Construction method and application of SARS-CoV-2 combined basic disease model

Abstract

The invention discloses a construction method and application of an SARS-CoV-2 combined basic disease model, and relates to the technical field of disease models. Based on the phenotype that 750 atherosclerotic mice have spontaneous atherosclerotic symptoms, hACE2 genes are introduced into modeling objects, then SARS-CoV-2 infection is carried out, an SARS-Cov-2 combined basic disease infection model is constructed, and the clinical condition that basic disease patients are infected with SARS-CoV-2 is simulated. According to the invention, the research and development of antiviral drugs with basic diseases can be accelerated, and the application value is extremely high.

Description

Technical Field

[0001] The present invention relates to the technical field of disease models, and more specifically, to a method for constructing a SARS-CoV-2 co-existing underlying disease model and its application. Background Art

[0002] Metabolism-related underlying diseases include diseases such as obesity, diabetes, and cardiovascular and cerebrovascular diseases. Cardiovascular and cerebrovascular diseases are a general term for heart blood vessel and cerebrovascular diseases, generally referring to ischemic or hemorrhagic diseases that occur in the heart, brain, and whole body tissues caused by hyperlipidemia, blood viscosity, atherosclerosis, hypertension, etc. Clinically, patients with underlying diseases related to glucose and lipid metabolism such as obesity, diabetes, and atherosclerosis are prone to severe cases after being infected with SARS-CoV-2. There is a lack of animal models that can simulate the situation of patients infected with SARS-CoV-2 in this regard. In order to accelerate the research and development of antiviral drugs, it is necessary to test the in vivo efficacy and safety of these experimental therapeutic agents without putting patients at risk. There is an urgent need for animal models that can withstand SARS-CoV-2 infection.

[0003] In view of this, the present invention is specifically proposed. Summary of the Invention

[0004] The purpose of the present invention is to provide a method for constructing a SARS-CoV-2 co-existing underlying disease model and its application to solve the above technical problems.

[0005] The present invention is implemented as follows:

[0006] In the first aspect, the present invention provides a method for constructing a SARS-CoV-2 co-existing underlying disease model, which includes the following steps:

[0007] Using 750 atherosclerotic mice and their offspring individuals as the objects to be modeled, introducing the hACE2 gene into the modeling objects, and then infecting them with SARS-CoV-2; the strain number of the 750 atherosclerotic mice is C57BL / 6JGpt-Chr1YP1 / Gpt|Strain NO.D000750.

[0008] In the second aspect, the present invention also provides the application of the SARS-CoV-2 co-existing underlying disease model constructed by the method for constructing a SARS-CoV-2 co-existing underlying disease model in screening drugs for preventing and / or treating SARS-CoV-2 co-existing underlying diseases.

[0009] The present invention has the following beneficial effects:

[0010] Based on the phenotype that 750 mice spontaneously exhibit atherosclerotic symptoms, by introducing the hACE2 gene into the modeling object and then performing SARS-CoV-2 infection, a SARS-Cov-2 co-infection model with underlying diseases was constructed to simulate the situation of SARS-CoV-2 infection in clinically patients with underlying diseases. Through clinical symptom observation, the constructed mouse model showed more severe symptoms after SARS-CoV-2 infection, and these symptoms were consistent with the clinical manifestations of human patients, such as significant weight loss, more severe pathological damage to the lungs, affecting the activation and function of immune cells, increasing inflammation and promoting pulmonary fibrosis, and causing significant changes in related metabolites in pathways such as phospholipid biosynthesis pathway and purine metabolism.

[0011] The proposal of the present invention helps to accelerate the research and development of antiviral drugs for patients with underlying diseases and has extremely high application value. Brief Description of the Drawings

[0012] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required for use in the embodiments. It should be understood that the following drawings only show some embodiments of the present invention, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings.

[0013] Figure 1 Flow chart of experiments for SARS-CoV-2 infection of diabetic model mice and chromosome substitution wild mice 750;

[0014] Figure 2 Curve of body weight change and lung virus load map of SARS-CoV-2 infected mice;

[0015] Figure 3 Pathological analysis of the lungs of SARS-CoV-2 infected mice;

[0016] Figure 4 Combined analysis of proteome and phosphorylome of the lungs of SARS-CoV-2 infected spontaneous atherosclerotic 750 spontaneous atherosclerotic mice;

[0017] Figure 5 Plasma and lung metabolomics analysis of SARS-CoV-2 infected spontaneous atherosclerotic 750 spontaneous atherosclerotic mice. Detailed Embodiments

[0018] Reference will now be made in detail to embodiments of the present invention, one or more examples of which are described below. Each example is provided by way of explanation and not limitation of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment can be used in another embodiment to yield a still further embodiment.

