Construction and application technology of hypoglycemic antithrombotic lactic acid bacteria (HAL)

Abstract

The invention relates to construction and an application technology of blood-glucose-reducing and thrombus-resisting lactic acid bacteria (HAL). 5 copies of long-acting insulin enterotropin (rolGLP-1) are respectively and seamlessly connected and fused with nattokinase (NK) and hirudin (HV) in series to obtain the blood-glucose-reducing antithrombotic peptide gene (HAP), and the product has dual functions of preventing and treating diabetes and thrombus complications thereof. A food-grade lactic acid bacteria HAP secretory expression vector pMG36-LacZ-Usp45-5rolGLP-1-NK (and-HV) is created by using beta galactosidase selection markers, and MG1363 competent cells are transformed by using the food-grade lactic acid bacteria HAP secretory expression vector so as to obtain lactic acid bacteria HAL1 (secretory expression insulinotropin-nattokinase) and HAL-2 (secretory expression insulinotropin-hirudin) which are stable in heredity and efficiently secrete HAP. Through intragastric administration of HAL samples to mouse thrombus and diabetes models, it is proved that HAL has good blood glucose reducing and thrombus resisting effects. The invention can be used for developing difunctional dietary therapy type blood glucose-reducing and thrombus-resisting lactic acid bacteria health-care products and beverages for simultaneously treating diabetes and thrombus complications thereof.

Description

Technical Field

[0001] The present invention relates to a construction method and application technology of hypoglycemic and anti-thrombotic lactic acid bacteria (HAL), belonging to the field of biotechnology. Background Art

[0002] Diabetes mellitus is a metabolic syndrome caused by abnormal insulin secretion or function. Its main clinical features are hyperglycemia and the "three polyps" (polyuria, polydipsia, polyphagia, and weight loss). It is one of the most common chronic diseases worldwide, with the number of people with diabetes projected to reach 642 million by 2040. Currently, there is no effective cure for diabetes, and severe cases rely solely on long-term insulin injections to survive.

[0003] Diabetes is known as the "root of all diseases." Persistently high blood sugar levels can cause metabolic disorders in proteins, fats, water, and electrolytes, progressively leading to a series of complications (cardiovascular disease, eye disease, liver disease, kidney disease, and leg and foot gangrene). Cardiovascular complications (cerebral thrombosis and myocardial infarction) are the leading cause of mortality in diabetic patients, accounting for over 80%. The incidence of cerebral thrombosis in diabetics is 12 times higher than in non-diabetics. In 2015, 17.7 million people died from cardiovascular and cerebrovascular diseases worldwide, accounting for 31% of all deaths worldwide, making it the leading cause of death.

[0004] Glucagon-like peptide-1 (GLP-1), also known as incretin, is a 30-amino acid polypeptide derived from proglucagon. GLP-1 is known as a smart glucose-lowering polypeptide that can promote insulin secretion in a blood sugar-dependent manner. The higher the blood sugar, the stronger its insulinotropic effect. If the blood sugar concentration returns to normal, GLP-1 will no longer promote secretion, so it will not cause hypoglycemia. GLP-1 can also prevent pancreatic cell apoptosis, repair pancreatic β-cell function, promote pancreatic β-cell regeneration, increase pancreatic cell activity and prolong its lifespan, inhibit the release of glucagon, regulate pancreatic β-cell-specific gene expression, and improve glucose transport and metabolism through this gene regulation, thereby increasing β-cell responsiveness to glucose, reducing appetite, and inhibiting gastric emptying. Gastroenterology , 2002, 122: 531-544, Endocr Rev , 1995, 16: 390-410, Curr Diab Rep , 2003, 3: 365-372, Diabetologia , 1992, 35: 701-711, Digestion , 1994, 55:22-28, Endocrinol, 1992, 130: 159-166, Euro J Endocrinol 2000, 143: 717-725, J Clin Invest , 1993, 91: 301-307, Diabetes ,1989, 38: 902-909, J Clin Invest ,2000,105: 955-965, Diabetes ,1999, 48: 2270-2276, Gastroenterology , 1994, 107: 1948-1955). GLP-1 is considered a drug that can fundamentally treat diabetes, effectively treating the symptoms and the root cause, and is therefore of great significance for the treatment of diabetes. With the gradual deepening of research on the relationship between the structure and function of natural GLP-1 and the elucidation of the mechanism of its ultra-short half-life in vivo, there has been a surge in interest in structurally modifying GLP-1 to obtain long-acting GLP-1 that is resistant to degradation and to develop oral insulin-stimulating agents. In this regard, we were the first to clone the gene for a recombinant oral, long-acting GLP-1 (rolGLP-1) that is resistant to degradation by DPP-4 and trypsin (Minggang Li et al. 2007, Biotechnol. Lett 29: 1439-1446; Biosci Biotechnol. Biochem ,2007, 71: 1462 -1469; Chemical Research in Chinese Universities ,2009, 25, 882-886; Chinese Science Bulletin ,2009, 54, 4658-4663, Int J Pept Res Ther , 2012, 18: 327-333; 2013, 19, 257-263; Current Pharmaceutical Biotechnology , 2013, 14, 985-994; 2015, 16, 564-572; Appl Biochem Biotechnol , 2016, 179, 59–74; 2016, 181, 2, 483-494; 2016, 180(5), 841-851) and has been granted a national invention patent (ZL200510013514.1), which proves the effectiveness and feasibility of recombinant oral long-acting insulinotropic agent (rolGLP-1) in the treatment of type 2 diabetes, laying the foundation for the development of new oral insulinotropic drugs.

