Application of ZmWOX5b gene in improving genetic transformation efficiency of different maize inbred lines

By applying the ZmWOX5b gene and its encoded protein to maize and using Agrobacterium-mediated transformation, the problem of maize transformation being limited by genotype was solved, and the transformation efficiency was significantly improved, thus promoting the progress of maize functional genomics research and bio-breeding.

CN120230790BActive Publication Date: 2025-11-21UNIV OF SCI & TECH BEIJING +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510714949.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-30
Publication Date
2025-11-21
Estimated Expiration
2045-05-30

AI Technical Summary

Technical Problem

The genetic transformation technology of maize suffers from genotype dependence and low transformation efficiency, making it difficult to meet the needs of modern agriculture and biotechnology research, and affecting gene function research and the creation of new germplasm resources.

Method used

Using the ZmWOX5b gene and its encoded protein, maize genetic transformation was performed via Agrobacterium-mediated transformation, which significantly improved the transformation efficiency of maize inbred lines of different genotypes.

Benefits of technology

It significantly improved the genetic transformation efficiency of maize inbred lines, broadened the selection range of transformation recipient inbred lines, and promoted the progress of maize functional genomics research and bio-breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120230790B_ABST
    Figure CN120230790B_ABST
Patent Text Reader

Abstract

The application relates to the field of plant genetic engineering, and discloses ZmWOX5b application of a gene in improving corn genetic transformation efficiency. ZmWOX5b The gene is separated, a recombinant carrier, an expression box or a recombinant bacterium containing the gene is constructed, corn inbred lines B73, B104, Zheng 58, FSJ115 and Xiang 249 are genetically transformed by using an agrobacterium-mediated method, and research results show that the gene can significantly improve the transformation efficiency. Compared with a traditional method, the application not only effectively improves the efficiency of an easy-to-transform genotype, but also greatly improves the transformation effect of a difficult-to-transform corn inbred line, effectively breaks through the restriction of a receptor genotype in corn genetic transformation. The achievement significantly widens the application range of corn genetic transformation, and provides a new tool for efficiently carrying out corn high-yield, high-quality, disease and pest resistance and stress resistance trait gene function research and application.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of plant genetic engineering, and particularly relates to ZmWOX5b Application of the gene in efficient genetic transformation of maize. BACKGROUND

[0002] Since the successful application of plant transgenic technology in the 1980s, remarkable progress has been made in the research of improving crops by genetic engineering. In recent years, transgenic maize has become one of the important directions of agricultural technology development due to its advantages in improving yield, enhancing resistance, improving quality, and reducing the use of pesticides and fertilizers. However, compared with the wide application of transgenic technology in other crops, the genetic transformation of maize still faces technical bottlenecks. At present, the maize transformation technology worldwide is limited by genotype dependence and low transformation efficiency, which is difficult to meet the actual needs of modern agriculture and biotechnology research. This limitation not only affects the in-depth development of gene function research, but also restricts the creation of new germplasm resources and the application of gene editing and synthetic biology technology. In recent years, with the advancement of maize genome sequencing and functional gene research, it is particularly important to develop efficient, safe and suitable for multiple genotypes of maize transformation system. On the one hand, the functional identification of target genes needs to overcome the influence of insertion site, copy number and other factors on expression effect; on the other hand, in order to meet the breeding goals of high yield, high quality, disease and pest resistance, it is urgent to improve the genetic transformation efficiency and expand the scale of transformation. The establishment of innovative maize transformation technology can not only accelerate the functional verification and breeding application of candidate genes, but also lay a solid foundation for promoting the industrialization of transgenic maize and maize functional genomics research.

[0003] The WUSCHEL-related homeobox (WOX) gene family is an important transcription factor family in plants, which is involved in multiple processes such as embryonic development, stem cell maintenance and organogenesis of plants. The first gene of the WOX family WUS ( WUSCHEL ) was discovered by Laux et al. in 1996 (Laux et al., 1996), and studies have shown that WUS The gene maintains the activity and stability of stem cells by regulating stem cell proliferation and differentiation in shoot apical meristems. The absence of WUSGenes can cause premature differentiation of stem cells, which in turn affects the growth of plants. The WOX family includes multiple members, such as WOX1 to WOX14, which play a role in the embryonic development and postembryonic development of plants (Deyhle et al, 2007). In particular, WOX5 maintains stem cell activity in the root apical meristem and is essential for root development. Genes such as WOX3, WOX13, and WOX14 regulate the development of flowers and roots and adjust the dynamic balance of stem cells in response to environmental changes (Rasheed et al, 2024).