[0019] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be described clearly and completely below. For those conditions not specified in the embodiments, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. For reagents or instruments whose manufacturers are not specified, they are all conventional products that can be obtained through commercial purchase.

[0020] In a first aspect, the present invention provides a method for constructing a SARS-CoV-2 combined with underlying disease model, which comprises the following steps:

[0021] Using 750 atherosclerotic mice and their offspring individuals as the objects to be modeled, introducing the hACE2 gene into the modeling objects, and then performing SARS-CoV-2 infection; the strain number of the 750 atherosclerotic mice is C57BL / 6JGpt-Chr1YP1 / Gpt|Strain NO.D000750.

[0022] Currently, there is a problem that ordinary mice cannot be infected with SARS-CoV-2. The inventors found that compared with the disease model in which C57BL / 6 mice can be induced to develop type II diabetes (T2DM) by a high-fat diet plus drug induction, using 750 mice as the objects to be modeled, introducing the hACE2 gene into the modeling objects, and then performing SARS-CoV-2 infection, an animal model that can more realistically simulate the situation of clinically underlying disease patients infected with SARS-CoV-2 can be obtained. Through clinical symptom observation, the constructed mouse model showed more severe symptoms after being infected with SARS-CoV-2, and these symptoms were consistent with the clinical manifestations of human patients, such as a significant decrease in body weight, more severe pathological damage to the lungs, affecting the activation and function of immune cells, increasing inflammation and promoting pulmonary fibrosis, and causing significant changes in related metabolites in pathways such as the phospholipid biosynthesis pathway and purine metabolism.

[0023] In a preferred embodiment of the application of the present invention, the method for introducing the hACE2 gene into the modeling object is selected from any one of the following:

[0024] (1) Introducing the hACE2 gene into the modeling object by means of a recombinant viral vector, and the recombinant viral vector contains the hACE2 gene;

[0025] (2) The hACE2 gene is introduced into the modeling object by gene editing, and the gene editing method is selected from: the gene editing technology is selected from at least one of CRISPR / Cas9 technology, CRISPR / Cas12a technology, CRISPR / Cas13a technology, zinc finger nuclease technology mediated by artificial nucleases, transcription activator-like effector nuclease technology, and Cre-loxp gene knockout technology.

[0026] The hACE2 gene refers to the human ACE gene.

[0027] In a preferred embodiment of the application of the present invention, the recombinant viral vector is a recombinant lentiviral vector, a recombinant adeno-associated viral vector, or a recombinant adenoviral vector.

[0028] The AAV nucleic acid sequence of the recombinant adeno-associated virus is derived from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, or a combination thereof.

[0029] The terms AAV vector, AAV particle, AAV vector particle, recombinant AAV particle, recombinant AAV vector particle, and rAAV are used interchangeably and, as used herein, refer to AAV capsids with or without a DNA genome containing ITRs produced by producer cells or packaging cells, respectively.

[0030] The recombinant adenovirus is, for example, hACE2-ADV, a recombinant adenovirus strain expressing human ACE2 constructed by the company. The full-length human ACE2 gene is constructed on the pADTrack-CMV transfer vector, and a defective type 5 adenovirus genomic plasmid pAdE-hACE2 containing the hACE2 gene is obtained based on homologous recombination in bacteria. After linearizing the plasmid containing the viral genome, it is transfected into 293 cells, and the supernatant containing the P0 generation of hACE2-adenovirus is harvested.

[0031] In a preferred embodiment of the application of the present invention, when using the recombinant viral vector method, the recombinant viral vector or the viral particle carrying the recombinant viral vector is first used to infect the object to be modeled, and after 5 - 7 days, it is infected with SARS-CoV-2.

[0032] In a preferred embodiment of the application of the present invention, when the recombinant viral vector is a recombinant adenoviral vector, the inoculation dose for infecting the object to be modeled is 2×10 8 -5×10 8 TCID 50 / animal;

[0033] In a preferred embodiment of the application of the present invention, the inoculation dose of SARS-CoV-2 is 1×10 5 -1×106 TCID 50 / only.