[0005] Nattokinase (NK) was first discovered in the traditional Japanese food natto. Bacillus subtilis ) is a serine protease secreted by the Experientia1987, 43, 1110-1111). It has been proven that nattokinase has a strong effect of reducing blood viscosity, improving blood circulation, softening and increasing blood vessel elasticity, etc. It can effectively prevent and treat cardiovascular and cerebrovascular diseases (cerebral thrombosis and myocardial infarction) and is also an ideal auxiliary treatment drug for diabetic patients in clinical practice (Fujita, M. et al. Biological& pharmaceutical bulletin 1995, 18, 1387-1391). Because it is derived from food, its safety has been widely accepted worldwide. More importantly, nattokinase can be absorbed by the intestines through oral administration and exert its function. It is currently the only protein drug that has been proven by rigorous scientific experiments to be absorbed by the intestines through oral administration and exert its function (Peng, Y et al. Appl Microbiol. Biotechnol 2005, 69, 126-132).

[0006] Hirudin (HV) is a Hirudomedieinalis ) A class of acidic small molecule proteins isolated and purified from the salivary glands, generally composed of 65-66 amino acids, with many acidic amino acids. The molecular weight of hirudin is about 7kDa. Hirudin is currently the best thrombin inhibitor and has great application value in the treatment and prevention of disseminated intravascular coagulation (DIC), cardiovascular and cerebral vascular embolism. Hirudin can prevent the effect of thrombin on fibrinogen and play a coagulation role. At the same time, it can inhibit platelet aggregation, accelerate thrombus dissolution, reduce blood viscosity, and have a good improvement effect on the thick, sticky, and aggregated state of patients with cardiovascular and cerebrovascular diseases due to abnormal blood rheology; hirudin can significantly lower blood lipids, regulate the relative balance of PGI and TXB in plasma, maintain the homeostasis of the intravascular environment, thereby preventing atherosclerosis and hyperlipidemia. It is the first choice for the treatment of cardiovascular and cerebrovascular diseases ( Biomed Biochim Acta , 1985,44: 1007-1013, Biochem. J .1994, 300: 643-650, Thromb Rest , 2003, 109: S17-S22, JPhar Sci , 2000, 89 (5): 579-585, Thromb Res , 2002, 106: V275-V284, Semin Thromb Hemost , 2001, 27(5): 543-9, Circulation , 2001, 103: 1479-1484, N Engl J Med , 1995, 332 (20): 1330-1335).

[0007] In order to prevent and treat chronic diseases such as diabetes, it is very important to develop simple, effective, economical and multifunctional dietary biological drugs that can simultaneously prevent and treat diabetes and its thrombotic complications. Biological drugs are a newly emerging oral delivery system for protein (peptide) drugs. They use living probiotics (yeast, lactic acid bacteria, etc.) as a sustained-release "capsule" for direct oral administration to achieve the purpose of treating chronic diseases. Its advantage is that it can save the expensive and tedious protein (peptide) collection, separation, and purification steps and retain the probiotic function of the probiotics themselves ( Int J Pharm , 2002, 249: 139-147, 235: 1-15, J Control Release , 2001, 71: 307-318, Curr. Opin. Biotechnol , 1993,4: 299-305, Microbiol. Res ,1997, 152: 171-179, J Biosci , 2019, 44: 9). The present invention is based on the latest concept of biological drugs, uses functional modularization and the principle of drug combination to construct an oral hypoglycemic and antithrombotic peptide gene that can prevent and treat diabetes and its thrombotic complications ( 5rolGLP-NK and 5rolGLP-HV ), the food-grade, safe lactic acid bacteria expression vector pMG36-LacZ, as well as the pMG36-LacZ-Usp45-5rolGLP1-NK and pMG36-LacZ-Usp45-5rolGLP1-HV hypoglycemic and antithrombotic peptide expression vectors, were used to transform MG1363 competent cells. Ultimately, the engineered lactic acid bacteria strain HAL, which is genetically stable and efficiently secretes and expresses hypoglycemic and antithrombotic peptides (HAP), was obtained. This is used to develop hypoglycemic and antithrombotic dairy products (yogurts) and beverages, as biopharmaceuticals, for the dietary treatment of chronic diseases such as diabetes. A literature search revealed no reports of hypoglycemic and antithrombotic lactic acid bacteria (HAL) biopharmaceuticals in China or abroad. Summary of the Invention

