A method for improving peroxisome localization specificity and its application

Abstract

The present invention relates to the fields of biotechnology and plant technology, and proposes a method for improving peroxisome localization specificity and its application, comprising the following steps: S1, fusing the peroxisome N-terminal localization sequence PTSp and the type I signal peptide PTS1, such as the nucleotide sequence shown in SEQ ID No. 1, with a target gene through homologous cloning to express, thereby obtaining a PTSp-target gene-PTS1 fusion construct; S2, transforming the fusion construct into Agrobacterium; S3, injecting the transformed Agrobacterium into plant leaves using an Agrobacterium-mediated transient transformation system; S4, performing fluorescence imaging using a laser confocal microscope to detect the specific localization of the target gene in peroxisomes in plant cells. This method solves the problem of non-specific localization of a single peroxisome signal peptide, provides a favorable method for plant subcellular localization research, and is of great significance.

Description

Technical Field

[0001] The present invention relates to the fields of biotechnology and plant technology, and in particular to a method for improving peroxisome localization specificity and an application thereof. Background Art

[0002] Plant cells primarily consist of two major parts: the cell wall and the protoplast. The protoplast, in turn, contains the cell membrane, cytoplasm, and nucleus. The cytoplasm includes the cytoplasmic matrix and organelles such as mitochondria, chloroplasts, endoplasmic reticulum, vacuoles, Golgi apparatus, peroxisomes, and lysosomes. The normal functioning of cells depends on the dynamic changes in protein types, content, and modification states under specific spatial distributions, thereby precisely regulating various biological processes. Therefore, subcellular localization, as a core element, plays a decisive role in the physiological functions of proteins within cells. Protein subcellular localization analysis has become a widely used experimental method in the field of gene function exploration. It can provide key reference information for clarifying the specific functions of proteins encoded by unknown genes and occupies an important position in the process of modern biological research.

[0003] Organelle labeling is a fundamental tool in cell biology. Its conventional use is to track and detect the dynamic behavior of the corresponding organelles, and to assist in accurately locking the subcellular localization coordinates of biological macromolecules. The application of fluorescent proteins enables researchers to accurately determine the localization of proteins through fluorescence imaging, but sometimes there is a lack of accurate and single reference materials, and the targeting specificity of proteins cannot be determined. Therefore, a visual fluorescent organelle labeling is of key value and can serve as a benchmark for the localization of proteins at the subcellular level, especially for proteins whose localization characteristics are manifested as a punctate fluorescence distribution pattern in plant peroxisomes. Its precise positioning role is increasingly prominent.

[0004] Plant peroxisomes play an important role in all stages of growth and development, as well as in responding to environmental stress. They are small, simple, and richly metabolically diverse organelles enclosed by a single membrane. They possess distinct tissue and species specificities. Peroxisomes play a crucial role in biological processes such as fatty acid degradation, plant hormone synthesis, reactive oxygen species scavenging, and photorespiration. Current research indicates that most peroxisomal proteins contain a C-terminal tripeptide localization signal, PTS1. However, in most cases, a single PTS1 signal peptide cannot achieve specific localization. Furthermore, an N-terminal localization signal peptide, PTS2, exists, but it is poorly conserved and has been less thoroughly studied. Studying the plant peroxisomal proteome has crucial applications in cell biology and agricultural biotechnology. Therefore, developing a method for specific localization of plant peroxisomes is of great scientific significance for enriching marker libraries and introducing target proteins. Summary of the Invention

[0005] In view of this, the present invention proposes a method for improving the specificity of peroxisome localization and its application, which can solve the problem of non-specific localization of a single peroxisome signal peptide.

[0006] The technical solution of the present invention is achieved as follows: In a first aspect, the present invention provides a method for improving the localization specificity of peroxisomes, comprising the following steps:

[0007] S1, the peroxisome N-terminal localization sequence PTSp and the type I signal peptide PTS1, whose nucleotide sequence is shown in SEQ ID No. 1, are fused and expressed with the target gene by homologous cloning to obtain a PTSp-target gene-PTS1 fusion construct;

[0008] S2, transformation of the fusion construct into Agrobacterium;

[0009] S3, the transformed Agrobacterium was injected into plant leaves using the Agrobacterium-mediated transient transformation system;

[0010] S4, fluorescence imaging using laser confocal microscopy to detect the specific localization of the target gene in peroxisomes in plant cells.

[0011] On the basis of the above technical solution, preferably, the nucleotide sequence of the type I signal peptide PTS1 is as shown in SEQ ID No. 2.

[0012] On the basis of the above technical solution, preferably, in step S1, the target gene is an exogenously introduced transgenic gene or an endogenous gene, and its expression product is a protein or a polypeptide.

[0013] On the basis of the above technical solution, preferably, the target genes are selected from red fluorescent protein mKate2 and actin AtActin2.

