Transformant-specific PCR (polymerase chain reaction) detection and genotype identification method of insect-resistant and herbicide-resistant soybean DBN8002

Abstract

The invention discloses a transformant specificity qualitative and quantitative PCR (polymerase chain reaction) method and a single plant genotype rapid identification method of transgenic soybean DBN8002. According to a transgenic soybean DBN8002 exogenous gene sequence and soybean genome sequences on two sides of an insertion site, a transformant specific primer combination and a primer / probe combination as well as an insertion site specific primer combination and a primer / probe combination are respectively designed. Carrying out identity identification and quantitative detection on the transgenic soybean DBN8002 by utilizing a transformant specific primer combination and a primer / probe combination; and the DBN8002 soybean homozygote and heterozygote can be rapidly identified. According to the invention, the problem of lack of transgenic soybean DBN8002 transformant detection and genotype identification methods in transgenic soybean safety supervision, breeding and standard substance development is solved, and transformant identification, quantification and genotype analysis can be rapidly and accurately carried out on the transgenic soybean DBN8002 by using the method.

Description

Technical Field

[0001] The present invention relates to the qualitative and quantitative detection technology of DBN8002 transformant in the supervision of genetically modified organism safety, and the identification technology of the genotype of transgenic soybean DBN8002 raw materials in the fields of biological breeding and the production of genetically modified reference materials. In particular, it relates to the primer / probe design and its application for the detection of DBN8002 soybean transformant and genotype identification. Background Art

[0002] Soybean (Glycine max) is one of the world's five major crops. With the rapid development of transgenic technology, transgenic crops are widely planted, and the safety of transgenic products has attracted much social attention. According to the statistics of the International Service for the Acquisition of Agri-biotech Applications (ISAAA), as of 2018, the total area of global transgenic crops reached 191.7 million hectares, and a total of 27 transgenic crops have obtained 387 approvals. Transgenic crops have been widely approved for food, feed and global commercial cultivation. Many countries have legislated to regulate the development, production, trade and application of genetically modified organisms (GMOs), and set the transgenic labeling threshold to help consumers make informed purchasing decisions. In the implementation of genetically modified organism laws and labeling policies, it is necessary to develop standardized qualitative and quantitative detection methods and supporting certified reference materials to identify the identity and quantitatively detect transgenic varieties. In the process of transgenic soybean breeding and the development of reference materials, it is necessary to identify heterozygous single plants (seeds) and homozygous single plants (seeds). Identifying them by field planting and phenotypic analysis is time-consuming and laborious, and cannot accurately evaluate the purity and homozygosity of raw materials.

[0003] my country is about to start the industrialization of biological breeding. Transformant identification or quantitative detection is required in the cultivation, planting, processing, production, and application of transgenic varieties to protect the intellectual property rights of researchers, ensure the compliant and orderly planting of transgenic varieties, and protect consumers' right to know. In the production of transgenic detection standard materials, the genotype identification of raw materials is involved. An important value of transgenic detection standard materials is the transgenic content, and the determination of transgenic content is closely related to the genotype of the raw materials. For homozygous single plants or homozygous seeds, the transgenic content is 100% at the DNA level, while for heterozygous single plants or heterozygous seeds, the transgenic content is 50% at the DNA level. Moreover, the identification of standard material raw materials requires not only genotype identification but also single seed identification to determine the purity of the seeds. Through quantitative PCR technology, not only can the purity of seeds be identified, but also the transgenic content can be determined, providing standards and channels for national transgenic food safety supervision, as well as technical support.

[0004] Based on the above background, it is particularly important to produce kits for identifying transformants and genotypes of transgenic varieties, which can not only save time and cost, but also provide standards and methods for regulatory testing, intellectual property protection, and the development of reference materials. Summary of the invention

[0005] The invention aims to solve the problem of lack of a method for detecting and rapidly identifying a transgenic soybean DBN8002 transformant and a genotype, analyzes the soybean genome sequence on both sides of the insertion site of an exogenous gene of the transgenic soybean DBN8002 and the insertion site sequence of a receptor genome, designs a specific primer pair DBN8002-F / DBN8002-R and a primer / probe combination DBN8002-QF / DBN8002-QR / DBN8002-QP according to the insertion site sequence of the genome of the transgenic soybean DBN8002 transformant, and provides an accurate qualitative and quantitative detection method for the transgenic soybean DBN8002 transformant; and is used in combination with a receptor genome insertion site-specific primer pair DBN8002-GF / DBN8002-GR and a primer / probe combination DBN8002-IF / DBN8002-IR / DBN8002-IP, to provide a rapid, economical and reliable method for identifying the genotype of a single transgenic soybean DBN8002 plant (seed).

[0006] In one aspect, the present invention provides a common PCR detection primer composition for the genome insertion site specificity of a transformant of transgenic soybean DBN8002:

[0007] DBN8002-F 5′—GTATAAGGTCTTTGGTTGGATTATCG—3′SEQ ID No.1

[0008] DBN8002-R 5′—GTCGTTTCCCGCCTTCAGTT—3′SEQ ID No.2

[0009] Another aspect of the present invention provides a primer and probe composition for real-time fluorescence PCR detection of the insertion site of the transgenic soybean DBN8002 transformant genome:

[0010] DBN8002-QF 5′—TATCCGCAATGTGTTATTAAGTTGTC—3′SEQ ID No.3

[0011] DBN8002-QR 5′—TGTCATTCCTCAAGTGTCCCAT—3′SEQ ID No.4

[0012] DBN8002-QP 5′—TGTGTAACGCTTGTTTTGCTAT—3′SEQ ID No.5.

[0013] Another aspect of the present invention provides a composition for ordinary PCR detection of the receptor of transgenic soybean DBN8002, which includes:

[0014] The primer composition for specific detection of the insertion site of the transgenic soybean DBN8002 transformant genome according to the present invention,

[0015] The first primer pair of DBN8002 receptor:

[0016] DBN8002-F 5′—GTATAAGGTCTTTGGTTGGATTATCG—3′SEQ ID No.1

[0017] DBN8002-GR 5′—ACCCTCTCGAAGTGTTTGCT—3′SEQ ID No.6.