[0034] In a preferred embodiment of the application of the present invention, the recombinant viral vector, the viral particle carrying the recombinant viral vector, or the infection mode of SARS-CoV-2 is nasal drip infection.

[0035] In a preferred embodiment of the application of the present invention, the underlying disease is selected from the underlying diseases related to metabolism.

[0036] In a preferred embodiment of the application of the present invention, the underlying diseases related to metabolism are selected from obesity, diabetes, or cardiovascular and cerebrovascular diseases. The disease model constructed by the present invention can simultaneously simulate multiple metabolism-related diseases. After being infected with SARS-CoV-2, it shows obvious weight loss, more severe pathological damage to the lungs, affects the activation and function of immune cells, increases inflammation and promotes pulmonary fibrosis, and significant changes occur in the related metabolites of pathways such as phospholipid biosynthesis pathway and purine metabolism. It is particularly suitable for simulating the situation of obese and diabetic patients after being infected with SARS-CoV-2.

[0037] In a preferred embodiment of the application of the present invention, the cardiovascular and cerebrovascular diseases are selected from thromboembolic diseases.

[0038] The thromboembolic diseases are selected from hereditary angioedema, advanced diabetic macular edema, myocardial infarction, angina pectoris, restenosis and reocclusion after angioplasty or aortic coronary artery bypass grafting, disseminated intravascular coagulation, stroke, transient ischemic attack, peripheral arterial occlusive disease, pulmonary embolism, or deep vein thrombosis.

[0039] In a preferred embodiment of the application of the present invention, the cardiovascular and cerebrovascular diseases are selected from at least one of coronary heart disease, atrial fibrillation, heart failure, hyperlipidemia, aortic atherosclerosis, coronary atherosclerosis, carotid atherosclerosis, cerebral atherosclerosis, renal artery atherosclerosis, and peripheral artery atherosclerosis.

[0040] In a second aspect, the present invention also provides the application of the SARS-CoV-2 combined underlying disease model constructed by the construction method of the SARS-CoV-2 combined underlying disease model in screening drugs for preventing and / or treating SARS-CoV-2 combined underlying diseases.

[0041] The proposal of the present invention helps to accelerate the research and development of antiviral drugs with underlying diseases and has extremely high application value.

[0042] In a preferred embodiment of the application of the present invention, the underlying disease is selected from the underlying diseases related to metabolism.

[0043] In a preferred embodiment of the application of the present invention, the underlying diseases related to metabolism are selected from obesity, diabetes, or cardiovascular and cerebrovascular diseases;

[0044] In a preferred embodiment of the application of the present invention, the cardiovascular and cerebrovascular diseases are selected from thromboembolic diseases;

[0045] The thromboembolic diseases are selected from hereditary angioedema, advanced diabetic macular edema, myocardial infarction, angina pectoris, reocclusion and restenosis after angioplasty or aortocoronary bypass surgery, disseminated intravascular coagulation, stroke, transient ischemic attack, peripheral arterial occlusive disease, pulmonary embolism or deep vein thrombosis;

[0046] In a preferred embodiment of the application of the present invention, the cardiovascular and cerebrovascular diseases are selected from at least one of coronary heart disease, atrial fibrillation, heart failure or hyperlipidemia, aortic atherosclerosis, coronary atherosclerosis, carotid atherosclerosis, cerebral atherosclerosis, renal artery atherosclerosis and peripheral arterial atherosclerosis.

[0047] The features and properties of the present invention will be further described in detail below in conjunction with examples.

[0048] Example 1

[0049] This example provides a method for constructing a SARS-CoV-2 combined with underlying disease model, and its modeling flowchart refers to Figure 1 chromosome replacement wild mice 750 in. The specific method for constructing the SARS-CoV-2 combined with underlying disease model is as follows:

[0050] 1. Experimental materials - virus strains

[0051] 1) SARS-CoV-2: 2019-nCoV-WIV04 (GISAID accession number: EPI_ISI_402124) was isolated by the Wuhan Institute of Virology, Chinese Academy of Sciences. After the isolated virus strain was purified, cultured, propagated and concentrated, the infectious titer of the virus was measured, and the titer unit was TCID 50 / mL.

