SNP molecular markers, detection primer sets, and applications and methods for hypoxia tolerance traits in grass carp

Abstract

This invention belongs to the technical field of molecular breeding of aquatic animals and specifically relates to a SNP molecular marker, detection primer set, and application and method for the hypoxia tolerance trait of grass carp. The SNP molecular marker is located at base 33445030 (P1) on chromosome 5 and / or base 36269337 (P2) on chromosome 10 of the grass carp genome; the SNP genotype at both sites is A / G. The molecular marker, combination, and primer set described in this invention can be used to detect grass carp's hypoxia tolerance and for molecular genetic breeding of grass carp for hypoxia tolerance, which is of great significance for accelerating the selection of superior grass carp varieties.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular breeding of aquatic animals, and particularly relates to a SNP molecular marker for the hypoxia tolerance trait of grass carp, a detection primer set, and an application and method. Background Art

[0002] grass carp( Ctenopharyngodon idellus ) belongs to the Cyprinidae family of the order Cypriniformes and is one of my country's "four major carps". Common breeding methods include pond farming and cage farming. In intensive farming, due to the high stocking density, especially in rainy weather and early morning hours, the dissolved oxygen level in the water is low, and the "floating head" phenomenon is very likely to occur. This will lead to slower fish growth, induce large-scale mortality events, and cause serious economic losses. At present, grass carp farming mainly relies on aerators for oxygenation, but this significantly increases the cost of farming. Therefore, the cultivation of grass carp varieties that are resistant to low oxygen has become an urgent need for industrial development.

[0003] Molecular marker-assisted breeding is a modern breeding method based on DNA molecular marker technology. By identifying molecular markers closely linked to target traits, it aids in the selection of individuals with favorable traits, significantly improving breeding efficiency and accuracy. Using genome-wide association studies (GWAS), single nucleotide polymorphisms (SNPs) associated with hypoxia tolerance in grass carp have been identified. The development and application of these molecular markers is expected to overcome the limitations of traditional breeding, significantly promoting the targeted breeding of new hypoxia-tolerant grass carp varieties and laying the molecular foundation for elucidating the mechanisms of hypoxia tolerance in grass carp.

[0004] FLU-ARMS technology, developed by Guangzhou Good Biotechnology Co., Ltd., is a fluorescent quantitative PCR-based SNP genotyping technique primarily used for high-precision biallelic typing of known SNPs. It is suitable for detecting SNPs in large numbers of samples and is economical, rapid, and flexible. It holds promise for the breeding of new hypoxia-tolerant grass carp varieties. Summary of the Invention

[0005] The present invention aims to provide a SNP molecular marker for the hypoxia tolerance trait of grass carp, a detection primer set, and an application and method.

[0006] To achieve the above purpose, the present invention adopts the following technical solutions:

[0007] A SNP molecular marker for a hypoxia tolerance trait in grass carp, wherein the SNP molecular marker is located at base 33445030 (P1) on chromosome 5 and / or base 36269337 (P2) on chromosome 10 of the grass carp genome; the SNP genotypes of the two sites are both A / G.

[0008] The SNP molecular marker located at base 33445030 (P1) of chromosome 5 of the grass carp genome is the base sequence shown in SEQ ID NO.1;

[0009] The SNP molecular marker located at base 36269337 (P2) of chromosome 10 of the grass carp genome is the base sequence shown in SEQ ID NO.2.

[0010] The genotype of the SNP molecular marker is GG at the P1 site and / or GG at the P2 site.

[0011] An application of the SNP molecular marker for the grass carp hypoxia tolerance trait, and an application of the SNP molecular marker in the molecular genetic breeding of grass carp hypoxia tolerance.

[0012] A detection primer set:

[0013] The primer set consists of a primer set for detecting the genotype of the P1 site and a primer set for detecting the genotype of the P2 site:

[0014] The primer set for detecting the P1 locus genotype is as follows:

[0015] P1-F1: GAAGGTGACCAAGTTCATGCTAGCAGCCCGCTGATCTAAGCAAGGTA;

[0016] P1-F2: GAAGGTCGGAGTCAACGGATTAGCAGCCGCTGATCTAAGCAAGGTG;

[0017] P1-R:GAAGAACATCAACCAAAAACAGGAAACTC;

[0018] The primer set for detecting the P2 locus genotype is as follows:

[0019] P2-F1: GAAGGTGACCAAGTTCATGCTTGACCAAGAAAATCTGAACTGCGAA;

[0020] P2-F2:GAAGGTCGGAGTCAACGGATTTGACCAAGAAAATCTGAACTGCGAG;

[0021] P2-R: AATAACGATAAATCAGTTCATCAGGGAGG.