[0018] Another aspect of the present invention provides a composition for real-time fluorescence PCR detection of the receptor identification of transgenic soybean DBN8002, which includes:

[0019] The primer and probe composition for real-time fluorescence PCR detection of the insertion site of the transgenic soybean DBN8002 transformant genome,

[0020] The second primer pair and the second probe composition of DBN8002 receptor:

[0021] DBN8002-IF 5′—GTTGGTTAAGTAGGTTATG—3′SEQ ID No.7

[0022] DBN8002-IR 5′—GTGTCCCATATATAGCAA—3′SEQ ID No.8

[0023] DBN8002-IP 5′—CAAGCGTTACACATAATTAATGTCT—3′SEQ ID No.9。

[0024] In the technical solution of the present invention, the common PCR primer pair for the soybean internal standard gene lec is as follows:

[0025] Lec-1672F: 5′-GGGTGAGGATAGGGTTCTCTG-3′SEQ ID No.13

[0026] Lec-1881R: 5′-GCGATCGAGTAGTGAGAGTCG-3′SEQ ID No.14

[0027] And the real-time fluorescence PCR primer pair and probe composition for the soybean internal standard gene lec;

[0028] In the technical solution of the present invention, the primer pair for the soybean internal standard gene lec is as follows:

[0029] lec-F 5′-GCCCTCTACTCCACCCCCA-3′SEQ ID No.10

[0030] lec-R 5′-GCCCATCTGCAAGCCTTTTT-3′SEQ ID No.11,

[0031] In the technical solution of the present invention, the probe for the soybean internal standard gene lec is as follows:

[0032] lec-P 5′-AGCTTCGCCGCTTCCTTCAACTTCAC-3′SEQ ID No.12。

[0033] Another aspect of the present invention provides a method for identifying the transgenic soybean DBN8002 transformant. The method is a common PCR method, which is detected by using the common PCR detection composition of the present invention. Preferably:

[0034] By respectively using the transformant genome insertion site-specific detection primer composition of transgenic soybean DBN8002 and the above-mentioned common PCR primer composition of the soybean internal standard gene lec, amplification is carried out on a common PCR instrument;

[0035] In the amplification results, if there are bands amplified by the soybean internal standard gene lec primer pair and the transgenic soybean DBN8002 transformant primer pair, it is determined as the DBN8002 transformant; if there is an amplification product for the soybean internal standard gene lec primer pair and no amplification product for the transgenic soybean DBN8002 transformant primer pair, it is determined as a negative sample.

[0036] Another aspect of the present invention provides a method for identifying the transgenic soybean DBN8002 transformant. The method is a real-time fluorescence PCR method, which is detected using the real-time fluorescence PCR detection primer composition described in the present invention. Preferably:

[0037] By amplifying on a real-time fluorescence PCR instrument using the DBN8002 transformant genome insertion site-specific detection primer composition and probe, as well as the soybean internal standard gene lec primer pair and probe composition respectively;

[0038] In the amplification results, if there are typical amplification curves for the soybean internal standard gene lec primer pair and probe composition, as well as the DBN8002 transformant primer composition and probe, it is determined as the DBN8002 transformant; if there is a typical amplification curve for the soybean internal standard gene lec primer pair and probe composition and no amplification curve for the DBN8002 transformant primer composition and probe, it is determined as a negative sample.

[0039] Another aspect of the present invention provides a method for identifying the genotype of transgenic soybean DBN8002. The method is a conventional PCR method, which is detected using the conventional PCR detection composition described in the present invention. Preferably:

[0040] By amplifying on a conventional PCR instrument using the transgenic soybean DBN8002 transformant genome insertion site-specific detection primer composition, the DBN8002 receptor genome insertion site-specific second primer pair, and the soybean internal standard gene lec conventional PCR primer pair respectively. In the amplification results, if there are bands for the soybean internal standard gene lec primer pair and the first primer pair and no band for the second primer pair, it is determined as a homozygote; if all three primer pairs have amplification products, it is determined as a heterozygote; if only the soybean internal standard gene lec primer pair and the second primer pair have amplification products, it is determined as a negative sample.

[0041] Another aspect of the present invention provides a method for identifying the genotype of transgenic soybean DBN8002. The method is a real-time fluorescence PCR method, which is detected using the real-time fluorescence PCR detection composition described in the present invention. Preferably:

[0042] Amplify by using the specific detection primer pair and probe composition for the insertion site of the transgenic soybean DBN8002 transformant genome, the second primer pair and second probe composition for the DBN8002 receptor, and the primer pair and probe composition for the soybean endogenous gene lec on a real-time fluorescence PCR instrument respectively;

[0043] In the amplification results, if the primer pair and probe composition for the soybean endogenous gene lec and the primer pair and probe composition for the specific detection of the insertion site of the transgenic soybean DBN8002 transformant genome show typical amplification curves, it is determined as a homozygote; if all three primer pairs and probe compositions show typical amplification curves, it is determined as a heterozygote; if only the primer pair and probe composition for the soybean endogenous gene lec and the second primer pair and second probe composition for the receptor show typical amplification curves, it is determined as a negative sample.

[0044] On the other hand, the present invention provides a method for quantitatively detecting transgenic soybean DBN8002. The method is a real-time fluorescence PCR method, which is detected by using the composition for real-time fluorescence PCR detection of the present invention. Preferably:

[0045] Amplify by using the specific detection primer pair and probe composition for the insertion site of the transgenic soybean DBN8002 transformant genome and the primer pair and probe composition for the soybean endogenous gene lec on a real-time fluorescence PCR instrument respectively. Use the transformant genome DNA diluted in gradients as a calibrator, and the calibrator includes at least 5 concentrations. According to the linear relationship between the contents of the DBN8002 transformant and the endogenous gene lec in the calibrator and the Ct value, draw the standard curves of the DBN8002 transformant and the endogenous gene Lec. Substitute the Ct value obtained from the test sample into the standard curve to calculate the content of the DBN8002 transformant.