[0008] The purpose of the present invention is to: 1) clone two hypoglycemic and antithrombotic peptide genes ( 5rolGLP-1-NK and 5rolGLP-1-HV ), which contains 5 copies of tandem long-acting glucagon-1 ( rolGLP-1 ) gene and a single copy of nattokinase ( NK ) gene or hirudin ( HV ) gene. 2) Using a carbohydrate selection marker β-galactosidase gene (LacZ) that meets food-grade vector requirements (food safety), we replaced the erythromycin resistance gene (Emr) selection marker in the commercial vector pMG36e to create the food-grade universal expression vector pMG36-LacZ for lactic acid bacteria. 3) Using overlap extension PCR, we cloned the signal peptide gene of Lactococcus lactis MG1363 into the vector. Usp45 and 5rolGLP-1-NK and 5rolGLP-1-HVThe fusion genes were seamlessly concatenated and inserted into the pMG36-LacZ vector to construct the pMG36-LacZ-Usp45-5rolGLP-1-NK and pMG36-LacZ-Usp45-5rolGLP-1-HV expression vectors. These vectors were then used to transform MG1363 competent cells. Two genetically stable, highly efficient, secretory hypoglycemic and antithrombotic peptides (HAL) were identified: HAL-1 secretes insulinotropic nattokinase, and HAL-2 secretes insulinotropic hirudin. 4) HAL product samples were prepared, and mouse models of thrombosis and diabetes were established to determine the hypoglycemic and antithrombotic effects of HAL.

[0009] The present invention is achieved through the following technical solutions: First, two fusion genes are cloned using gene molecular cloning technology 5rolGLP-1-NK and 5rolGLP-1-HV .in 5rolGLP-1-NK The fusion gene contains five copies of the long-acting glucagon-like polypeptide-1 gene ( rolGLP-1 ) and a single copy of the nattokinase mature peptide gene NK ; 5rolGLP- Contains 5 copies ​ gene and a single copy of the hirudin gene HV, whose gene sequences are shown in the attached ​ shown.

[0010] cloned ​ and ​ Fusion genes in ​ The gene is obtained by using DNA synthesis technology to replace the 8th, 26th and 34th Ala, Lys and Lys of the natural glucagon-like polypeptide-1 (GLP-1) with Ser, Gln and Asp, thereby eliminating its internal DDP-4 and trypsin recognition sites to achieve the purpose of oral administration and long-term effect. It is named recombinant oral long-acting GLP-1 (Recombinant Oral Long-acting GLP-1, rolGLP-1).

[0011] cloned ​ and ​ Fusion genes are genes that use each copy ​ The gene encoding product has the characteristic that the last amino acid at the C-terminus is Arg (trypsin recognition site) and is obtained by seamless tandem fusion. This allows the encoded product, Hypoglycemic Anti-Thrombus (HAP), to be cleaved without loss by trypsin in the gastrointestinal tract into five complete copies of rolGLP-1 and a single copy of NK or HV after oral administration, providing hypoglycemic and antithrombotic effects in a 5:1 combination.

[0012] A food-grade lactic acid bacteria expression vector was constructed using gene manipulation technology. The construction process was to use a sugar screening marker β-galactosidase gene ( ​ ), replacing the erythromycin resistance gene in the commercial vector pMG36e ( ​ ) screening marker, thereby constructing the food-grade universal expression vector pMG36-LacZ for lactic acid bacteria.

[0013] Two engineered HAL strains, HAL-1 and HAL-2, were constructed to secrete and express the anti-diabetic and anti-thrombus lactic acid bacteria. The signal peptide gene of Lactococcus lactis MG1363 was cleaved by overlapping extension PCR. ​ and ​ and ​ The fusion genes were seamlessly concatenated and inserted into the pMG36-LacZ vector to obtain the pMG36-LacZ-Usp45-5rolGLP-1-NK and pMG36-LacZ-Usp45-5rolGLP-1-HV expression vectors, which were used to transform MG1363 competent cells, respectively, and the genetically stable and highly efficient secretory expression of hypoglycemic and antithrombotic peptide (HAP) lactic acid bacteria engineered strains HAL-1 (secreting insulinotropic-nattokinase) and HAL-2 (expressing insulinotropic-hirudin) were screened.

[0014] The genetic stability of the glucose-lowering and anti-thrombotic lactate HAL-1 (secreting and expressing insulinotropic-nattokinase) and HAL-2 (expressing insulinotropic-hirudin) was tested using continuous subculture detection technology. After 40 generations of subculture under standard culture conditions, no loss of the transferred expression plasmid vector was found, proving that the transferred glucose-lowering and anti-thrombotic peptide (HAP) gene can be stably inherited.

[0015] The two hypoglycemic and anti-thrombotic lactic acids HAL-1 (secreting and expressing insulinotropic-nattokinase) and HAL-2 (expressing insulinotropic-hirudin) constructed by the present invention are mixed with whole milk in a certain proportion and fermented at 52°C for 6-7 hours to prepare hypoglycemic and anti-thrombotic yogurt.

[0016] The two hypoglycemic and antithrombotic lactic acid bacteria HAL-1 and HAL-2 constructed by the present invention can be freeze-dried to prepare freeze-dried powder, and can be added with appropriate ingredients to prepare hypoglycemic and antithrombotic lactic acid bacteria tablets (Lactobacillin tablets) and hypoglycemic and antithrombotic lactic acid bacteria beverages (Lactobacillin drinks).

[0017] The hypoglycemic and antithrombotic lactic acid bacteria (HAL) and its products (yogurt, bacterial tablets and beverages) prepared by the above method can be used to prevent and treat diabetes and its thrombotic complications.