[0004] Recent studies have shown that TaWOX5 Genes not only improve the transformation efficiency of wheat, but also significantly improve the transformation efficiency of other cereal crops such as barley, rye, black wheat, and triticale. TaWOX5 The application of the gene has significantly improved the transformation frequency of some difficult-to-transform barley varieties. Currently, there is no report on the function research and application of WOX genes in corn inheritance transformation. SUMMARY

[0005] In view of the shortcomings of the prior art, the present application aims to provide ZmWOX5b The application of the gene and its encoded protein in corn genetic transformation. The present application successfully isolates the ZmWOX5b gene, and carries out genetic transformation experiments through Agrobacterium-mediated method, and the results show that the gene can significantly improve the transformation efficiency of different genotypes of corn inbred lines. ZmWOX5b The discovery and application of the gene in improving the genetic transformation efficiency of corn not only help to expand the inbred line range of corn transformation receptors, but also promote the research progress of corn functional genomics and accelerate the process of corn biological breeding, which has important potential value.

[0006] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:

[0007] In a first aspect of the present application, a corn ZmWOX5b gene is cloned;

[0008] In a second aspect of the present application, the application of the ZmWOX5b gene in high-efficiency genetic transformation of corn is provided;

[0009] The ZmWOX5b gene is a nucleic acid molecule as shown in (1) or (2):

[0010] (1) The nucleotide sequence is a nucleic acid molecule as shown in SEQ ID NO. 1;

[0011] (2) A nucleic acid molecule encoding the amino acid sequence as shown in SEQ ID NO. 2 other than (1).

[0012] In a third aspect of the present application, there is provided ZmWOX5b Use of a gene-encoded protein in improving genetic transformation efficiency of maize

[0013] The ZmWOX5b The gene-encoded protein is a protein as shown in (1) or (2) below:

[0014] (1) a protein consisting of the amino acid sequence shown in SEQ ID NO. 2 in the sequence listing;

[0015] (2) a fusion protein obtained by connecting a protein tag to the N terminus and / or C terminus of the protein defined in (1). The proteins of (1) and (2) can be artificially synthesized or obtained by first synthesizing the encoding gene and then performing biological expression.

[0016] In the above protein, the protein tag refers to a polypeptide or protein fused and expressed with the target protein by DNA in vitro recombination technology, so as to facilitate the expression, detection, tracking and / or purification of the target protein. In order to facilitate the purification of the protein in (1), a tag can be connected to the amino terminus or carboxyl terminus of the protein in (1). The tag can be Poly-His (usually 6 HHHHHH), FLAG (DYKDDDDK) or c-Myc (EQKLISEEDL), etc.

[0017] In a fourth aspect of the present application, there is provided a method for improving the transformation efficiency of a nucleic acid molecule into a target plant: introducing a ZmWOX5b gene and a nucleic acid molecule into the target plant to achieve the purpose of improving the transformation efficiency of the nucleic acid molecule into the target plant. The ZmWOX5b The gene is a nucleic acid molecule as shown in (1) or (2) below:

[0018] (1) a nucleic acid molecule with the nucleotide sequence shown in SEQ ID NO. 1;

[0019] (2) a nucleic acid molecule other than (1) encoding the amino acid sequence shown in SEQ ID NO. 2.

[0020] In the above method, ZmWOX5b The gene and the nucleic acid molecule can be introduced into the target plant by one vector or by different vectors.

[0021] Advantages of the present application:

[0022] The present application first discovers the key role of the maize ZmWOX5b gene in promoting the genetic transformation efficiency of plants. The present study shows that Figure 1The gene can significantly improve the genetic transformation efficiency of corn inbred lines B73, B104, Zheng58, FSJ115 and Xiang249, effectively break through the technical bottleneck of corn transformation limited by genotype, and broaden the selection range of transformation receptor inbred lines. This not only provides an important tool for analyzing corn functional genomics, but also shows wide application potential in biological breeding, and has important economic value and social benefits for realizing the directional improvement of crop high yield, high quality and stress resistance. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 2 Figure 1 is a schematic diagram of the structure of recombinant plasmid pG3GB411-mCherry.