[0046] On the other hand, the present invention provides a method for quantitatively detecting transgenic soybean DBN8002. The method is a digital PCR method, which is detected by using the composition for real-time fluorescence PCR detection of the present invention. Preferably:

[0047] Amplify by using the specific detection primer pair and probe composition for the insertion site of the transgenic soybean DBN8002 transformant genome and the primer pair and probe composition for the soybean endogenous gene lec on a digital PCR instrument respectively, read the fluorescence data of the droplets or chips, calculate the copy number concentrations of the DBN8002 transformant and the endogenous gene lec of the transgenic soybean, and then calculate the ratio of the two, so as to directly measure the content of the DBN8002 transformant.

[0048] In another aspect of the present invention, there is provided a kit for detecting transgenic soybean DBN8002, which kit comprises at least one of the following compositions: the specific conventional PCR detection primer composition for the genomic insertion site of the transformant of the above transgenic soybean DBN8002, the specific real-time fluorescence PCR detection primer and probe composition for the genomic insertion site of the transformant of the above transgenic soybean DBN8002, the conventional PCR detection composition for detecting the receptor of the above transgenic soybean DBN8002, and the real-time fluorescence PCR detection composition for identifying the receptor of the above transgenic soybean DBN8002.

[0049] Furthermore, the kit further comprises the soybean internal standard gene lec primer pair and probe shown in SEQ ID No.10, SEQ ID No.11 and SEQ ID No.12, or the soybean internal standard gene lec conventional PCR primer pair shown in SEQ ID No.13 and SEQ ID No.14.

[0050] In another aspect of the present invention, there is provided the use of the specific conventional PCR detection primer composition for the genomic insertion site of the transformant of transgenic soybean DBN8002 in the preparation of a kit for detecting transgenic soybean DBN8002.

[0051] In another aspect of the present invention, there is provided the use of the specific real-time fluorescence PCR detection primer and probe composition for the genomic insertion site of the transformant of transgenic soybean DBN8002 in the preparation of a kit for detecting transgenic soybean DBN8002.

[0052] In another aspect of the present invention, there is provided the use of the specific conventional PCR detection composition for the genomic insertion site of the receptor of transgenic soybean DBN8002 in the preparation of a kit for detecting transgenic soybean DBN8002.

[0053] In another aspect of the present invention, there is provided the use of the specific real-time fluorescence PCR detection composition for the genomic insertion site of the receptor of transgenic soybean DBN8002 in the preparation of a kit for detecting transgenic soybean DBN8002.

[0054] In the technical solution of the present invention, the following is the nucleotide sequence of the deletion of the genomic insertion site of the receptor during the genetic transformation of soybean DBN8002;

[0055] AGACAT.

[0056] In the technical solution of the present invention, SEQ ID No.15 is the amplification sequence of the specific conventional PCR for the genomic insertion site of the transformant of soybean DBN8002, and the positions of the primer combinations are shown in the appendix Figure 3 .

[0057] GTATAAGGTC TTTGGTTGGATTATCGGTAC CACCATTATA TACACATAAA 50ATCACTAACCATACATGTTG GTTAAGTAGG TTATGAAGTC TTAGATAATG 100ATTGTAAATC AAATGACTAATTATTTGAGATCTCATTTTATGTTAGAGTA150AGAATCAATT TTTGTTTAAA AAAAATATTT AGATACCAAATTAATTACTC 200AAACACTGAT AGTTTAAACT GAAGGCGGGA AACGAC 236

[0058] In the technical solution of the present invention, Figure 4 It is the amplified sequence of the genomic insertion site-specific ordinary PCR of the soybean DBN8002 receptor. The positions of the primer combinations are shown in the appendix Figure 4 , and the blackened bases in the box represent the inserted and deleted bases of T-DNA.

[0059] In the technical solution of the present invention, the appendix Figure 3 It is the position of the amplified sequence and primer composition of the genomic insertion site-specific ordinary PCR of the soybean DBN8002 transformant.

[0060] In the technical solution of the present invention, the appendix Figure 4 It is the position of the amplified sequence and primer composition of the genomic insertion site-specific ordinary PCR of the soybean DBN8002 receptor.

[0061] In the technical solution of the present invention, the appendix Figure 5 It is the position of the amplified sequence and primer-probe composition of the genomic insertion site-specific real-time fluorescence PCR of the soybean DBN8002 transformant.

[0062] In the technical solution of the present invention, the appendix Figure 6 It is the position of the amplified sequence and primer-probe composition of the genomic insertion site-specific real-time fluorescence PCR of the soybean DBN8002 receptor.

[0063] The object of the present invention is achieved as follows:

[0064] I. Design of primer / probe combinations

[0065] By analyzing the molecular characteristics of the DBN8002 transformant and the recipient, one primer each was designed on the right border of the exogenous insertion vector and the flanking genomic sequence of the DBN8002 transformant, namely DBN8002-F and DBN8002-R. The amplicon sequence spans the junction site of the inserted sequence and the flanking genomic sequence, and PCR amplification is carried out on a common PCR platform to accurately identify the DBN8002 transformant. A set of primers DBN8002-F / DBN8002-GR spanning the insertion site was designed at the genomic insertion site of the DBN8002 recipient. Since the length of the inserted exogenous vector fragment is 6 kb, by controlling the extension time during amplification, a fragment without the exogenous vector can be amplified by the primer pair DBN8002-F / DBN8002-GR. By using the primer pairs DBN8002-F / DBN8002-R, DBN8002-F / DBN8002-GR, and Lec-1672F / Lec-1881R in combination, the genotype of individual DBN8002 plants (seeds) can be identified by common PCR. For DBN8002 homozygotes, exogenous genes are inserted on both chromosomes. Therefore, by controlling the PCR extension time, only the DBN8002 transformant-specific primer combination DBN8002-F / DBN8002R and the internal standard gene Lec-1672F / Lec-1881R have PCR products; for DBN8002 heterozygotes, exogenous genes are inserted on one chromosome and not on the other chromosome, and all three primer combinations DBN8002-F / DBN8002-R, DBN8002-F / DBN8002-GR, and Lec-1672F / Lec-1881R have PCR products; for negative plants, only the primer combinations DBN8002-F / DBN8002-GR and Lec-1672F / Lec-1881R have PCR products. A schematic diagram of the principle of common PCR identification for the identification of homozygous and heterozygous transgenic soybean DBN8002 is shown as Figure 1 shown below.