[0018] A mouse tail thrombosis model was constructed (a thrombosis mouse model was constructed by subcutaneous injection of 50 mg / kg of k-type carrageenan to cause thrombosis in the tail) and the prepared hypoglycemic and anti-thrombotic lactic acid bacteria (HAL) and its products (yogurt, bacterial tablets and beverages) were gavaged into the model mice. By observing the time and relative length of the thrombosis in the tail of the mice, it was proved that it can effectively delay the time of thrombosis in the model mice and significantly reduce the relative length of the thrombus.

[0019] A diabetic mouse model was constructed (type 2 diabetes was induced in mice by intraperitoneal injection of 50 mg / kg of streptozotocin (STZ) once a day for 3 consecutive days and feeding with a high-fat and high-sugar diet) and the prepared hypoglycemic and anti-thrombotic lactic acid bacteria (HAL) and its products (yogurt, bacterial tablets and beverages) samples were gavage-administered to the diabetic model mice for 12-15 days (once a day). The blood glucose levels of the mice were tested every 4 days. The results showed that the HAL can significantly reduce the blood glucose levels of the model mice and improve the diabetic symptoms of the model mice, such as polydipsia, polyphagia and polyuria.

[0020] Beneficial effects of the present invention: The present invention provides a new multifunctional dietary therapy biopharmaceutical technology that can be used to develop simple, effective, economical and applicable technologies that can simultaneously prevent and treat diabetes and its thrombotic complications. Biopharmaceuticals are a newly emerging oral delivery system for protein (peptide) drugs, which use living probiotic cells as a sustained-release "capsule" for direct oral administration to achieve the purpose of treating chronic diseases. It can eliminate the expensive and tedious steps of protein (peptide) collection, separation, and purification and retain the probiotic function of the probiotics themselves. Its prospects are very attractive and may bring a revolution to the treatment and delivery system of chronic diseases such as diabetes, bringing good news and hope to hundreds of millions of patients. Based on the latest concept of biopharmaceuticals, the present invention uses functional modularization and the principle of compatibility to construct an oral hypoglycemic and antithrombotic peptide gene ( ​ and ​ ), the food-grade universal expression vector pMG36-LacZ for edible lactic acid bacteria, as well as the pMG36-LacZ-Usp45-5rolGLP1-NK and pMG36-LacZ-Usp45-5rolGLP1-HV expression vectors, were used to transform MG1363 competent cells, and finally a genetically stable and highly efficient lactic acid bacteria engineered strain HAL (HAL1-2) that secretes and expresses hypoglycemic and antithrombotic peptides (HAP) was obtained. The research and development of dietary therapeutic biological drugs such as hypoglycemic and antithrombotic dairy products (yogurt) and beverages for the dietary treatment of chronic diseases such as diabetes has great economic and social benefits.

[0021] Description of the drawings:​ fusion gene ​ and ​ DNA sequence.

[0022] ​ ​ and ​ Agarose gel electrophoresis identification results of PCR products. A: ​ Agarose gel electrophoresis results of PCR products, lane M: DL2000 PlusMarker, lanes 1-3: electrophoresis bands of 5rolGLP1-NK. B: ​ Agarose gel electrophoresis results of PCR products, lane M: DNA Marker; lane 1: pET22b(+)-5rolGLP-HV; lane 2: plasmid and 5rolGLP-HV after enzyme digestion; lane 3: ​ ​ .

[0023] ​ Plasmid pMG36e- and ​ Agarose gel electrophoresis identification results. Lane M: DL2000PlusMarker, lanes 1-2: electrophoresis bands of pMG36e-, lanes 3-4: ​ electrophoresis bands.

[0024] ​ Agarose gel electrophoresis analysis of the constructed pMG36-LacZ vector and its PCR products. A: pMG36-LacZ plasmid electrophoresis analysis, lane M: DL2000 PlusMarker, lanes 1-3: pMG36-LacZ plasmid electrophoresis bands; B: PCR products electrophoresis analysis, lane M: DL2000 PlusMarker, lanes 1-8: PCR products.

[0025] ​ Agarose gel electrophoresis of the PCR product of the signal peptide gene Usp45. Lane M: DL2000PlusMarker, Lanes 1-4: Usp45 electrophoretic bands.

[0026] ​ ​ and Usp45-5rolGLP1-HV Agarose gel electrophoresis results of PCR products. A: Usp45-ai5rolGLP1-NK Agarose gel electrophoresis results of PCR products, lane M: 200 bp DNALadder, lanes 1-4: PCR products of Usp45-5rolGLP1-NK. B: Usp45-5rolGLP1-HVAgarose gel electrophoresis results of PCR products, M: DNA Marker; 1-3: pMG36e-usp45-5rolGLP-HV double-enzyme digestion products; 4: unenzyme-digested plasmid control.

[0027] Figure 7 Agarose gel electrophoresis identification results of the constructed pMD-19T-Usp45-5rolGLP1-NK plasmid. A: Electrophoresis results of the bacterial solution PCR product of pMD-19T-Usp45-5rolGLP1-NK, lane M: DL2000 PlusMarker, lanes 1-4: bacterial solution PCR products of pMD-19T-Usp45-5rolGLP1-NK. B: Xba I. Sac I double enzyme electrophoresis results, lane M: DL2000 PlusMarker, lanes 1-4: pMD-19T-Usp45-5rolGLP1-NK Xba I, SacI double digestion product.