[0024] Figure 3 Figure 2 is a schematic diagram of the structure of plant expression vector pG3GB411-ZmWOX5b.

[0025] Bar Figure 3 is a T0 seedling of the gene. Figure 4 PCR detection results of the gene.

[0026] ZmWOX5b Figure 4 is a comparison of the callus regeneration phenotype of the control group and overexpression ZmWOX5b. DETAILED DESCRIPTION

[0027] Example 1 ZmWOX5b Cloning of the gene

[0028] The RNA of the immature embryo of corn inbred line B73 after 9 days of pollination was extracted, and reverse transcription was carried out to synthesize cDNA as a template, and the gene was amplified ZmWOX5b The full length of the CDS region of the gene is 660 bp. The amplification system is shown in Table 1:

[0029] Table 1 ZmWOX5b Gene amplification system

[0030]

[0031] The primer sequence is as follows (5'-3'):

[0032] WOX5b-F: GCTTAACTGGCGGTGTAGTG

[0033] WOX5b-R: CTACACAATGATGCGTGAGAC

[0034] PCR reaction program: 95 ℃ pre-denaturation 5 min; 98 ℃ denaturation 10 s, 59 ℃ annealing 30 s, 68 ℃ extension 30 s, 32 cycles; 68 ℃ extension 5 min, 16 ℃ incubation. The obtained PCR product was analyzed by 1.5% agarose gel electrophoresis. The target fragment was recovered by cutting the gel. The above PCR product was ligated to pEASY-Blunt Zero Cloning Vector (CB501, full formula gold) vector to obtain pEASY-Blunt-TaWOX5. The sequence of the PCR product obtained by sequencing is shown as SEQ NO. 1, named Figure 1 ZmWOX5b.

[0035] Example 2 Construction of pG3GB411-mCherry and pG3GB411-ZmWOX5b vectors

[0036] The target fragment mCherry (purchased from Wuhan Moli Biological Technology Co., Ltd.) and pG3GB411 plant expression vector (purchase link: https: / / www.addgene.org / 134748 / ) were cut with BamHI enzyme, and the fragments were recovered according to the steps of the PCR product purification kit (purchased from Tiangeng Biochemical Technology Co., Ltd.). The two fragments were ligated with homologous recombination enzyme (purchased from Yixing Biological Technology Co., Ltd.), and the ligation system is shown in Table 2.

[0037] Table 2 Ligation system of mCherry and pG3GB411 enzyme cutting fragments

[0038]

[0039] The ligation reaction was carried out at 50 ℃ for 20 min to construct the recombinant plasmid pG3GB411-mCherry. Figure 2

[0040] The target ZmWOX5b fragment prepared in Example 2 and the pG3GB411 plant expression vector were cut with BamHI enzyme, and the fragments were recovered according to the steps of the PCR product purification kit (purchased from Tiangeng Biochemical Technology Co., Ltd.). The two fragments were ligated with homologous recombination enzyme (purchased from Yixing Biological Technology Co., Ltd.), and the ligation system is shown in Table 3.

[0041] Table 3 Ligation system of ZmWOX5b and pG3GB411

[0042]

[0043] ​50 ℃ for 20 min, and the recombinant plasmid pG3GB411-ZmWOX5b was constructed. Bar ].

[0044] The pG3GB411-ZmWOX5b and the control vector pG3GB411-mCherry were transformed into the Agrobacterium pVS1-LBA4404 competent cells, and the Agrobacterium strains available for transformation were obtained.

[0045] Example 3 Agrobacterium-mediated maize immature embryo transformation

[0046] I. Agrobacterium-mediated maize immature embryo genetic transformation

[0047] Three days before the infection, the pVS1-LBA4404 Agrobacterium containing pG3GB411-ZmWOX5b and pG3GB411-mCherry were inoculated on YEP solid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and placed in a 28°C incubator for 1-2 days of dark culture. Single colonies were picked for subsequent preparation of seed bacterial liquid.