[0066] The primer sequences designed in the present invention are as follows: Primer DBN8002-F 5′—GTATAAGGTCTTTGGTTGGATTATCG—3′ (SEQ ID No.1), DBN8002-R 5′—GTCGTTTCCCGCCTTCAGTT—3′ (SEQ ID No.2), the amplicon sequence is 236 bp long, and the positions of the primer pair on the target sequence are shown as Figure 3 shown below. Primer DBN8002-F (SEQ ID No.1) and DBN8002-GR 5′—ACCCTCTCGAAGTGTTTGCT—3′ (SEQ ID No.6), the amplicon sequence is 404 bp long, and the positions of the primer pair on the target sequence are shown as Figure 4 shown below.

[0067] By designing a primer DBN8002-QF and a primer DBN8002-QR on the left border of the exogenous inserted DNA and the flanking genomic sequence of DBN8002 respectively, and designing a probe DBN8002-QP in the middle, the amplicon sequence is 104 bp long, spanning the junction region between the inserted DNA and the flanking genome. Using the primer-probe combination DBN8002-QF / DBN8002-QR / DBN8002-QP for PCR amplification on a real-time fluorescence PCR platform, the DBN8002 transformant can be accurately identified. A primer DBN8002-IF and a primer DBN8002-IR are designed on both sides of the insertion site in the receptor genome, and a probe DBN8002-IP is designed on the nucleotide sequence deleted at the insertion site, and the amplification product spans the insertion site. For the DBN8002 homozygote, exogenous genes are inserted on both of its two chromosomes. Therefore, by controlling the PCR extension time, only the DBN8002 transformant-specific primer / probe combination DBN8002-QF / DBN8002-QR / DBN8002-QP and lec-F / lecR / lecP have typical amplification curves; for the DBN8002 heterozygote, exogenous genes are inserted on one chromosome and not inserted on the other chromosome, and the three primer-probe combinations DBN8002-QF / DBN8002-QR / DBN8002-QP, DBN8002-IF / DBN8002-IR / DBN8002-IP and lec-F / lecR / lecP all have typical amplification curves; for negative plants, only the primer-probe combinations DBN8002-IF / DBN8002-IR / DBN8002-IP and lec-F / lecR / lecP have typical amplification curves. The schematic diagram of the principle of real-time fluorescence PCR for the identification of homozygous and heterozygous transgenic soybean DBN8002 is as Figure 2 shown.

[0068] The primer-probe sequences designed in the present invention are as follows: primer DBN8002-QF 5′—TATCCGCAATGTGTTATTAAGTTGTC—3′ (SEQ ID No.3) and primer DBN8002-QR 5′—TGTCATTCCTCAAGTGTCCCAT—3′ (SEQ ID No.4), probe DBN8002-QP 5′—TGTGTAACGCTTGTTTTGCTAT—3′ (SEQ ID No.5), the length of the amplified target sequence is 104 bp, and the positions of the primer and the probe on the target sequence are as Figure 5As shown, primer DBN8002-IF 5′—GTTGGTTAAGTAGGTTATG—3′ (SEQ ID No.7) and DBN8002-IR 5′—GTGTCCCATATATAGCAA—3′ (SEQ ID No.8), probe DBN8002-IP 5′—CAAGCGTTACACATAATTAATGTCT—3′ (SEQ ID No.9), the amplified target sequence is 177bp long, and the positions of the primer and probe on the target sequence are as Figure 6 shown.

[0069] II. Application of the primer / probe combination

[0070] Synthesize the primer / probe in the present invention and the primer / probe of the soybean internal standard gene lec gene. Extract the total DNA of the transgenic corn DBN8002 sample, and use the primer pairs or primer / probe combinations of the internal standard gene lec, the DBN8002 transformant, and the receptor insertion site to perform PCR amplification on the sample genomic DNA respectively. The ordinary PCR products are separated by agarose gel electrophoresis, and after EB staining, it is identified whether there are amplified products; for the real-time fluorescence PCR products, it is judged whether there are amplified products according to whether there are typical amplification curves. According to the amplification results of each primer pair or primer / probe combination, identify the identity of the DBN8002 transformant, or quantify the DBN8002 transformant, or judge the genotype of each sample.

[0071] Compared with the prior art, the present invention has the following advantages and positive effects:

[0072] (1) On the ordinary PCR or real-time fluorescence PCR platform, identify the identity of the sample to be tested through qualitative PCR;

[0073] (2) On the real-time fluorescence PCR or digital PCR platform, measure the content of the DBN8002 transformant through quantitative PCR;

[0074] (3) On the ordinary PCR or real-time fluorescence PCR platform, accurately determine the genotype of the sample to be tested through qualitative PCR;

[0075] (4) There is no need to identify homozygotes or heterozygotes through field segregation tests, saving labor, time and economic costs;

[0076] (5) It provides an accurate, fast and economical method for identifying the genotypes of raw materials in the fields of transgenic breeding and the development of transgenic reference materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] Figure 1 Schematic diagram of the principle of ordinary PCR for identifying homozygotes and heterozygotes of transgenic soybean DBN8002;

[0078] Figure 2 Schematic diagram of the principle of real-time fluorescence PCR for identifying homozygotes and heterozygotes of genetically modified soybean DBN8002;

[0079] Figure 3 Schematic diagram of the positions of the designed DBN8002 transformant-specific conventional PCR primers on the target sequence;

[0080] Figure 4 Schematic diagram of the positions of the designed receptor insertion site-specific conventional PCR primers on the target sequence;

[0081] Figure 5 Schematic diagram of the positions of the designed DBN8002 transformant-specific real-time fluorescence PCR primers and probes on the target sequence;

[0082] Figure 6 Schematic diagram of the positions of the designed receptor insertion site-specific real-time fluorescence PCR primers and probes on the target sequence;

[0083] Figure 7 Electrophoresis pattern of identifying the DBN8002 transformant of genetically modified soybean by conventional qualitative PCR;

