissues, roots, stems, leaves, flowers, pods, and seeds at different developmental stages of the soybean variety Jack were taken: roots, stems, and leaves were at the V4 stage; flowers were at the R2 stage; seeds and pods were 25 and 45 days after flowering. The samples were quickly frozen in liquid nitrogen and stored at -80 °C. The extraction of total RNA was the same as in step 1). Using the total RNA obtained from the above tissue sampling as a template, it was reverse transcribed into cDNA. The fluorescence quantitative primer sequences of GmAGL1 were F2: GCCGTAACGGGTTGCTCAAG and R2: TGTGGAGGCAGCACATGCTTT. The detection results of tissue expression levels showed that the expression level of GmAGL1 was the highest in the pods 45 days after flowering ( Figure 2 ).

[0031] 4) Subcellular localization of the GmAGL1 gene

[0032] Primers containing the complete CDS of the GmAGL1 gene (excluding the stop codon) were designed. The primer sequences are shown in F3: ACAAATC TATCTCTCTCGAGATGGAATTTCCCAACGAAGC and R3: GCTCACCATGGATCCGACAAGTTGAAGAGCAGTCT. The specific PCR procedure was the same as that in step 1). PCR amplification was performed using a high-fidelity enzyme. After the obtained product was recovered and purified by gel electrophoresis, the product and the vector were double-digested with restriction enzymes SmaⅠ and XhoⅠ, ligated with the vector P2 using a homologous recombinase, then transformed and plated. The bacterial solution with correct sequencing was used to extract the plasmid and named P2-GmAGL1. After transferring it and the empty vector into EHA105 competent cells respectively, 48 hours after injecting the Agrobacterium bacterial solution into tobacco, a Leica laser confocal microscope was used to verify the subcellular localization. The results showed that green fluorescence was observed in each tissue for the empty plasmid vector, while GmAGL1 was mainly localized in the plasma membrane and nucleus ( Figure 3 ).

[0033] Example 2 Genetic engineering application of the gene GmAGL1

[0034] 1) Construction of a plant overexpression vector

[0035] The overexpression vector was constructed using the method of enzymatic digestion and recombination. First, the pBA002 vector was cut with restriction enzymes MluI and SacI, and after gel extraction and purification, the concentration was measured.

[0036] PCR amplification was performed using the T-GmAGL1 plasmid as a template. The amplification primer sequences with the pBA002 vector digestion adaptors are shown in F4: CGCGCCGGGCCCAGGCCTACGCGTATGGAATTTCCCAACGAAGC and R4: ATCGGGGAAATTCGAGCTCGACAAGTTGAAGAGCAGTCT. The PCR program was as follows: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 60 seconds, for a total of 35 cycles, and finally incubation at 72°C for 5 minutes, followed by constant temperature at 4°C. After running the gel, the gel was recovered to obtain the complete CDS sequence of the GmAGL1 gene with MluI and SacI digestion adaptors.

[0037] The target gene fragment with the digestion adaptor amplified by primers F4 and R4 and the cut pBA002 vector were used with the Use the Entry One Step Cloning Kit (C115) for ligation, transformation, plating, picking single colonies, and performing colony PCR sequencing verification. The specific PCR process is the same as in step 1). Finally, obtain the pBA002-GmAGL1 plant overexpression plasmid ( Figure 4 ), and store it at -20 °C in the refrigerator for later use.

[0038] 2) Agrobacterium-mediated transformation of soybean cotyledon nodes

[0039] Transform the plasmids obtained in steps 1) and 2) into Agrobacterium tumefaciens EHA105 and perform plant tissue culture. The specific experimental operation procedures are as follows:

[0040] 1. Bacterial liquid preparation: Streak the pBA002-GmAGL1 bacterial liquid on a YEB plate containing kanamycin, invert it on a shaker at 28 °C. After single colonies grow, pick a single colony into a 2 ml centrifuge tube containing 1 ml of liquid medium. Culture it overnight on a shaker at 28 °C, and then transfer it to a 150 ml conical flask containing 120 ml of liquid medium with antibiotics. Culture it overnight at 28 °C and 100 rpm, and measure its OD 600 to be between 0.85 and 0.9.

[0041] 2. Bacterial liquid collection: Divide the bacterial liquid in the conical flask into two 50 ml centrifuge tubes, centrifuge at 5000 rpm for 10 min, and discard the supernatant. Suspend the bottom precipitate with 45 ml of CCM-liquid, pour the suspension into the collection tank, and then repeat the above steps. Measure the OD of the bacterial liquid in the collection tank 600 to be between 0.5 and 0.6, and store it in the refrigerator for later use.