[0028] Figure 8 Agarose gel electrophoresis analysis of the constructed pMG36-LacZ-Usp45-5rolGLP1-NK and pMG36-LacZ-Usp45-5rolGLP1-HV vectors. A: pMG36-LacZ-Usp45-5rolGLP1-NK identified by lipose gel electrophoresis. Lane M: DL2000 Plus Marker. Lanes 1-4: pMG36-LacZ-Usp45-5rolGLP1-NK bacterial suspension PCR results. B: pMG36-LacZ-Usp45-5rolGLP1-HV identified by lipose gel electrophoresis. Lane M: 200bp DNA Ladder. Lanes 1-4: pMG36-Usp45-5rolGLP1-HV bacterial suspension PCR results.

[0029] Figure 9 Analysis of plasmid genetic stability in pMG36-LacZ-Usp45-5rolGLP1-NK and pMG36-LacZ-Usp45-5rolGLP1-HV positive transformants. A: Analysis of plasmid genetic stability in pMG36-LacZ-Usp45-5rolGLP1-NK positive transformant (HAL-1). B: Analysis of plasmid genetic stability in pMG36-LacZ-Usp45-5rolGLP1-HV positive transformant (HAL-2).

[0030] Figure 10SDS-PAGE electrophoresis results for positive transformants of Lactobacillus spp. (HAL). A: SDS-PAGE results for HAL-1 positive transformants. Lane M: protein marker. Lanes 1-3: supernatants from centrifugation of positive transformant cultures. Lane 4: supernatants from ultrasonic cell pellets of positive transformants. B: SDS-PAGE results for HAL-2 positive transformants.

[0031] Figure 11 Results of in vitro antithrombotic activity testing of 5rolGLP1-NK. A: Results of in vitro antithrombotic activity testing of 5rolGLP1-NK, fibrin standard plate, B: fibrin plate with bacterial supernatant, C: Standard curve of concentration-lysis zone diameter.

[0032] Figure 12 Tail thrombosis in mice treated with the hypoglycemic and antithrombotic lactic acid bacteria (HAL) thrombosis model and control groups. a: Tail thrombosis in mice treated with HAL-1. A: Saline thrombosis group. A1, A2, and A3 represent tail thrombosis on days 3, 5, and 7 of administration, respectively. B: OHAL thrombosis group. B1, B2, and B3 represent tail thrombosis on days 3, 5, and 7 of administration, respectively. b: Tail thrombosis in mice treated with HAL-2. A: Normal control group. B: Saline thrombosis group. C: HAL thrombosis group.

[0033] Figure 13 Blood glucose changes in mice during gavage with the antidiabetic and antithrombotic lactic acid bacteria (HAL). A: Blood glucose changes in mice during gavage with the antidiabetic and antithrombotic lactic acid bacteria HAL-1. Normal represents the normal group; Saline represents the saline group; Rosiglitazone represents the rosiglitazone group; HAL-1 represents the antidiabetic and antithrombotic lactic acid bacteria group. (✱ indicates p < 0.05, ✱✱ indicates p < 0.01, and ✱✱✱ indicates p < 0.0001, vs. 1 day). B: Blood glucose changes in mice after 15 days of continuous gavage with the antidiabetic and antithrombotic lactic acid bacteria HAL-2 (5rolGLP-1-HV).

[0034] Specific embodiments: The examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0035] Example 1 Fusion Gene 5rolGLP-1-NK and 5rolGLP-1-HV The construction includes the following steps.

[0036] (1) Using plasmid DNA pET-22b(+)-5rolGLP-1-NK (gift from Professor Li Minggang of Nankai University) as a template, PCR amplification reaction was performed with primers P1 and P2. The PCR product was detected by electrophoresis. The results showed that there was a bright band at 1300 bp ( Figure 2 A) is consistent with the target band size of 5rolGLP1-NK, and the correct band was recovered by gel excision. PCR amplification was performed using plasmid DNA pET-22b(+)-5rolGLP-1-HV (a gift from Professor Li Minggang of Nankai University) as a template and primers P3 and P4. PCR products were detected by electrophoresis, and the results showed a bright band at 740 bp ( Figure 2 B), and 5rolGLP1-HV The target bands are of the same size and the correct bands can be recovered by gel cutting.

[0037] For amplification NK Primers: P1: 5'ATATTGCTAAACAAGATGCGCATTCTGAGGGTACCTTC3', P2: 5'CTGCAGGTCGACTCTAGACTATTATTGTGCAGC3'.

[0038] For amplification HV The primers were: P3 5'GATATTGCTAAACAAGATGCGGTCGACCATTCTGAGGGT 3', P4 5'GGTCGACTCTAGAATTATTGCAAGTATTCCTCTGGAATCTCC 3'.

[0039] (2) Recycling the cut rubber 5rolGLP1-NK and 5rolGLP1-HV The PCR products were cloned into the pMD19-T vector to construct pMD19-T-NK and pMD19-T-HV, respectively. The enzyme digestion and PCR identification were performed, and the results showed that the pMD19-T-NK and pMD19-T-HV vectors had been constructed.

[0040] Example 2 Construction of a food-grade lactic acid bacteria secretion expression vector pMG36-LacZ.