[0084] Figure 8 Amplification curve of identifying the DBN8002 transformant of genetically modified soybean by real-time fluorescence PCR;

[0085] Figure 9 Electrophoresis pattern of identifying homozygous plants, heterozygous plants and negative plants of genetically modified soybean DBN8002 by conventional qualitative PCR;

[0086] Figure 10 Amplification curve of identifying homozygous plants, heterozygous plants and negative plants of genetically modified soybean DBN8002 by real-time fluorescence PCR;

[0087] Figure 11 Standard curve and quantitative results of quantitatively detecting the content of the DBN8002 transformant of genetically modified soybean by fluorescence quantitative PCR;

[0088] Figure 12 Microdroplet heat map and quantitative results of quantitatively detecting the content of the DBN8002 transformant of genetically modified soybean by digital PCR. Specific implementation manners

[0089] The following details the application method of the present invention in conjunction with the accompanying drawings and embodiments:

[0090] Table 1 Primer sequences for identifying the DBN8002 transformant and genotype of genetically modified soybean and quantification by conventional PCR and real-time fluorescence PCR methods.

[0091]

[0092]

[0093] Example 1 Identification of DBN8002 transformants on a conventional PCR platform

[0094] Using a single plant or a single seed of transgenic soybean DBN8002 as a test sample, and using the primer pairs DBN8002-F / DBN8002-R designed in the present invention and the soybean endogenous gene primer pair Lec-1672F (5′-GCCCTCTACTCCACCCCCA-3′ SEQ ID No. 13) / Lec-1881F (5′-GGCGAAGCTGGCAACG-3′ SEQ ID No. 14), with the extracted genomic DNA as a template, the DBN8002 transformants in each sample were identified.

[0095] The PCR reaction used a 25 μL reaction system, containing 2 μL of DNA template, 1×PCR Buffer (containing 10 mM Tris HCl pH 8.3, 50 mM KCl), 200 μM dNTPs, 2.5 mM MgCl2, 250 nM of forward primer and reverse primer, and 1 U of DNA Taq enzyme. The reaction procedure was pre-denaturation at 95°C for 3 minutes, 30 seconds at 95°C, 30 seconds at 58°C, 30 seconds at 72°C, 35 cycles, and incubation at 72°C for 5 minutes. The PCR products were separated by agarose gel electrophoresis and identified for the presence of amplification products after EB staining.

[0096] Using 2 sets of conventional PCR primer pairs: the DBN8002 transformant primer pair DBN8002-F / DBN8002-R designed in the present invention and the soybean endogenous gene primer pair Lec-1672F / Lec-1881F, the extracted genomic DNA was amplified. If there were amplification bands for the soybean endogenous gene lectin and the DBN8002 transformant primer pair in the DBN8002 transformant sample, it was determined to be a DBN8002 transformant; if there was only an amplification product for the soybean primer pair of the soybean endogenous gene in the non-DBN8002 transformant sample, it was determined to be a negative sample( Figure 6 ). The experimental results were consistent with the expectations, and the transformants of DBN8002 soybean could be accurately identified.

[0097] Example 2 Identification of DBN8002 transformants on a real-time fluorescence PCR platform

[0098] Use a single plant or single seed of transgenic soybean DBN8002 as a test sample, and use the primer pairs DBN8002-QF / DBN8002-QR / DBN8002-QP designed in the present invention and the soybean internal standard gene primer pairs lec-F (5′-GCCCTCTACTCCACCCCCA-3′ SEQ ID No.10) / lec-R (5′-GGCGAAGCTGGCAACG-3′ SEQ ID No.11) / lec-P (5′-AGCTTCGCCGCTTCCTTCAACTTCAC-3′ SEQ ID No.12). Using the extracted genomic DNA as a template, identify the DBN8002 transformant of each sample.

[0099] Real-time fluorescence PCR analysis was performed on a CFX96 PCR instrument. The PCR reaction system was 25 μL, containing 2 μL of DNA template, 1×PCR buffer (containing 1 U of Taq DNA polymerase, 4.5 mM MgCl2, 300 μM dNTPs), 400 nM forward and reverse primers, and 200 nM probe. PCR reaction program: After pre-denaturation at 95°C for 10 minutes, 45 PCR cycles were carried out: denaturation at 95°C for 15 seconds, annealing and extension at 60°C for 1 minute, and fluorescence signals were collected.

[0100] Use two primer / probe combinations: the DBN8002 transformant primer / probe combination DBN8002-QF / DBN8002-QR / DBN8002-QP designed in the present invention and the soybean internal standard gene soybean primer / probe combination lec-F / lec-R / lec-P to amplify the extracted genomic DNA. The soybean internal standard gene lectin of the DBN8002 transformant sample and the DBN8002 transformant have typical amplification curves, and it is determined to be a DBN8002 transformant; only the soybean internal standard gene lectin primer / probe combination of the non-DBN8002 transformant sample has amplification products, and it is determined to be a negative sample ( Figure 7 ). The experimental results are consistent with the expectations, and the transformants of DBN8002 soybeans can be accurately identified.

[0101] Example 3 Identify the genotype of transgenic soybean DBN8002 on a common PCR platform

[0102] Using a single plant or a single seed of transgenic soybean DBN8002 as a test sample, and using the primer pairs DBN8002-F / DBN8002-R, DBN8002 receptor primer pair DBN8002-F (5′—GTATAAGGTCTTTGGTTGGATTATCG—3′ SEQ ID No.1) / DBN8002-GR (5′—ACCCTCTCGAAGTGTTTGCT—3′ SEQ ID No.6), and soybean internal standard gene primer pair Lec-1672F (5′-GCCCTCTACTCCACCCCCA-3′ SEQ ID No.13) / Lec-1881R (5′-GGCGAAGCTGGCAACG-3′ SEQ IDNo.14) designed in the present invention, with the extracted genomic DNA as a template, identify the homozygotes and heterozygotes of each sample.