[0014] In a second aspect, the present invention provides a fusion gene construct for improving peroxisome localization specificity, comprising a peroxisome N-terminal localization sequence PTSp, a type I signal peptide PTS1 and a target gene, wherein the nucleotide sequence of the N-terminal localization sequence PTSp is shown in SEQ ID No. 1.

[0015] On the basis of the above technical solution, preferably, the target genes are red fluorescent protein mKate2 and actin AtActin2.

[0016] In a third aspect, the present invention provides an expression cassette for improving peroxisome localization specificity, comprising a fusion gene construct.

[0017] In a fourth aspect, the present invention provides the use of the above-mentioned method or fusion gene construct or expression cassette in plant subcellular localization research.

[0018] The method for improving peroxisome localization specificity and its application of the present invention have the following beneficial effects compared with the prior art:

[0019] The present invention localizes the target gene to the peroxisome by fusion expression of the peroxisome N-terminal localization sequence PTSp and the type I signal peptide PTS1 through homologous cloning. Subsequently, Agrobacterium tumefaciens is transformed with the red fluorescent protein mKate2 and the actin AtActin2 target genes through Agrobacterium-mediated transient genetic transformation. The target genes are then injected into tobacco leaves, and fluorescence imaging is performed using a laser confocal microscope to obtain a fluorescent signal that specifically localizes the peroxisome. This invention solves the problem of non-specific localization of single peroxisomal signal peptides, providing a promising method for plant subcellular localization research and is of great significance.

[0020] The plant cell peroxisome localization marker of the present invention enriches the subcellular localization marker library and can be used as a marker control marker for peroxisome localization; in addition, non-peroxisome localized genes can be specifically localized in peroxisomes, thereby improving the accuracy of target protein targeting. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0022] Figure 1 This is the map of the PTS-mKate2 vector;

[0023] Figure 2 This is the localization map of pBWA(V)-PTS-mKate2 in Nicotiana benthamiana epidermal cells;

[0024] Figure 3 The localization map of PTS-AtActin2-mKate2 in tobacco epidermal cells;

[0025] Figure 4 The localization map of PTS1-AtActin2-mKate2 in tobacco epidermal cells. DETAILED DESCRIPTION

[0026] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0027] Example 1

[0028] The present invention provides a method for improving peroxisome localization specificity, comprising the following steps:

[0029] S1, the peroxisome N-terminal localization sequence PTSp and type I signal peptide PTS1 were fused with the target gene through homologous cloning to obtain the PTSp-PTS1-target gene fusion construct. The specific method is as follows:

[0030] 1) The N-terminal localization sequence PSTp was synthesized by General Biotech Co., Ltd.

[0031] The nucleotide sequence of PSTp is: ATGGATCGCGCCCGCCTCGCCGTGCTCTCCGC CCACCTCGCCTCCCCCCGCCGCCGCCTGCGGGGAGGCGGACGCGGCGGGGCCGCTGGAGAGGTCGGCGGCGTCTGCGGGGGCGCGAGGCGGCGCCTGGGCGGTGGTGGATGGGAGGACGGGGAAGAGGTACGAGG TCAAGGTGTCGGACGAGGGGACCGTGCGCGCCACCGACTTCAAGAAGATTACCACTGGAAAGGACGACAAGGGTCTTAAGATCTATGATCCTGGTTATCTCAACACAGCCCCAGTTCGCTCATCCATCTGCTAC. (SEQ ID No.1)

[0032] The nucleotide sequence of PTS1 is: TCTGCCCTGTGA. (SEQ ID No. 2)

[0033] The nucleotide sequence of mKate2 is: GTGAGCGAGCTGATTAAGGAGAACATGCAC ATGAAGCTGTACATGGAGGGCACCGTGAACAACCACCACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAGGGCACCCAGACCATGAGAATCAAGGCGGTCGAGGGCGGCCCTCTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGGCAGCAAAACCTTCATCAACCACACCCAGGGCATCCCCGACTTCTTTAAGCAGTCCTTCCCCGAGGGCTTCACATGGGAGAGAGTCACCACATACGAGGACGGGGGCGTGCTGACCGCTACCCAGGACACCAGCCTCCAGGACGGCTGCCTCATCTACAACGTCAAGATCAGAGGGGTGAACTTCCCATCCAACGGCCCTGTGATGCAGAAGAAAACACTCGGCTGGGAGGCCTCCACCGAAACCCTGTACCCCGCTGACGGCGGCCTGGAAGGCAGAGCCGACATGGCCCTGAAGCTCGTGGGCGGGGGCCACCTGATCTGCAACTTGAAAACCACATACAGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGGCGTCTACTATGTGGACAGAAGGCTGGAAAGAATCAAGGAGGCCGACAAAGAAACCTACGTCGAGCAGCACGAGGTGGCTGTGGCCAGATACTGCGACCTCCCTAGCAAACTGGGGCACAGA. (SEQ ID No.3)

[0034]

[0035] 2) Design recombination primers based on the sequence

[0036]

[0037] 3) Amplification of target fragment

[0038] Use the following PCR system and procedure to amplify the target gene.