[0022] An application of the detection primers, and an application of the primer set in preparing a product for detecting the hypoxia tolerance trait of grass carp.

[0023] An application of the detection primers, and an application of the primer set in detecting the hypoxia tolerance of grass carp.

[0024] An application of the detection primers, and an application of the primer set in the genetic breeding of grass carp with low oxygen tolerance.

[0025] A method for detecting the hypoxia tolerance of grass carp,

[0026] (1) Extracting genomic DNA from the grass carp sample to be tested;

[0027] (2) using the genomic DNA as a template and performing PCR amplification using the primer set;

[0028] (3) Collect the fluorescence signals generated by each reaction well, determine the genotype of the SNP site, and determine the tolerance of grass carp samples to hypoxia.

[0029] In the step (3), for determining the genotype of the SNP site, for the P1 and P2 sites, if only FAM fluorescence is detected, the genotype is GG; if only HEX fluorescence is detected, the genotype is AA; if both FAM and HEX fluorescence are detected, the genotype is AG.

[0030] The PCR amplification reaction system: primer-F1: 0.02 μL; primer-F2: 0.02 μL; primer-R: 0.06 μL; Flu-Arms 2×PCR mix: 1.0 μL; DNA template (5 ng - 50 ng): 0.9 μL.

[0031] PCR amplification program: 95°C, 1 min, 1 cycle; 95°C, 5 s, 63.4°C to 57°C, 0.8°C decrease per cycle, 15 s, 9 cycles; 95°C, 5 s, 57.5°C, 15 s, 35 cycles; 16°C, 20 s, 2 cycles.

[0032] The advantages of the present invention are:

[0033] The molecular markers, combinations and primer sets proposed in the present invention can be used for the detection of grass carp's hypoxia tolerance and the molecular genetic breeding of grass carp with hypoxia tolerance, which is of great significance for accelerating the selection and breeding of excellent grass carp varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The genotype ratio of the P1 locus of 150 hypoxia-tolerant grass carp and 150 hypoxia-intolerant grass carp provided in the embodiment of the present invention. "*" represents that there is a significant difference in the genotype of hypoxia-tolerant and hypoxia-intolerant individuals ( P <0.05, chi-square test).

[0035] Figure 2The genotype ratio of the P2 locus of 150 hypoxia-tolerant grass carp and 150 hypoxia-intolerant grass carp provided in the embodiment of the present invention. "***" represents that there is a significant difference in the genotype of hypoxia-tolerant and hypoxia-intolerant individuals ( P <0.001, chi-square test).

[0036] Figure 3 The ratio of the nine genotype combinations of P1 and P2 loci of 150 hypoxia-tolerant grass carp and 150 hypoxia-intolerant grass carp provided in the embodiment of the present invention. "***" indicates that there is a significant difference in the genotypes of hypoxia-tolerant and hypoxia-intolerant individuals ( P <0.001, chi-square test). DETAILED DESCRIPTION

[0037] The present invention will be further described below with reference to the embodiments.

[0038] The present invention utilizes FLU-ARMS technology, combined with the identified grass carp hypoxia-resistant molecular marker, to accurately screen breeding parents carrying hypoxia-resistant markers in the early stages of breeding, thereby significantly shortening the breeding cycle and accelerating the breeding process of new hypoxia-resistant grass carp varieties.

[0039] It should be noted that all raw materials used in the examples were commercially available unless otherwise specified. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.; lu-Arms 2×PCR mix was purchased from Guangzhou Good Biotechnology Co., Ltd.; and genome resequencing was performed by Shanghai Meiji Biotechnology Co., Ltd.

[0040] Example 1

[0041] The identification of molecular markers for hypoxia tolerance in grass carp includes the following steps:

[0042] (1) Grass carp hypoxia stress experiment

[0043] Two thousand grass carp were purchased from Weishan County Nansihu Fishery Co., Ltd., with an average weight of 23.50 g and an average total length of 12.58 cm. During the hypoxia stress experiment, the water temperature was maintained at 21 ± 1°C, and sodium sulfite powder was added to reduce dissolved oxygen in the water. Fish were observed for signs of loss of balance, the duration of each loss of balance was recorded, and fin ray tissue samples were taken. The first 150 fish to lose balance were considered hypoxia-intolerant, while the last 150 fish to lose balance or survive were considered hypoxia-tolerant.