[0041] Plasmids pMG36e and pMV-LacZ (synthesized by BGI) were used as templates and PCR amplification was performed using the corresponding primers (LacZ F 5'TTAAC CGCGGATCCGCGCTATGCGGCATCAGA3', LacZ R 5'GAGGGTTATAGGAAGATCTTCCTTTACACTTTATGCTTCCGGC3', pMG36 F 5'GGAAGATCTTCCTATAACCCTCTTTAATTTGG3', pMG36 R 5'TTCGCGGATCCGTTTTTCGTGTGCCTA3'). PCR products were detected by electrophoresis. The results showed that bright bands were detected at 2900 bp and 400 bp, respectively. Figure 3 ), which was consistent with the target band size of pMG36e- and LacZ, and the correct band was recovered by gel excision.

[0042] The recovered pMG36e- was ligated with the LacZ fragment using an infusion kit. The ligation product was transformed into E. coli DH5α competent cells, and blue colonies were screened on an LB selection plate containing X-gal. The plasmid was extracted and subjected to electrophoresis detection. A bright band appeared at 3300 bp ( Figure 4 A). PCR was performed using LacZ primers in bacterial culture, and the PCR products were detected by electrophoresis. The results showed that a bright band appeared around 400 bp ( Figure 4 B), which is consistent with the size of the LacZ target band, preliminarily proved that the construction of pMG36-LacZ was successful.

[0043] The Usp45 gene was amplified by PCR and the genome of Lactococcus lactis MG1363 was extracted using the designed primers (Usp45 F5'AT TC GAGCTC ACCGAACTTAATGGGAGG3', Usp45 R 5'GTGAAGGTACCCTCAGAATGCGCATCTTGTTTAG3') were used for PCR amplification reaction, and the PCR products were detected by electrophoresis. The results showed that there was a bright band at 150 bp ( Figure 5 ), which is consistent with the size of the Usp45 target band, and the correct band was recovered by gel cutting.

[0044] Usp45 and 5rolGLP1-NK and 5rolGLP1-HV The recovered Usp45 and

[0042] 5rolGLP1-NK and 5rolGLP1-HVThe gene amplification products were seamlessly connected using the designed primers by overlapping PCR technology. The PCR products were detected by electrophoresis. The results showed that there was a bright band at 1450 bp, which was consistent with the size of the target band of Usp45-5rolGLP1-NK, indicating that Usp45 and 5rolGLP1-NK ( Figure 6 A) and 5rolGLP1-HV ( Figure 6 B) The gene was successfully connected, the correct band was recovered by gel excision, and cloned into the pMD-19T plasmid to construct pMD-19T-Usp45-5rolGLP1-NK and pMD-19T-Usp45-5rolGLP1-HV plasmids ( Figure 7 ).

[0045] Construction of lactic acid bacteria secretory expression vectors pMG36-LacZ-Usp45-5rolGLP1-NK and pMG36-LacZ-Usp45-5rolGLP1-HV. The prepared pMG36-LacZ, pMD-19T-Usp45-5rolGLP1-NK and pMD-19T-Usp45-5rolGLP1-HV plasmid DNAs were cleaved using restriction endonucleases. Xba I. Sac I double digestion for 2 h, the digestion products were detected by electrophoresis, the correct bands were recovered, and T4 DNA ligase was used to ligate at 16°C overnight. The ligation products were transformed into Escherichia coli DH5α competent cells, and blue colonies were screened on LB selection plates containing X-gal. The plasmid was extracted and detected by electrophoresis. The results showed that a bright band appeared at 4700 bp ( Figure 8 ), indicating that both pMG36-LacZ-Usp45-5rolGLP1-NK and pMG36-LacZ-Usp45-5rolGLP1-HV were successfully constructed.

[0046] Example 3 Construction of glucose-lowering and anti-thrombotic lactic acid bacteria and detection of genetic stability.

[0047] The plasmid with correct sequencing described in

[0045] was electrotransformed into competent cells of Lactococcus lactis MG1363, and the bacterial solution was spread on an MRS solid plate (containing X-gal). Blue colonies were selected as positive transformants. The genetic stability of the positive transformants was analyzed by inoculating the positive transformants in an MRS liquid medium at a ratio of 1%, 30°C, and streaking them onto MRS solid plates when the 5th and 10th generations were statically cultured. The culture was cultured at 30°C for 24 h. The culture medium cultured to the 10th generation was placed at 4°C to stop bacterial growth. The next day, the same ratio was continued to be inoculated into fresh MRS liquid medium. The operation of the previous day was repeated, and 50 single colonies were randomly selected from the MRS solid plate streaked the previous day and spotted on an MRS plate containing X-gal. After culturing at 30°C for 24 h, the percentage of blue colonies to all spotted colonies was calculated ( Figure 9 ), until the 40th generation, the results showed that the plasmid in the constructed positive transformation strain could still be stably inherited. The positive transformant bacteria were ultrasonically disrupted and then SDS-PAGE electrophoresis was identified, proving that the positive transformant could secrete and express the anti-diabetic and anti-thrombotic peptides (5rolGLP1-NK and 5rolGLP1-HV) ( Figure 10 ).