[0048] Freshly peeled 1.2-1.8 mm maize inbred lines B73, B104, Zheng58, FSJ115 and X249 (Xiang249) immature embryos were selected as recipient materials. The peeled maize embryos were placed in 2 mL centrifuge tubes containing 1.8 mL suspension, and the peeling process lasted no more than 1 hour, and about 60 immature embryos were placed in each centrifuge tube.

[0049] After the pVS1-LBA4404 Agrobacterium containing pG3GB411-ZmWOX5b and pG3GB411-mCherry were resuspended and infected, the scutellum of the immature embryos was placed on the co-culture medium (1 / 2 MS basic medium, sucrose 20 g / L, glucose 10 g / L, acetosyringone 100 μM and agarose 8 g / L) and placed in a 23°C incubator for 2 days of dark culture.

[0050] After co-culture, the immature embryos were transferred to the recovery medium (MS basic medium, MS vitamins, 2,4-D 0.5 mg / L, Picloram 2.2 mg / L, casein 0.1 g / L, sucrose 30 g / L, AgNO3 40 μM, temik 200 mg / L and phytagel 3 g / L) and placed in a 28°C incubator for 7-10 days of dark culture.

[0051] The callus after recovery culture was transferred to differentiation medium I (MS basic medium, sucrose 60 g / L, myo-inositol 1 g / L, 6-BA 1 mg / L, zeatin 5 mg / L, thidiazuron 200 mg / L, phytagel 3 g / L and Bialaphos 1.5 mg / L) for differentiation screening culture, and cultured in a 25°C incubator under illumination for 16 hours for 10-14 days.

[0052] The green regenerated shoots that had grown were transferred to differentiation medium II (differentiation medium I with Bialaphos 2.0 mg / L) for high-concentration screening, and cultured in a 25°C incubator under illumination for 16 hours for 10-14 days.

[0053] When the regenerated seedlings had grown to 3 leaves, the seedlings were transplanted to rooting medium and cultured indoors. After the seedlings had grown new leaves and roots, they were removed from the rooting medium and transplanted to a small pot containing nutrient soil and vermiculite (1:3 by volume). When the seedlings had grown 2-3 new leaves, they were transplanted to a field.

[0054] II. Statistics of transformation efficiency of different genotypes of corn inbred lines

[0055] Using Bar The pG3GB411 vector contains Figure 3 The primer (F: TGCACCATCGTCAACCACTACAT; R: GCTGCCAGAAACCCACGTCAT) was used to perform PCR amplification on the pG3GB411-ZmWOX5b seedlings with B104 as the receptor. The results are shown in Bar Figure 2. M: 5000 bp DNA marker; lane 1 is the pG3GB411-ZmWOX5b vector as a positive control, lane 2 is the ordinary corn inbred line B104 as a negative control; lanes 3-50 are T0 seedlings of pG3GB411-ZmWOX5b. Among the 48 T0 seedlings tested, 7 were negative seedlings, 41 were positive seedlings, and the positive rate of transgenic seedlings was 85.42%.

[0056] Further according to the detection results of all transgenic seedlings Figure 4 The resistance callus induction rate, regeneration efficiency of callus into positive seedlings, and the final transformation efficiency of different inbred lines were analyzed according to the detection results of the resistance callus induction rate, regeneration efficiency of callus into positive seedlings, and the final transformation efficiency of different inbred lines. Among them, the resistance callus induction rate = (number of resistance calli / number of immature embryos) x 100%, the regeneration efficiency = (number of positive seedlings / number of resistance calli) x 100%, and the transformation efficiency = (number of positive seedlings / number of immature embryos) x 100%. The results are shown in Table 4 and ZmWOX5bAs shown, compared with the vector pG3GB411-mCherry (control) which does not contain the ZmWOX5b gene, the pG3GB411-ZmWOX5b vector (ZmWOX5b-OE) can significantly improve the transformation efficiency of the same maize variety. The first reference genome for maize is the B73 genome, published in 2009, which greatly promoted the discovery of functional genes and the analysis of the genetic mechanisms of important traits. In transformation experiments of transgenic maize inbred lines, B73 showed significant difficulties in callus induction and transformation. In the control group, the callus induction rate of B73 was only 5.68%, almost unable to produce transgenic plants, and its transformation efficiency was close to zero; however, when introduced… ZmWOX5b After vectorization, the callus induction rate increased significantly from 5.68% to 79.81%, and the transformation efficiency increased significantly from 0 to 47.12%. For B104, which has a high transformation efficiency, the transformation efficiency also increased substantially. The control group had a callus induction rate of 64.00%, a regeneration efficiency of 31.25%, and a final transformation efficiency of 20%, while the vector-transformed B104 showed a significant improvement. Figure 4 After carrier inoculation, the callus induction rate increased to 96.71%, the regeneration efficiency increased to 80.68%, and the conversion efficiency jumped to 78.02% (Table 4 and 2000). ZmWOX5b ).