[0103] The PCR reaction uses a 25 μL reaction system, containing 2 μL of DNA template, 1×PCR Buffer (containing 10 mM TrisHCl pH8.3, 50 mM KCl), 200 μM dNTPs, 2.5 mM MgCl2, 400 nM of forward primer and reverse primer, and 1 U DNA Taq enzyme. The reaction procedure is as follows: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 1 minute, 35 cycles, and incubation at 72°C for 5 minutes. The PCR products are separated by agarose gel electrophoresis, and after EB staining, identify whether there are amplified products.

[0104] Using three common PCR primer pairs: the DBN8002 transformant primer pair DBN8002-F / DBN8002-R, DBN8002 receptor primer pair DBN8002-F / DBN8002-GR, and soybean internal standard gene primer pair Lec-1672F / Lec-1881R designed in the present invention, amplify the genomic DNA extracted from a single plant or a single seed. For the DBN8002 transformant homozygous sample, only the soybean internal standard gene lectin and the DBN8002 transformant have amplified bands, and it can be determined as a homozygote; for the BN8002 transformant heterozygous sample, all three primer combinations have amplified products, and it is determined as a heterozygote; for the non-DBN8002 transformant sample, only the soybean internal standard gene soybean and the DBN8002 receptor primer pair have amplified products, and it is determined as a negative sample ( Figure 8 ). The experimental results are consistent with the expectations, and the homozygotes and heterozygotes of transgenic soybean DBN8002 can be accurately identified.

[0105] Example 4 Identification of the genotype of transgenic soybean DBN8002 on a real-time fluorescence PCR platform

[0106] Using a single plant or single seed of transgenic soybean DBN8002 as a test sample, and using the primer / probe combinations DBN8002-F / DBN8002-R / DBN8002-P, DBN8002 receptor primer / probe combination DBN8002-QF(5′—GTTGGTTAAGTAGGTTATG—3′SEQ ID No.7) / DBN8002-QR(5′—GTGTCCCATATATAGCAA—3′SEQ ID No.8) / DBN8002-QP(5′—CAAGCGTTACACATAATTAATGTCT—3′SEQ ID No.9), and the primer / probe combination lec-F(5′-GCCCTCTACTCCACCCCCA-3′SEQ ID No.10) / lec-R(5′-GGCGAAGCTGGCAACG-3′SEQ ID No.11) / lec-P(5′-AGCTTCGCCGCTTCCTTCAACTTCAC-3′SEQ ID No.12) of the soybean endogenous gene soybean designed in the present invention, using the extracted genomic DNA as a template, identify the homozygotes and heterozygotes of each sample.

[0107] Real-time fluorescence PCR analysis was carried out on a CFX96 PCR instrument. The PCR reaction system was 25 μL, containing 2 μL of DNA template, 1×PCR buffer (containing 1 U of Taq DNA polymerase, 4.5 mM MgCl2, 300 μM dNTPs), 400 nM forward and reverse primers, and 200 nM probe. The PCR reaction procedure: After pre-denaturation at 95°C for 10 minutes, 45 PCR cycles were carried out: denaturation at 95°C for 15 seconds, annealing and extension at 60°C for 1 minute, and fluorescence signals were collected.

[0108] Using three primer / probe combinations: the DBN8002 transformant primer / probe combination DBN8002-QF / DBN8002-QR / DBN8002-QP, the DBN8002 receptor primer / probe combination DBN8002-IF / DBN8002-IR / DBN8002-IP, and the soybean endogenous gene soybean primer / probe combination lec-F / lec-R / lec-P designed in the present invention, amplify the genomic DNA extracted from a single plant or single seed. For the DBN8002 transformant homozygous sample, only the soybean endogenous gene lectin and the DBN8002 transformant primer / probe have typical amplification curves, and it is determined as a homozygote; for the DBN8002 transformant heterozygous sample, all three primer / probe combinations have amplification products, and it is determined as a heterozygote; for the non-DBN8002 transformant sample, only the soybean endogenous gene lectin and the DBN8002 receptor primer / probe combination have amplification products, and it is determined as a negative sample ( Figure 9)。The experimental results are consistent with the expectations, and the homozygotes and heterozygotes of transgenic soybean DBN8002 can be accurately identified.

[0109] Example 5 Quantitative detection of transgenic soybean DBN8002 on a real-time fluorescence PCR platform

[0110] Using the genomic DNA of the sample to be tested as the test sample, and using the primer / probe combination DBN8002-F / DBN8002-R / DBN8002-P designed in the present invention, and the primer / probe combination lec-F / lec-R / lec-P of the soybean internal standard gene soybean. By serially diluting the genomic DNA of the transformant of DBN8002 at 50 ng / μL by 10-fold, 10-fold, 10-fold, and 4-fold with 1×TE buffer respectively, so that the contents of the transformant of DBN8002 and the internal standard gene lec in the final 25 μL system are 100, 10, 1, 0.1, and 0.025 ng. According to the linear relationship between the contents of the transformant of DBN8002 and the internal standard gene lec and the Ct value, a standard curve is drawn. All fluorescence quantitative reactions are repeated 3 times.

[0111] According to the optimized results of the standard curve, using the same PCR reaction conditions as those for establishing the standard curve, and using the standard curve as a reference to determine the amount of the genomic DNA of the DBN8002 transformant in the mixed soybean DNA sample containing the genomic DNA of DBN8002. Taking 100 ng of genomic DNA as the template, using standard samples with different contents to make a standard curve, and according to the obtained standard curve and the Ct value of the transgenic sample, calculate the mass of the genomic DNA of the DBN8002 transformant, and thus calculate the content of the DBN8002 transformant in the sample. All fluorescence quantitative reactions are repeated 3 times.

[0112] Real-time fluorescence PCR analysis is carried out on a CFX96 PCR instrument. The PCR reaction system is 25 μL, containing 2 μL of DNA template, 1×PCR buffer (containing 1.25 U of Taq DNA polymerase, 4.5 mM MgCl2, 300 μM dNTPs), 400 nM of forward and reverse primers, and 200 nM of probe. PCR reaction program: After pre-denaturation at 95°C for 10 minutes, 45 PCR cycles are carried out: denaturation at 95°C for 15 seconds, annealing and extension at 60°C for 1 minute, and fluorescence signals are collected.