[0039] Amplification system: Nuclease-free water 20 μL, Pfu PCR MIX 25 μL, upstream primer F 2 μL, downstream primer R 2 μL, template (pBWA(V)HS-mKate2 plasmid, PTSp nucleotide sequence) 1 μL, a total of 50 μL.

[0040] AtActin2 (At3g18780) was used as an example gene sequence amplified from the cDNA of wild-type Arabidopsis thaliana.

[0041] Amplification program: 94°C for 5 min, 94°C for 30 sec, 50°C for 45 sec, 72°C for 20 sec, 30 cycles, 72°C for 10 min.

[0042] The fragments were electrophoresed on 1.5% agarose gel and excised under UV light. The recovery procedure was performed according to the DNA gel recovery kit (Axygen). Finally, the DNA was recovered with 30 μL of water.

[0043] 4) Vector digestion

[0044] The pBWA(V)HS-mKate2 plasmid was used as the vector (SEQ ID No. 5). Double enzyme digestion was performed using Eco31 Ⅰ and Apa Ⅰ. The enzyme digestion system consisted of 12 μL of Nuclease-free water, 2 μL of 10× Buffer, 1 μL each of Eco31 Ⅰ and Apa Ⅰ, and 4 μL of the vector, for a total of 20 μL. The enzyme digestion was carried out at 37°C for 1 h. The digestion product was purified and recovered using a DNA gel recovery kit (Axygen) for use in the recombination reaction.

[0045] 5) Vector construction

[0046] Use BioRun Seamless Cloning Kit (#RDA01) to connect the target fragment to the linear vector. The reaction system is: 5 μL linear vector, 5 μL target fragment, Biorun 2×EasyClone Mix 10μL, a total of 20μL, the reaction system was connected at 37℃ for 1h, 5μL of the connection product was added to 50μL of transformed E. coli DH5α competent cells melted on ice, gently mixed and let it stand on ice for 30min, heat shocked in a 42℃ water bath for 45sec, quickly let it stand on ice for 2min and avoid shaking, 700μL of LB liquid medium without antibiotics (tryptone 10g / L, yeast extract 5g / L, NaCl10g / L) was added to the centrifuge tube, mixed and recovered at 37℃, 200rpm for 1h, the transformed competent cells were evenly spread on a culture dish containing LB solid medium (containing 15g / L agar) containing kanamycin, inverted cultured at 37℃ for 12h, and positive single clones were screened for sequencing identification. The PTS-mKate2 vector plasmid map is as follows Figure 1 shown.

[0047] The recombinant vector pBWA(V)-PTS-mKate2 is obtained by replacing the small fragment between the Eco31 Ⅰ and Apa Ⅰ restriction enzyme recognition sites of pBWA(V)HS-mKate2 with the DNA fragments of PTSp, mKate2 and PTS1 while keeping other nucleotide sequences unchanged.

[0048] S2, transform the fusion construct into Agrobacterium. The specific method is as follows:

[0049] The constructed vector plasmid was added to the Agrobacterium (GV3101) melted on ice, and the mixture was gently mixed. The mixture was then placed on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min. 700 μL of antibiotic-free YEB liquid medium (1 g / L yeast extract, 5 g / L beef extract, 5 g / L peptone, 5 g / L sucrose, 0.5 g / L MgSO4•7H2O, pH = 7.0) was added to the centrifuge tube, mixed, and recovered at 28°C, 200 rpm for 2 h. The transformed competent cells were evenly spread on YEB solid medium containing kanamycin (containing 15 g / L agar) and inverted for 2 days at 28°C. Positive clones were picked and inoculated into 10 mL of YEB liquid medium containing kanamycin, cultured at 170 rpm / min overnight, centrifuged at 4000 rpm / min for 4 min, and the supernatant was discarded. The cells were washed with 10 mM MgCl2 (containing 120 μL AS, acetosyringone) suspension resuspended the cells and adjusted the OD 600 =about 0.6.

[0050] S3, the transformed Agrobacterium is injected into plant leaves using the Agrobacterium-mediated transient transformation system.

[0051] Select tobacco plants with good growth conditions and inject the transformed Agrobacterium into the lower epidermis of the tobacco leaves using a 1 mL syringe without a needle. Culture the injected tobacco plants under weak light for 2 days and then observe them.

[0052] S4, fluorescence imaging using laser confocal microscopy to detect the specific localization of the target gene in peroxisomes in plant cells.