[0042] 3. Cotyledonary node genetic transformation: Select soybean seeds with uniform color, plump grains and no cracks for sterilization. Use chlorine gas generated by the chemical reaction HCl (concentrated) + NaClO → Cl2↑ + NaOH (the volume ratio of concentrated hydrochloric acid to sodium hypochlorite is about 1:10) for disinfection. This step is carried out in a fume hood for 6 - 7 hours. After sterilization, place the seeds on the laminar flow bench to fully disperse the residual chlorine gas, and then insert the seeds into the SG4 solid medium with forceps overnight. First, use a scalpel to cut the imbibed seeds in half along the middle of the cotyledons, remove the true leaves, and then gently make several incisions along the direction of the hypocotyl at the cotyledonary node part with the knife. Pour the treated explants and the suspended bacterial liquid in step 2) into a sterilized jar, and co-culture at 28°C and 120 rpm for 30 - 40 min. Finally, take out the explants, place the cotyledonary node side down on the solid co-culture medium CCM covered with a layer of filter paper, put 14 explants in each petri dish, and culture in the dark at 25°C for 5 days. After co-culturing for 5 days, sterilize the explants with sterilized water and Wash-Liquid, cut off the overly long hypocotyl, leaving about 5 - 10 mm, and insert the growth point obliquely upward at a 45-degree angle into the SIM solid medium. At this time, no herbicide resistance screening is carried out, 8 in each dish, and culture under light at 26°C for about 15 days. Then cut off the large buds and part of the hypocotyl, and transfer the explants with clustered buds to the SIM solid medium added with 6 mg / L glufosinate for screening. After continuing to culture for half a month, cut off the cotyledons, withered leaves and part of the hypocotyl of the explants that have not completely withered, and transfer them to the SEM solid medium added with 4 mg / L glufosinate for culture. Carry out the above operations once every half month until the buds elongate. When the buds of the explants elongate to about 6 cm, cut off the bottom, make a cross-shaped incision at the bottom of the stem, and transfer it to the rooting medium RM for culture. Induced roots can be seen after about 10 days. Pour an appropriate amount of sterile water into the bottle and culture under light at 26°C for about 5 days. When the number and length of the roots are appropriate, separate the tissue culture seedlings from the medium, transplant them into sterilized soil, and place them in an artificial incubator for growth (16 h light / 8 h dark, 25°C).

[0043] 4. The tissue culture seedlings transplanted into the soil are first detected with a Bar test strip, and then DNA is extracted from the leaves for PCR identification after the detection.

[0044] 3) Identification of GmAGL1 overexpression lines

[0045] 1. PCR detection: Take the leaves of transgenic plants to extract DNA. Use the overexpression identification primers F5: TCAGCAGGAAGCGTCCAAAT and R5: TAATCATCGCAAGACCGGCA to detect transgenic plants.

[0046] 2. qRT-PCR assay: Using F2 and R2 as primers, the transcriptional level changes of the target gene in overexpressing transgenic materials were detected. The results showed that compared with the control material Jack, the relative expression level of the target gene in the overexpressing materials was significantly increased ( Figure 4 ).

[0047] 4) Determination of protein components in transgenic soybean seeds

[0048] The data of 11S and 7S contents were collected according to the instructions of the glycinin and β-conglycinin ELISA kits (Beijing Longke Fangzhou Biotechnology Co., Ltd., China). An appropriate amount of soybean seeds was ground with a high-speed grinder, and the powder was passed through a 60-mesh sieve. The specific pretreatment steps and detection procedures were based on the kit instructions, and two technical replicates were performed for each material. The determination results showed that the content of the 7S protein component in overexpressing transgenic soybeans was significantly increased ( Figure 5 ).

[0049] 5) Determination of sulfur-containing amino acid content in transgenic soybean seeds

[0050] Transgenic soybean and wild-type Jack seeds with intact seed coats and the same size were selected, dried and then placed on a near-infrared grain analyzer (NIR) (Bruker, Vector 22 / N) for the determination of sulfur-containing amino acid content. The determination result of each sample showed three spectral data, and the results were expressed as a percentage of the soybean dry weight. The determination results showed that the content of sulfur-containing amino acids in overexpressing transgenic soybean seeds was significantly increased ( Figure 6 ).

Claims

1. Application of soybean GmAGL1 gene in changing soybean seed protein components and increasing sulfur-containing amino acid content; the nucleotide sequence of the soybean MADS box transcription factor encoding gene GmAGL1 is shown in SEQ ID NO.

1.

2. Application of the recombinant expression vector of soybean GmAGL1 in changing the protein components of soybean grains and increasing the content of sulfur-containing amino acids through genetic engineering; the nucleotide sequence of the transcription factor encoding gene GmAGL1 of the soybean MADS box is shown in SEQ ID NO.

1.

3. The use according to claim 2, characterized in that: The recombinant expression vector of the transcription factor encoding gene GmAGL1 containing the soybean MADS box is obtained by inserting the transcription factor encoding gene GmAGL1 into the space between MluI and SacI of the pBA002 vector.

Images