[0044] (2) Genome-wide association study (GWAS)

[0045] Fin ray DNA was extracted from hypoxia-intolerant and hypoxia-tolerant fish, totaling 300 samples (150 from hypoxia-intolerant grass carp and 150 from hypoxia-tolerant grass carp). Genome resequencing was performed using the Illumina platform. Each sample had a total sequencing capacity of 8 Gb. Raw sequence reads were filtered using Fastp (v 0.23.4) and aligned to the grass carp reference genome. GATK (v 3.8) was used to identify high-quality single-nucleotide polymorphisms (SNPs) for each sample, using a minimum allele frequency (MAF) >5% and a missing data percentage <20% as filtering thresholds. Genome-wide association analysis was performed using a generalized linear model (GLM), with phenotypic data converted into binary variables. Multiple testing was performed on candidate marker loci using the Bonferroni correction to control false-positive rates.

[0046] (3) Discovery of molecular marker sites for grass carp's tolerance to hypoxia

[0047] The SNP sites obtained by genome-wide association analysis were p The SNPs were sorted by the size of the values ​​and the SNP sites significantly associated with the hypoxia tolerance of grass carp were screened. The results showed that the 33445030th base (P1) of chromosome 5 and the 36269337th base (P2) of chromosome 10 of grass carp genome were significantly associated with the hypoxia tolerance trait. p The values ​​were 1.12E-07 and 1.27E-07, respectively. The P1 and P2 sites and their upstream and downstream sequences are shown in SEQ ID NOs. 1 and 2. [A / G] represents the SNP site of the molecular marker. SEQ ID NO. 1 is for bases 33444832-33445230 on chromosome 5. SEQ ID NO. 1 is for bases 36269137-36269537 on chromosome 10.

[0048] The sequence shown in SEQ ID NO.1 is as follows:

[0049] TATATAAAAAAAAGATAGTGGCGAGATACAGCAACTCCCCCCAACTGTTGACTGGCTCTAATAGCGCCATTGTTTCTCTCACCCAAAAAGCCCCAGCAAGGCAGAGTTCATAAAAGCAAAATATCAAATGCTGGCTTACGTCCATCGTTTACCATGTCGAGATGACGACAGTACAGCAGCCGCTGATCTAAGCAAGGT[A / G ]AGGAAAGAGTTTCCTGTTTTTGGTTGATGTTCTTCTCGATATTCAAATATGTGATGCATCCATGATACATTTTTTCAGGTTTGACTTGCTTTATTGTTGAATAAATTTAAACAGTTCCTCTAGCACATCTAAGGCTTTTTGTCTGCTATCAGGCTTGTTGAAATGTCTCTATTGATGCACTTTGTCTTTGATTC.

[0050] The sequence shown in SEQ ID NO.2 is as follows:

[0051] AGAATATAATTTAAAACATATTTTTGAAAATAATTCAGATGTGTACACTCACATGTATTCAGTGTGTAAGAGCCATTAATTTGAAACAGGTTTCGAAACCAACATGAACACAAAGAGTACATTTCTAAGAAATTCTAAGAATTTTTTGTTTTATCAAGGAAACTCTTAAATGTCATTGACCAAGAAAATCTGAACTGCGA[A / G]TGAAAGCCTCCCTGATGAACTGATTTATCGTTATTTGTTGTTGTAGAGCACACATCCAACTATGCCGATAATGGGGTTGTAATTTATGTGTGTAAGTGCATGTACGAACTGTACGAAAGTGTAAACAGCCAACCAAAACAAAACTCCCAGATCAACTTCTCTCATAAACAGTTGCCTTTAACTGCATCATTGCTCTTCTT.

[0052] The results of GWAS analysis showed that when the genotype of grass carp at P1 and P2 sites was GG, its tolerance to hypoxia was stronger; when the genotype of P1 and P2 sites was other types, its tolerance to hypoxia was weaker.

[0053] Example 2

[0054] The design of detection primers for the molecular marker site of hypoxia tolerance trait of grass carp includes the following steps:

[0055] A specific Flu-Arms primer set was designed based on the upstream and downstream sequences of base 33445030 (P1) of chromosome 5 and base 36269337 (P2) of chromosome 10 of grass carp genome.

[0056] The sequences of the primer combinations for detecting the genotype of the P1 locus are as follows:

[0057] P1-F1:

[0058] GAAGGTGACCAAGTTCATGCTAGCAGCCGCTGATCTAAGCAAGGTA (SEQ ID NO.3);

[0059] P1-F2:

[0060] GAAGGTCGGAGTCAACGGATTAGCAGCCGCTGATCTAAGCAAGGTG (SEQ ID NO. 4);

[0061] P1-R:

[0062] GAAGAACATCAACCAAAAACAGGAAACTC (SEQ ID NO. 5).