[0053] Take the tobacco leaves injected with Agrobacterium, make temporary slides, observe and take pictures under laser confocal microscope (OlypusFV3000), and the positioning results are as follows: Figure 2 , Figure 3 shown.

[0054] Figure 2 The images show the localization of pBWA(V)-PTS-mKate2 in Nicotiana benthamiana epidermal cells. From left to right, the images include: pBWA(V)-eGFP localization in tobacco epidermal cells (green signal); pBWA(V)-PTS-mKate2 localization (red signal); chloroplast localization (purple); bright field image of tobacco epidermal cells; and overlay image.

[0055] It can be found that the fluorescence signal of pBWA(V)-PTS-mKate2 does not overlap with the fluorescence of pBWA(V)-eGFP and chloroplasts. The method of this embodiment can introduce the red fluorescent protein mKate2 into peroxisomes and can be observed in living cells, saving time and labor and facilitating the study of protein function. The resulting pBWA(V)-PTS-mKate2 expression cassette can be effectively used for peroxisome localization.

[0056] Figure 3 Shown are examples of applications of peroxisome-targeted expression cassettes in plants. Images from left to right include: an image of AtActin2 localization in tobacco epidermal cells (red signal); an image of chloroplast localization (purple); a brightfield image of tobacco epidermal cells; and an overlay image.

[0057] AtActin2 itself is a protein located in the cytoplasm, such as Figure 3 As shown above. The PTS-AtActin2-mKate2 localization map shows that the red signal disappears from the cytoplasm and appears as a granular structure, which is a characteristic of peroxisomes and does not overlap with the chloroplast localization signal (purple), indicating that AtActin2 is specifically localized in peroxisomes. Figure 3 As shown below.

[0058] In summary, the Arabidopsis gene AtActin2 (At3g18780) was originally located in the cytoplasm ( Figure 3 However, when it was linked to the peroxidase localization sequence, the red signal in the cytoplasm disappeared and was replaced by a large amount of granular fluorescence that did not overlap with the chloroplast fluorescence signal, indicating that AtActin2 was specifically localized in the peroxisome ( Figure 3 Down).

[0059] Figure 4 Shown are examples of localization in tobacco epidermal cells containing only the type I signal peptide PTS1 and the target gene. From left to right, the images show the localization of PTS1 and AtActin2 in tobacco epidermal cells (red signal); the chloroplast localization (purple); a bright field image of tobacco epidermal cells; and an overlay image.

[0060] Figure 4 In the superimposed field image, in addition to the red granular signal, there are other red fluorescent signals, indicating that AtActin2 is not completely directed to the peroxisome, but still exists in the cytoplasm.

[0061] As can be seen, when only PTS1 is present, AtActin2 protein is still widely distributed throughout the cytoplasm in the form of red signals. This indicates that AtActin2 is not specifically localized to peroxisomes, thus proving that the peroxisomal N-terminal localization sequence PTSp of the present application can significantly improve the specificity of peroxisomal localization.

[0062] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for improving peroxisome localization specificity, characterized in that: The following steps are involved: S1, the peroxisome N-terminal localization sequence PTSp and the type I signal peptide PTS1, whose nucleotide sequence is shown in SEQ ID No. 1, are fused and expressed with the target gene by homologous cloning to obtain a PTSp-target gene-PTS1 fusion construct; S2, transformation of the fusion construct into Agrobacterium; S3, the transformed Agrobacterium was injected into plant leaves using the Agrobacterium-mediated transient transformation system; S4, fluorescence imaging using laser confocal microscopy to detect the specific localization of the target gene in peroxisomes in plant cells; In step S1, the nucleotide sequence of the type I signal peptide PTS1 is shown as SEQ ID No.

2.

2. The method for improving peroxisome localization specificity according to claim 1, wherein: In step S1, the target gene is an exogenously introduced transgenic gene or an endogenous gene, and its expression product is a protein or polypeptide.

3. The method for improving peroxisome localization specificity according to claim 2, wherein: The target genes are red fluorescent protein mKate2 and actin AtActin2.

4. A fusion gene construct for improving peroxisome localization specificity, characterized in that: The invention comprises the peroxisome N-terminal localization sequence PTSp, type I signal peptide PTS1 and target gene according to claim 1, wherein the structure of the fusion gene construct is PTSp-target gene-PTS1.

5. The fusion gene construct according to claim 4, wherein The target genes are red fluorescent protein mKate2 and actin AtActin2.

6. An expression cassette for improving peroxisome localization specificity, characterized in that: Comprising the fusion gene construct according to claim 4 or 5.

7. Use of the fusion gene construct according to any one of claims 4 to 5 or the expression cassette according to claim 6 in plant subcellular localization.

Images