[0113] Using two primer / probe combinations: The primer / probe combination DBN8002-QF / DBN8002-QR / DBN8002-QP designed for the DBN8002 transformant of the present invention and the primer / probe combination lec-F / lec-R / lec-P for the soybean endogenous gene were used to amplify the template DNA. According to the fluorescence curve information obtained by gradient dilution of the template with 3 replicates, a standard curve was established for the specific fluorescence quantitative PCR reaction of the DBN8002 transformant. As Figure 10 shown, its R 2 is 0.998, indicating that there is a good corresponding relationship between the copy number of the foreign gene and the fluorescence intensity, which is suitable for the precise quantification of the foreign gene.

[0114] To verify the accuracy of the quantitative method established in this study, the genomic DNA extracted from the standard transgenic soybean DBN8002 transformant product was diluted to a certain content with non-transgenic rapeseed genomic DNA, and the same amount of genomic DNA without the genomic DNA of the transgenic soybean DBN8002 transformant was used as a control, which served as the template for the real-time fluorescence quantitative PCR reaction. According to the standard curve obtained under the same conditions, the content of the genomic DNA of the transgenic soybean DBN8002 transformant in different samples was calculated.

[0115] Using the non-transgenic soybean genomic DNA without the transgenic soybean DBN8002 transformant as the template, no amplification products were detected. For the mixed experimental samples, the specific fluorescence quantitative detection method for transgenic soybean DBN8002 established in this study was used for detection, and the quantitative results were very close to the theoretical values, with an error less than 15% and a deviation less than 10% ( Figure 10 ).

[0116] From the above results, it can be seen that the real-time fluorescence PCR quantitative detection method for the DBN8002 transformant provided by the present invention is accurate and reliable, providing a useful reference and means for the quantitative detection of the DBN8002 transformant.

[0117] Example 6 Quantitative detection of transgenic soybean DBN8002 on the digital PCR platform

[0118] Using the genomic DNA of the sample to be tested as the test sample, the primer / probe combination DBN8002-F / DBN8002-R / DBN8002-P designed in the present invention and the primer / probe combination lec-F / lec-R / lec-P for the soybean endogenous gene were used. The accuracy was detected using the prepared standard samples of 100%, 3%, and 1% as templates, and the content of the DBN8002 transformant was the ratio of the copy number of the DBN8002 transformant to the copy number of the soybean endogenous gene.

[0119] Digital PCR amplification was performed on a BioRad PCR instrument. The PCR reaction system was 20 μL, containing 2 μL of DNA template, 1×ddPCR Supermix for Probes, 400 nM forward and reverse primers, and 200 nM probe. The PCR reaction procedure was as follows: After pre-denaturation at 95°C for 10 minutes, denaturation at 94°C for 30 seconds, annealing and extension at 60°C. Denaturation and annealing / extension were carried out for 49 cycles, and the enzyme was inactivated at 98°C for 10 minutes. Then the temperature was cooled to 4°C, and the copy number was read on a droplet reader.

[0120] Two primer / probe combinations were used: the DBN8002 transformant primer-probe combination DBN8002-QF / DBN8002-QR / DBN8002-QP designed by the present invention and the soybean internal standard gene soybean primer-probe combination lec-F / lec-R / lec-P to amplify the template DNA ( Figure 11 ). According to the read exogenous and internal reference copy number concentrations, the content of the DBN8002 transformant was determined.

[0121] To verify the accuracy of the quantitative method established in this study, genomic DNA extracted from the standard transgenic soybean DBN8002 transformant product was diluted with non-transgenic rapeseed genomic DNA to a certain content, and three technical replicates were performed to calculate the content of transgenic soybean DBN8002 transformant genomic DNA in different samples.

[0122] Using genomic DNA with transgenic soybean DBN8002 transformant contents of 100%, 3%, and 1% as templates, the obtained transgenic soybean DBN8002 transformant contents were all very close to the theoretical values, with the error and deviation rate less than 10% ( Figure 11 ).

[0123] From the above results, it can be seen that the present invention provides a simple and reliable determination method for the quantitative detection and analysis of transgenic soybean DBN8002, which can be used for the quantification of transgenic soybean DBN8002 in mixed products from different sources and with different contents. The present invention provides a useful reference for transgenic labeling and necessary means for the control of transgenic products.

Claims

1. An ordinary PCR detection composition for detecting the specific genomic insertion site of the transformant of transgenic soybean DBN8002, characterized in that it comprises a primer pair shown in SEQ ID NO.1 and SEQ ID NO.2: DBN8002-F 5′—GTATAAGGTCTTTGGTTGGATTATCG—3′SEQ ID No.1 DBN8002-R 5′—GTCGTTTCCCGCCTTCAGTT—3′SEQ ID No.2, Preferably, the ordinary PCR detection composition further comprises a primer pair for the soybean internal standard gene; More preferably, the primer pair for the soybean internal standard gene is shown in SEQ ID NO.13 and SEQ ID NO.

14.

2. A real-time fluorescence PCR detection composition for detecting the specific genomic insertion sites of the transformant of transgenic soybean DBN8002: characterized in that And it comprises a primer pair shown in SEQ ID NO.3 and SEQ ID NO.4 and a probe shown in SEQ ID NO.5: DBN8002-QF 5′—TATCCGCAATGTGTTATTAAGTTGTC—3′SEQ ID No.3 DBN8002-QR 5′—TGTCATTCCTCAAGTGTCCCAT—3′SEQ ID No.4 DBN8002-QP 5′—TGTGTAACGCTTGTTTTGCTAT—3′SEQ ID No.5; Preferably, the real-time fluorescence PCR detection composition further comprises a primer pair for the soybean internal standard gene and a probe composition; More preferably, the primer pair for the soybean internal standard gene is shown in SEQ ID NO.10 and SEQ ID NO.11, and the probe sequence is shown in SEQ ID NO.

12.