[0048] Example 4 Detection of the antithrombotic activity of hypoglycemic and antithrombotic lactic acid bacteria in model mice.

[0049] (1) Detection of the in vitro antithrombotic activity of glucose-lowering and antithrombotic lactic acid bacteria. Prepare standard solutions with urokinase concentrations of 5, 10, 20, 40, and 80 U / ml. The diameter of the dissolution zone of the fibrin plate ( Figure 11 ), and draw a concentration-dissolution zone diameter standard curve. Substituting the dissolution zone diameter of the sample plate into the standard curve, it can be deduced that the fibrinolytic activity of the supernatant of the centrifuged bacterial solution is 21.0 U / ml.

[0050] Detection of the in vivo antithrombotic activity of hypoglycemic and antithrombotic lactic acid bacteria. Fifteen three-week-old KM mice were randomly divided into a normal group (n=5), a saline thrombosis group (n=5) and a hypoglycemic and antithrombotic lactic acid bacteria (HAL) thrombosis group (n=5). Subsequently, both thrombosis groups were intraperitoneally injected with 1% carrageenan (50 mg / Kg). The HAL thrombosis group was immediately gavaged with HAL sample (16 mg / Kg). The normal group and the saline thrombosis group were gavaged with the same dose of saline. The time for the appearance of thrombosis in the tail of mice in each group was observed. The results showed that tail thrombosis appeared 15 hours after gavage in the saline thrombosis group, while tail thrombosis appeared 23 hours after gavage in the HAL thrombosis group, and the relative length of the thrombosis in the HAL group was significantly shorter than that in the saline thrombosis group ( Figure 12), indicating that HAL can affect the formation of tail thrombi in mice, delaying thrombosis to a certain extent. In the HAL thrombosis group, the relative length of tail thrombi remained unchanged on the third day of feeding, but their color became slightly lighter. On the fifth day of feeding, the relative length of tail thrombi began to shorten, and their color became significantly lighter. By the seventh day of feeding, the relative length and color of tail thrombi had significantly decreased, and no mice experienced tail amputation. Measurement of tail length revealed that the relative length of tail thrombi decreased from 81.50±2.5% to 16.03±1.1%. This indicates that the engineered strain constructed in this study can secrete a hypoglycemic and antithrombotic peptide, and that this fusion peptide can exert its antithrombotic effect in the gastrointestinal tract of mice, delaying thrombosis and exerting a certain therapeutic effect on thrombosis.

[0051] Detection of hypoglycemic activity of hypoglycemic and antithrombotic lactic acid bacteria.

[0052] Diabetic mouse modeling. Twenty-five C57 / BL male mice of similar growth stages were randomly divided into a normal group (n=5) and a modeling group (n=20). Type 2 diabetes was induced in mice by feeding them a 60% high-fat, high-sugar diet combined with a rapid intraperitoneal injection of streptozotocin. Three weeks after the normal diet and the high-fat, high-sugar diet, the modeling group mice were fasted for 12 hours but allowed free access to drinking water. A 50 mg / kg dose of streptozotocin was then rapidly injected intraperitoneally for three consecutive days. One week later, the mice were tail-clipped and their 6-hour fasting blood glucose levels were measured; blood glucose levels greater than 11.1 mmol / L were considered successful.

[0053] Effects of oral administration of hypoglycemic and antithrombotic lactic acid on the physiological state of model mice. After modeling, 15 successfully modeled mice were randomly divided into a normal saline group (n=5), a rosiglitazone group (n=5, dose 5 mg / Kg), and a HAL group (n=5, dose 16 mg / Kg). The feed of all mice in each group was replaced with normal feed. After 15 consecutive days of drug administration, it was observed that the activity level of mice in the normal saline group was the worst among all groups. Compared with the state before and after drug administration, there was no significant improvement, and even worse, and the "three mores and one less" diabetic symptoms still existed. In contrast, the activity level of mice in the rosiglitazone and HAL groups was significantly restored compared to before drug administration, their mental state also improved, and their food and water intake returned to normal.

[0054] Effects of oral administration of hypoglycemic and anti-thrombotic lactic acid on blood glucose in model mice. During the administration period, fasting blood glucose of each group of mice was monitored, and the changes in blood glucose of each group of mice on the 1st, 5th, 10th and 15th day of administration were measured and recorded. Figure 13Results showed that, although blood glucose levels in the normal group fluctuated during oral administration, they remained within the normal range. In the saline group, blood glucose levels continued to rise slightly during oral administration. In the rosiglitazone group, blood glucose levels decreased significantly from 14.8±1.0 mM to 6.4±0.7 mM, approaching the normal blood glucose level. In the HAL group, blood glucose levels decreased significantly from 15.02±0.9 mM to 7.38±0.4 mM. Both HAL-1 and HAL-2 mice showed some recovery in physiological status, body weight, and blood glucose levels during oral administration, mirroring the trend observed in the rosiglitazone group. Furthermore, the improvement trend lines were relatively flat, demonstrating that both HALs have therapeutic potential in treating type 2 diabetes and thrombosis, with HAL-1 and HAL-2 exhibiting similar glucose-lowering and antithrombotic effects.

[0055] Example 5 Development of dietary health products containing hypoglycemic and antithrombotic lactic acid bacteria (HAL).