[0052] 2) hACE2-ADV: A recombinant adenovirus strain expressing human ACE2 constructed by the company. The full-length human ACE2 gene (obtainable from NCBI) was constructed on the pADTrack-CMV transfer vector, and a defective adenovirus type 5 genome plasmid pAdE-hACE2 containing the hACE2 gene was obtained based on homologous recombination in bacteria. After linearizing the plasmid containing the viral genome, it was transfected into 293 cells, and the supernatant containing the P0 generation hACE2-adenovirus was harvested.

[0053] 2. Virus culture and titer determination

[0054] 1) Cultivation and titer determination of SARS-CoV-2: Vero E6 cells (ATCC, No. 1586) were cultured in minimum Eagle’s medium (MEM, Gibco Invitrogen) containing 10% fetal bovine serum (FBS). When the cell monolayer reached 80% confluence, SARS-CoV-2 was inoculated. After culturing for 2 days at 37 °C and 5% CO2, the cell supernatant was collected. Then, the virus suspension was centrifugally concentrated using a 100 kDa ultrafiltration concentrator tube (Millipore), and the titer of the concentrated virus on Vero E6 was determined by the end-point titration method. The titer determination is briefly described as follows: The concentrated virus suspension was serially diluted 10-fold (10 -1 ~10 -8 ). The diluted virus was inoculated into cells (8 wells of 96-well plates for each dilution). After incubation for 1 hour, the virus dilution was aspirated, and 100 μL of fresh MEM containing 2% FBS was added. After culturing for 3 days, the cytopathic effect was observed, and the virus titer (TCID 50 / mL) was calculated.

[0055] 2) Cultivation and titer determination of hACE2-ADV: Passage 0 adenovirus (MOI = 1) was used to infect 293A cells. After 48 hours, passage 1 virus was harvested. The virus was passaged in the same way to obtain passage 3 virus. Passage 3 virus (MOI = 5) was used to infect 293A cells. After 48 hours, passage 4 virus was harvested and purified by cesium chloride ultracentrifugation. The purified virus suspension was dialyzed, and the dialyzed virus stock solution was stored at -80 °C. The titer was determined on 293A cells by the end-point titration method. The purified virus suspension was serially diluted 10-fold (10 -1 ~10 -8 ). The diluted virus was inoculated into cells (8 wells of 96-well plates for each dilution). After culturing for 48 hours, the fluorescence expression was observed, and the virus titer (TCID 50 / mL) was calculated.

[0056] 3. Experimental materials - Experimental animals

[0057] SPF-grade 750 atherosclerotic mice and wild-type C57BL / 6 mice, 6 - 8 weeks old, 24 male mice. All the above mice were provided by Jiangsu Jicui Yakang Biotechnology Co., Ltd. The commercial product number of 750 atherosclerotic mice is (C57BL / 6JGpt-Chr1YP1 / Gpt|Strain NO.D000750). The mice were set as the spontaneous atherosclerosis group and further divided into 4 subgroups as follows:

[0058] Control group 1 (PBS): 6 wild-type C57BL / 6 mice;

[0059] Control group 2 (PBS): 6 spontaneously atherosclerotic 750 spontaneously atherosclerotic mice;

[0060] Infection group 1 (SARS-CoV-2 original strain): 6 wild-type C57BL / 6 mice;

[0061] Infection group 2 (SARS-CoV-2 original strain): 6 feral mice 750 spontaneously atherosclerotic mice.

[0062] 4. Virus infection

[0063] On day -5, the mice were anesthetized with isoflurane gas and then intraperitoneally injected with avertin (150 μL / 10 g) liquid anesthetic. After sufficient anesthesia, 50 μL of hACE2-ADV (2.5×10 8 TCID 50 / mouse) was instilled into the nasal cavity; on day 0, 50 μL of SARS-CoV-2 (1×10 6 TCID 50 / mouse) was instilled into the nasal cavity using the same method.

[0064] Comparative example 1

[0065] 1. Experimental materials - Experimental animals

[0066] SPF-grade hACE2 KI mice and hACE2 KI-T2DM, 8 - 10 weeks old, 9 mice each. All the above mice were provided by Jiangsu Jicui Yakang Biotechnology Co., Ltd. The mice were set as the type II diabetes induction group, and each group was further divided into 4 subgroups as follows:

[0067] Type II diabetes induction group ( Figure 1 ):

[0068] Control group 1 (PBS): 4 C57BL / 6-hACE2 KI mice;

[0069] Control group 2 (PBS): 4 C57BL / 6-hACE2 KI-T2DM mice;

[0070] Infection group 1 (SARS-CoV-2 original strain): 5 C57BL / 6-hACE2 KI mice;

[0071] Infection group 2 (SARS-CoV-2 original strain): 5 C57BL / 6-hACE2 KI-T2DM mice.