3. A common PCR detection composition for detecting the receptor genome insertion site specificity of genetically modified soybean DBN8002, characterized in that, It includes: The ordinary PCR detection composition according to claim 1, and The second primer pair specific for the genomic insertion site of the DBN8002 receptor: The second primer pair specific is shown in SEQ ID No.1 and SEQ ID No.6; DBN8002-F 5′—GTATAAGGTCTTTGGTTGGATTATCG—3′SEQ ID No.1 DBN8002-GR 5′—ACCCTCTCGAAGTGTTTGCT—3′SEQ ID No.6; Preferably, the ordinary PCR detection composition further comprises a primer pair for the soybean internal standard gene; More preferably, the primer pair for the soybean internal standard gene is shown in SEQ ID NO.13 and SEQ ID NO.

14.

4. A real-time fluorescence PCR detection primer and probe composition for detecting the specific genomic insertion site of the DBN8002 receptor of transgenic soybean, which includes: The real-time fluorescence PCR detection composition for the specific genomic insertion site of the transformant of transgenic soybean DBN8002 according to claim 2, The second primer and probe composition specific for the genomic insertion site of the DBN8002 receptor: DBN8002-IF 5′—GTTGGTTAAGTAGGTTATG—3′SEQ ID No.7 DBN8002-IR 5′—GTGTCCCATATATAGCAA—3′SEQ ID No.8 DBN8002-IP 5′—CAAGCGTTACACATAATTAATGTCT—3′SEQ ID No.9; Preferably, the real-time fluorescence PCR detection composition further comprises a primer pair and a probe composition for a soybean internal standard gene; More preferably, the primer pair for the soybean internal standard gene is as shown in SEQ ID NO.10 and SEQ ID NO.11, and the probe sequence is as shown in SEQ ID NO.

12.

5. Identification method for transgenic soybean DBN8002 transformant, the method being a conventional PCR method, characterized in that, It is detected using the general PCR detection composition described in claim 1, Preferably, in the amplification result, if the primer pair for the soybean internal standard gene and the primer pairs shown in SEQ ID NO.1 and SEQ ID NO.2 amplify bands, it is determined as the DBN8002 transformant; if the primer pair for the soybean internal standard gene has an amplification product and the primer pairs shown in SEQ ID NO.1 and SEQ ID NO.2 have no amplification product, it is determined as a negative sample.

6. Identification method for transgenic soybean DBN8002 transformant, said method being a real-time fluorescence PCR method, characterized in that, It is detected using the real-time fluorescence PCR detection primer composition described in claim 2, Preferably, in the amplification result, if the primer pair and probe composition for the soybean internal standard gene and the primer pairs shown in SEQ ID NO.3 and SEQ ID NO.4 and the probe shown in SEQ ID NO.5 amplify an amplification curve, it is determined as the DBN8002 transformant; if the primer pair and probe composition for the soybean internal standard gene have an amplification curve and the primer pairs shown in SEQ ID NO.3 and SEQ ID NO.4 and the probe shown in SEQ ID NO.5 have no amplification curve, it is determined as a negative sample.

7. Method for identifying genotype of transgenic soybean DBN8002, wherein the method for identifying genotype of transgenic soybean DBN8002 is a conventional PCR method, characterized in that, It is detected using the general PCR detection composition described in claim 3; Preferably, in the amplification result, if the primer pair for the soybean internal standard gene and the primer pairs shown in SEQ ID NO.1 and SEQ ID NO.2 amplify bands and the second primer pair has no amplification band, it is determined as a homozygote; if the primer pair for the soybean internal standard gene, the primer pairs shown in SEQ ID NO.1 and SEQ ID NO.2, and the specific second primer pair all have amplification products, it is determined as a heterozygote; if only the primer composition for the internal standard gene by ordinary PCR and the specific second primer pair have amplification products, it is determined as a negative sample; Or, The method for genotyping the transgenic soybean DBN8002 is a real-time fluorescence PCR method, and it is detected using the real-time fluorescence PCR detection composition described in claim 4; Preferably, in the amplification result, if there is an amplification curve for the primer pair and probe composition of the soybean internal standard gene, the primer pair shown in SEQ ID NO.3 and SEQ ID NO.4, and the probe composition shown in SEQ ID NO.5, it is determined as a homozygote; if there are amplification curves for the primer pair and probe composition of the soybean internal standard gene, the primer pair shown in SEQ ID NO.3 and SEQ ID NO.4, the probe composition shown in SEQ ID NO.5, and the specific second primer and probe primer composition, it is determined as a heterozygote; if there are typical amplification curves only for the primer pair and probe composition of the soybean internal standard gene and the specific second primer and probe primer composition, it is determined as a negative sample.

8. A method for quantitatively detecting transgenic soybean DBN8002, wherein the method is a real-time fluorescence method, and the method uses the real-time fluorescence PCR detection composition described in claim 2 for detection; Preferably, by respectively amplifying with the primer pair and probe composition specific for the insertion site of the transgenic soybean DBN8002 transformant genome described in claim 2 and the primer pair and probe composition of the soybean internal standard gene on a real-time fluorescence PCR instrument; using the gradient-diluted DBN8002 transformant genomic DNA as a calibrator, with at least 5 concentration gradients, according to the linear relationship between the content of the DBN8002 transformant and the internal standard gene and the Ct value, respectively draw the standard curves of the DBN8002 transformant and the soybean internal standard gene. Substitute the Ct value obtained from the test sample into the standard curve to calculate and obtain the result of the transformant content of DBN8002; Or, The method is a digital PCR method, and the method uses the composition for real-time fluorescence PCR detection described in claim 2 for detection. Preferably: By respectively amplifying with the primer pair and probe composition specific for the insertion site of the transgenic soybean DBN8002 transformant genome described in claim 2 and the primer pair and probe composition of the soybean internal standard gene lec on a digital PCR instrument and reading the data of the droplets or chips, obtaining the copy number concentrations of the transgenic soybean DBN8002 transformant and the internal standard gene, and then calculating the ratio to obtain the result of the transformant content of DBN8002.

9. A kit for detecting transgenic soybean DBN8002, which comprises the detection composition described in any one of claims 1-4.

10. The application of the detection composition described in any one of claims 1-4, or the kit described in claim 9 in the detection of transgenic soybean DBN8002; Preferably, the detection is for qualitative or quantitative detection; Preferably, the detection is for genotype detection.

Images