[0056] The engineered lactic acid bacteria strains HAL-1 (secreting and expressing insulinotropic-nattokinase) and HAL-2 (expressing insulinotropic-hirudin) that efficiently secrete and express hypoglycemic and antithrombotic peptides (HAP) are used, mixed with plain old yogurt and whole milk (preferably high in protein and fat) as starters at a ratio of 1:5, and then placed in a sterilized fermentation container. 10 g of HAL-1 and HAL-2 bacteria are then added and mixed evenly. The mixture is fermented at 52°C for 5-7 hours to prepare hypoglycemic and antithrombotic yogurt. Hypoglycemic and antithrombotic lactic acid bacteria (HAL) can also be freeze-dried to produce a lyophilized powder (by adding 15% trehalose, 2% sodium thiosulfate, 15% mannitol, and 3% sorbitol to the collected bacterial pellet, mixing thoroughly, ultra-freezing at -80°C for 3 hours, and vacuum freeze-drying for 24 hours). Appropriate ingredients (flour) and sorbitol can then be added to produce hypoglycemic and antithrombotic lactic acid bacteria tablets and a hypoglycemic and antithrombotic lactic acid bacteria drink. HAL and its products (yogurt, tablets, and drinks) prepared using this method can be used to prevent and treat type 2 diabetes and its thrombotic complications.

Claims

1. Two hypoglycemic and antithrombotic peptide genes ( 5rolGLP-1-NK and 5rolGLP-1-HV ), which contain a 5-copy tandem of the long-acting glucagon-1 ( rolGLP-1 ) gene and a single-copy nattokinase ( NK ) gene or a hirudin ( HV ) gene, and the DNA base sequences and encoded amino acid sequences are shown in Figure 1 of the specification.

2. The 5rolGLP-1-NK and 5rolGLP-1-HV fusion gene according to claim 1, characterized in that: Using DNA synthesis technology, Ala, Lys, and Lys at positions 8, 26, and 34 of natural glucagon-like peptide-1 (GLP-1) were replaced with Ser, Gln, and Asp respectively, thereby obtaining GLP-1 that eliminates its internal DPP-4 and trypsin recognition sites, in order to achieve the purpose of oral administration and long-acting effect. Therefore, it was named recombinant oral long-acting GLP-1 (Recombinant Oral Long-acting GLP-1, rolGLP-1).

3. The 5rolGLP-1-NK and 5rolGLP-1-HV fusion gene according to claim 1, characterized in that: The fusion gene is seamlessly tandemly fused by utilizing the feature that the C-terminal terminal amino acid of the gene coding product is Arg (trypsin recognition site), so that its coding product, Hypoglycemic Anti-Thrombus Peptide (HAP), can be cut into 5 copies of intact rolGLP-1 and 1 copy of NK or HV without loss by trypsin in the gastrointestinal tract after oral administration, providing hypoglycemic and anti-thrombotic effects in a 5:1 compatibility mode. rolGLP-1 The C-terminal terminal amino acid of the gene coding product is Arg (trypsin recognition site), and the fusion gene is seamlessly tandemly fused. After oral administration, its coding product, Hypoglycemic Anti-Thrombus Peptide (HAP), can be cut into 5 copies of intact rolGLP-1 and 1 copy of NK or HV without loss by trypsin in the gastrointestinal tract, providing hypoglycemic and anti-thrombotic effects in a 5:1 compatibility mode.

4. A food-grade lactic acid bacteria expression vector, characterized in that: Using the sugar screening marker β-galactosidase gene that meets the requirements of food-grade carriers (edible safety) LacZ ), replacing the erythromycin resistance gene screening marker in the commercial vector pMG36e Emr ), a food-grade universal expression vector pMG36-LacZ for lactic acid bacteria was created.

5. Two kinds of hypoglycemic anti-thrombus lactic acid bacteria (HAL), characterized in that: Using the overlap extension PCR technique, the signal peptide gene of Lactococcus lactis MG1363 Usp45 and the 5rolGLP-1-NK and 5rolGLP-1-HV fusion genes were seamlessly concatenated and inserted into the pMG36-LacZ vector to construct the pMG36-LacZ-Usp45-5rolGLP-1-NK and pMG36-LacZ-Usp45-5rolGLP-1-HV expression vectors. The competent cells of MG1363 were transformed with them, and the engineering lactic acid bacteria strains HAL-1 (secreting and expressing insulinotropic nattokinase) and HAL-2 (expressing insulinotropic hirudin) with genetic stability and high-efficiency secretion and expression of hypoglycemic and antithrombotic peptide (HAP) were screened and obtained.

6. The technology for developing hypoglycemic and antithrombotic yogurt, tablets, and beverages based on the hypoglycemic and antithrombotic lactic acid bacteria (HAL1-2) described in claim 5, characterized in that: ① Hypoglycemic and antithrombotic yogurt fermented by the hypoglycemic and antithrombotic lactic acid bacteria (HAL1-2); ② Hypoglycemic and antithrombotic lactic acid bacteria tablets (Lactobacillin tablet) and hypoglycemic and antithrombotic lactic acid bacteria beverages (Lactobacillin drink) formed by freeze-drying the hypoglycemic and antithrombotic lactic acid bacteria (HAL1-2).

Images