[0063] The sequences of the primer combinations for detecting the P2 locus genotype are as follows:

[0064] P2-F1:

[0065] GAAGGTGACCAAGTTCATGCTTGACCAAGAAAATCTGAACTGCGAA (SEQ ID NO. 6);

[0066] P2-F2:

[0067] GAAGGTCGGAGTCAACGGATTTGACCAAGAAAATCTGAACTGCGAG (SEQ ID NO. 7);

[0068] P2-R:

[0069] AATAACGATAAATCAGTTCATCAGGGAGG (SEQ ID NO. 8).

[0070] Example 3

[0071] Detection of molecular marker genotypes using the molecular marker primer set designed in Example 2 above includes the following steps:

[0072] (1) Extraction of grass carp genomic DNA

[0073] Fin ray tissues of grass carp were cut and genomic DNA was extracted using the phenol-chloroform method.

[0074] (2) Establishment of genotyping PCR amplification system

[0075] The PCR amplification system (2 μL) is shown in Table 1.

[0076] Table 1. PCR amplification system for detecting hypoxia-tolerant molecular marker genotypes in grass carp

[0077]

[0078] (3) Genotyping fluorescence quantitative PCR amplification procedure

[0079] Genotyping was performed using a QS1 real-time fluorescence quantitative PCR instrument (Thermo Fisher Scientific, USA). Amplification conditions are shown in the table below.

[0080] Table 2. Fluorescence quantitative amplification program for genotyping

[0081]

[0082] (4) Plate reading test

[0083] After the amplification process is complete, the real-time fluorescence quantitative PCR instrument can directly scan the amplified products on the PCR plate and analyze the genotype. For the P1 and P2 sites, if only FAM fluorescence is detected, the genotype is GG; if only HEX fluorescence is detected, the genotype is AA; if both FAM and HEX fluorescence are detected, the genotype is AG.

[0084] Example 4

[0085] The validation of the identified molecular markers for hypoxia tolerance in grass carp includes the following steps:

[0086] 1000 grass carps were subjected to hypoxia stress, and the resistance of each grass carp to hypoxia was tested using the method in Example 1. 150 hypoxia-sensitive individuals and 150 hypoxia-tolerant individuals were obtained. Using the primer set in Example 2 and the molecular marker genotyping method in Example 3, the genotypes of the P1 and P2 loci of the 150 hypoxia-sensitive individuals (numbered 1-150) and 150 hypoxia-tolerant individuals (numbered 151-300) were tested (Table 3). In the hypoxia-sensitive individuals and the hypoxia-tolerant individuals, the genotype ratio of the P1 locus was, for example, Figure 1 As shown, the genotype ratio of P2 locus is as follows Figure 2As shown, the genotype combination distribution ratio of P1 and P2 sites is as follows: Figure 3 shown.

[0087] Genotypic analysis showed that the proportion of individuals with the GG genotype at the P1 locus was significantly higher in the hypoxia-tolerant population than in the hypoxia-intolerant population. The proportion of individuals with the AG genotype was significantly higher in the hypoxia-intolerant population than in the hypoxia-tolerant population. At the P2 locus, the proportion of the GG genotype was significantly higher in the hypoxia-tolerant population than in the hypoxia-intolerant population. Regarding genotype combinations at the P1 and P2 loci, the proportion of the GG genotype combination at the P1 locus and the GG genotype combination at the P2 locus (GG-GG) was significantly higher in the hypoxia-tolerant population than in the hypoxia-intolerant population; the proportion of the AG-AA genotype combination was significantly higher in the hypoxia-intolerant population than in the hypoxia-tolerant population. This demonstrates that the P1 and P2 loci, and their combination, can be used as molecular markers to detect hypoxia tolerance in grass carp and have significant potential for application in genetic marker-assisted breeding.

[0088] Table 3. Genotype detection results of P1 and P2 loci of 300 grass carp

[0089]

[0090] Note: “-” represents weaker hypoxia tolerance, and “+” represents stronger hypoxia tolerance.