[0072] The following type II diabetes induction was performed on the type II diabetes induction group:

[0073] Before the virus attack, the C57BL / 6-hACE2 KI-T2DM mice in the control group 2 and the infection group 2 were fed a high-fat diet for two weeks to induce insulin resistance, and then STZ (streptozotocin) at a dose of 25-40 mg / Kg was intraperitoneally injected, and then the high-fat diet was continued. The blood glucose changes of the mice were detected by a blood glucose meter, and the fasting blood glucose and postprandial blood glucose were measured to determine whether they had type 2 diabetes. The blood glucose test results showed that before the virus attack, the blood glucose of all mice induced with type 2 diabetes (C57BL / 6-hACE2 KI-T2DM) was generally higher than 11.0mmol / L, while the blood glucose of mice not induced with type 2 diabetes (C57BL / 6-hACE2 KI) was basically stable at 6.0-8.0mmol / L.

[0074] 2. Viral infection

[0075] Type 2 diabetes induction group: On day 0, mice were anesthetized with isoflurane gas, and then intraperitoneally injected with avertin (150 μL / 10 g) liquid anesthetic. After adequate anesthesia, the nasal cavity was inoculated with 50 μL of SARS-CoV-2 (1×10 6 TCID 50 / ml only).

[0076] The subsequent animal behavior observation, animal dissection, sample collection and experimental methods are the same as those in Example 1.

[0077] Experimental Example 1

[0078] Animal behavior observation, animal dissection and sample collection were performed on the animal models constructed in Example 1 and Comparative Example 1, respectively, and testing and analysis were performed according to the following experimental methods.

[0079] 1. Animal behavior observation

[0080] After virus infection, the clinical symptoms of mice were observed every day, and the body weight of mice was measured and recorded.

[0081] When the mice lose weight significantly (≥15%), have poor appetite, decreased activity, and slow movements, they are judged to be in the dying stage, and they are euthanized and dissected. If they do not meet the dying standard, all mice are dissected and killed on the 5th day after infection, and the experimental animal dissection is performed according to the standard operation of experimental animals.

[0082] Clinical performance indicators

[0083] After viral infection, the mice were observed every day for typical clinical symptoms and signs that simulated human COVID-19 disease, including weight, hair, activity, secretions, death, etc.

[0084] 2. Animal Dissection and Sample Collection

[0085] On the 5th day after infection, the mice were anesthetized with gas, then blood was collected by eye enucleation and the mice were sacrificed. All animals were dissected to collect lung tissues, which were divided into several parts. One part was weighed and lysed with TRIzol for analyzing the genomic copy number of the virus, and another part was fixed with 10% neutral formalin for pathological analysis. In the spontaneous atherosclerosis group, two additional parts were taken. One part was treated with LC-grade methanol for metabolomics analysis, and one part was treated with 2% SDS (sodium dodecyl sulfate) for proteomics analysis; animal dissection was performed according to the standard operating procedures for experimental animals. The test methods for qRT-PCR and histopathological analysis are shown below.

[0086] The methods for phenotypic analysis and evaluation are as follows:

[0087] A. Virological Indexes

[0088] The viral load in each tissue of the mice was analyzed by real-time quantitative fluorescence PCR (qRT-PCR): After the tissue was fully lysed with a tissue homogenizer, nucleic acids in the sample were extracted according to the method of lysing the sample with TRIzol. 1 μg of the extracted RNA sample was taken for reverse transcription respectively, and the reverse transcription kit produced by Vazyme company ( III RTSuperMix for qPCR (+gDNA wiper, product number R323) was used for RNA reverse transcription. The reverse transcription system is as follows:

[0089]

[0090] Mix the above system well, and incubate in a water bath at 42 °C for 2 min to remove the possible gDNA in the sample;

[0091] Add 4 μL of 5×HiScript III qRT SuperMix to the nucleic acid sample obtained after lysis with TRIzol, react at 37 °C for 15 min, and then react at 85 °C for 5 sec to obtain cDNA by transcription.