[0057] In addition, the maize inbred lines Zheng 58 and Xiang 249, which have consistently had low conversion rates, have also experienced challenges in conversion. ZmWOX5b After introduction of the carrier, both callus induction rate and transformation efficiency were significantly improved. For Zheng 58, the callus induction rate increased from 27.42% to 71.62%, the callus regeneration efficiency increased from 17.65% to 77.36%, and the transformation efficiency increased from 4.83% to 55.41%. For X249 (Xiang 249), the callus induction rate increased from 49.25% to 91.18%, the callus regeneration efficiency increased from 21.21% to 56.45%, and the transformation efficiency increased from 10.45% to 51.47%. Notably, the FSJ115 variety, previously considered incapable of effective transformation, showed improvement after the introduction of the carrier. ZmWOX5b After the vector was applied, the callus induction rate increased from 7.01% to 71.16%, and the conversion efficiency also reached 26.92%.

[0058] Table 4. Statistical analysis of transformation efficiency of different maize inbred lines

[0059]

[0060] Further analysis showed that although some callus tissue in the control group differentiated into seedlings, it was different from that containing... Figure 4 Compared to callus tissue, the former showed a higher rate of browning necrosis (…). ZmWOX5b This indicates that... ZmWOX5bThe vector not only significantly improves the callus induction rate of corn inbred lines, but also improves the health status of callus and increases the regeneration efficiency of callus differentiation into seedlings, thereby showing an increase in transformation efficiency.

[0061] From the above results, it can be seen that, ​ The gene can improve the transformation efficiency of different corn inbred lines, and to some extent solve the problem of serious dependence on the genotype of the receptor in corn genetic transformation.

[0062] References

[0063] Laux T, Mayer K F X, Berger J, et al. The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis[J]. Development, 1996,122(1): 87-96.

[0064] Deyhle F, Sarkar A K, Tucker E J, et al. WUSCHEL regulates cell differentiation during anther development[J]. Developmental biology, 2007,302(1): 154-159.

[0065] Rasheed H, Shi L, Winarsih C, et al. Plant Growth Regulators: An Overview of WOX Gene Family[J]. Plants, 2024, 13(21): 3108.

Claims

1. ZmWOX5b Application of genes in improving the efficiency of maize genetic transformation; the aforementioned ZmWOX5b The gene is a nucleic acid molecule as shown in (1) or (2) below, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO. 2; (1) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO. 1; (2) Nucleic acid molecules other than (1) that encode the amino acid sequence shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The ZmWOX5b The gene improved the induction rate and regeneration efficiency of resistant callus in recipient plants, thereby increasing the efficiency of maize genetic transformation.

3. ZmWOX5b The application of gene-encoded proteins in improving the efficiency of maize genetic transformation; characterized by, The ZmWOX5b The protein encoded by the gene is the protein shown in (1) or (2) below: (1) A protein consisting of the amino acid sequence shown in SEQ ID NO. 2 of the sequence listing; (2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (1).

4. A method for improving the efficiency of introducing exogenous nucleic acid molecules into maize for transformation, characterized in that, Will ZmWOX5b The transfer of genes and exogenous nucleic acid molecules into maize aims to improve the transformation efficiency of the target plant by introducing nucleic acid molecules; ZmWOX5b Genes are nucleic acid molecules as shown in (1) or (2) below: (1) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO. 1; (2) Nucleic acid molecules other than (1) that encode the amino acid sequence shown in SEQ ID NO. 2.

Citation Information

Patent Citations

  • Method for improving transformation efficiency of plant and method for transforming plant

    CN111278849A

  • WOX genes

    CN114096672A