Claims

1. A SNP molecular marker for hypoxia tolerance in grass carp, characterized by: The SNP molecular marker is shown in SEQ ID NO.1 and / or SEQ ID NO.2, The sequence shown in SEQ ID NO.1 is as follows: TATATAAAAAAAAGATAGTGGCGAGATACAGCAACTCCCCCCAACTGTTGACTGGCTCTAATAGCGCCATTGTTTCTCTCACCCAAAAAGCCCCAGCAAGGCAGAGTTCATAAAAGCAAAATATCAAATGCTGGCTTACGTCCATCGTTTACCATGTCGAGATGACGACAGTACAGCAGCCGCTGATCTAAGCAAGGT[A / G ]AGGAAAGAGTTTCCTGTTTTTGGTTGATGTTCTTCTCGATATTCAAATATGTGATGCATCCATGATACATTTTTTCAGGTTTGACTTGCTTTATTGTTGAATAAATTTAAACAGTTCCTCTAGCACATCTAAGGCTTTTTGTCTGCTATCAGGCTTGTTGAAATGTCTCTATTGATGCACTTTGTCTTTGATTC; The sequence shown in SEQ ID NO.2 is as follows: AGAATATAATTTAAAACATATTTTTGAAAATAATTCAGATGTGTACACTCACATGTATTCAGTGTGTAAGAGCCATTAATTTGAAACAGGTTTCGAAACCAACATGAACACAAAGAGTACATTTCTAAGAAATTCTAAGAATTTTTTGTTTTATCAAGGAAACTCTTAAATGTCATTGACCAAGAAAATCTGAACTGCGA[A / G]TGAAAGCCTCCCTGATGAACTGATTTATCGTTATTTGTTGTTGTAGAGCACACATCCAACTATGCCGATAATGGGGTTGTAATTTATGTGTGTAAGTGCATGTACGAACTGTACGAAAGTGTAAACAGCCAACCAAAACAAAACTCCCAGATCAACTTCTCTCATAAACAGTTGCCTTTAACTGCATCATTGCTCTTCTT; There is an A / G mutation at position 199 of SEQ ID NO.1; There is an A / G mutation at position 201 of SEQ ID NO.

2.

2. The SNP molecular marker for the hypoxia tolerance trait of grass carp according to claim 1, characterized in that: The genotype of the SNP molecular marker is GG at the first site and / or GG at the second site.

3. A use of the SNP molecular marker for the hypoxia tolerance trait of grass carp according to claim 1, characterized in that: Application of the SNP molecular marker in the molecular genetic breeding of grass carp tolerant to hypoxia; The genotype of the SNP molecular marker is GG at the first site and / or GG at the second site.

4. A primer set for detecting the SNP molecular marker for the hypoxia tolerance trait of grass carp according to claim 1, characterized in that: The primer set consists of a primer set for detecting the genotype of the first site and a primer set for detecting the genotype of the second site: The primer set for detecting the genotype of the first site is as follows: P1-F1: GAAGGTGACCAAGTTCATGCTAGCAGCCCGCTGATCTAAGCAAGGTA; P1-F2: GAAGGTCGGAGTCAACGGATTAGCAGCCGCTGATCTAAGCAAGGTG; P1-R:GAAGAACATCAACCAAAAACAGGAAACTC; The primer set for detecting the genotype of the second site is as follows: P2-F1: GAAGGTGACCAAGTTCATGCTTGACCAAGAAAATCTGAACTGCGAA; P2-F2:GAAGGTCGGAGTCAACGGATTTGACCAAGAAAATCTGAACTGCGAG; P2-R: AATAACGATAAATCAGTTCATCAGGGAGG.

5. Use of the primer set according to claim 4, characterized in that: The primer set is used in preparing a product for detecting the hypoxia tolerance trait of grass carp.

6. Use of the primer set according to claim 4, characterized in that: The primer set is used in detecting the hypoxia tolerance of grass carp.

7. Use of the primer set according to claim 4, characterized in that: The primer set is used in the molecular genetic breeding of grass carp tolerant to hypoxia.

8. A method for detecting the hypoxia tolerance of grass carp, characterized in that: (1) Extracting genomic DNA from the grass carp sample to be tested; (2) using genomic DNA as a template and performing PCR amplification using the primer set described in claim 4; (3) Collect the fluorescence signals generated by each reaction well, determine the genotype of the SNP site, and determine the tolerance of grass carp samples to hypoxia.

9. The method for detecting the hypoxia tolerance of grass carp according to claim 8, characterized in that: In step (3), for the first and second SNP sites, if only FAM fluorescence is detected, the genotype is GG; if only HEX fluorescence is detected, the genotype is AA; if both FAM and HEX fluorescence are detected, the genotype is AG.

Images