[0092] For fluorescence quantitative PCR, the reaction system was mixed well with Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Q712), and the amplification reaction and reading were performed on a StepOne Plus Real-time PCR instrument (brand: ABI). Calculate the copy number per milliliter of the provirus solution. The steps are as follows:

[0093] (1) First, establish the standard product: Dilute the plasmid pMT-RBD to 5×10 8 , 5×10 7 , 5×106 ,5×10 5 ,5×10 4 ,5×10 3 and 5×10 2 copies / μL. Take 2 μL of the standard product or cDNA template for qPCR reaction.

[0094] (2) The primer sequences used in the experiment are as follows (all represented in the 5'-3' direction):

[0095] RBD-qF1: CAATGGTTTAACAGGCACAGG (SEQ ID NO: 1);

[0096] RBD-qR: CTCAAGTGTCTGTGGATCACG (SEQ ID NO: 2).

[0097] (3) The reaction procedure is as follows:

[0098] Pre-denaturation: 95°C for 5 minutes;

[0099] Cycle parameters: 95°C for 15 seconds, 54°C for 15 seconds, 72°C for 30 seconds. A total of 40 cycles.

[0100] B. Pathological indicators

[0101] 1) Gross anatomical observation

[0102] The animal model may show obvious pathological changes mainly characterized by lung tissue inflammation. Gross anatomy shows lesions on the surface of the lung tissue, including bleeding, exudation, etc., which make the surface of the lung tissue form an uneven dark red color.

[0103] 2) Histopathological analysis

[0104] The collected lung tissues were fixed in 4% paraformaldehyde for more than 3 days and then removed from the laboratory (performed in accordance with the regulations and requirements for removing inactivated materials in P3 experiments), followed by paraffin embedding and sectioning. After staining the sections with hematoxylin and eosin, they were observed under a light microscope. The simple procedures are as follows: Fix the embedded wax blocks on the microtome and cut them into 3-μm thin slices. Place the cut thin slices in hot water (42 °C) to flatten them, stick them onto glass slides, and dry them in an incubator at 60 °C for 1 h. Dewax the baked blank slides to water, with the steps being: xylene I for 15 min, xylene II for 15 min, xylene III for 15 min, absolute ethanol for 5 min, 85% ethanol for 5 min, 75% ethanol for 5 min, and ddH2O for 2 min. Immerse the sections that have been dewaxed to water in hematoxylin aqueous solution for 5 min. After rinsing with running water for 30 s, treat them with differentiating solution for 15 s, blueing solution for 15 s, and then rinse with running water for 30 s. Stain with eosin staining solution for 5 min and rinse with running water for 30 s. After staining, dehydrate the sections with 75% ethanol for 5 min, 85% ethanol for 5 min, and absolute ethanol for 5 min, and then make the sections transparent with xylene I for 5 min, xylene II for 5 min, and xylene III for 5 min, and then cover the slides for observation. According to the pathological change characteristics of the alveoli, bronchi, blood vessels, etc. in the lungs of experimental animals, determine the grade of lung pathological injury, which is divided into 6 grades according to the following table:

[0105]

[0106]

[0107] C. Molecular pathological analysis

[0108] (1) Data analysis of proteome and phosphoproteome

[0109] Collect the lung tissues of mice after virus challenge, inactivate them with 2% SDS, and extract proteins in a BLS-2 laboratory. After quantification by BCA, reduce, alkylate, and enzymatically digest to obtain peptide fragments. Take 10 μg and 1 mg of peptide fragments respectively for proteome and phosphoproteome detection. Enrich phosphorylated peptide fragments using TiO2 microspheres. Adopt the DIA technical scheme for data acquisition of proteome and phosphoproteome, and use Spectronaut software for analysis. Perform median normalization and log2 transformation on proteome data. After median normalization and log2 transformation of phosphoproteome data, normalize them to the corresponding protein level and then use them for subsequent data analysis.

[0110] (2) Metabolomics analysis

[0111] Mouse plasma was collected after virus challenge. For extraction, 20 μL of plasma or 20 mg of lung tissue was added to 400 μL of methanol, vortexed thoroughly, sonicated in an ice-water bath for 10 min, and then centrifuged. The supernatant was filtered through a needle filter and placed in a liquid injection vial for detection by ultra-high performance liquid chromatography-quadrupole orbitrap mass spectrometry Q-Exactive plus (Thermo Fisher, USA). After mass spectrometry detection, the original mass spectrometry data (RAW data) was obtained. The RAW data was processed by non-targeted metabolomics using MADIAL software to obtain Clean data after cleaning. Finally, the Clean data was analyzed using SIMCA software to obtain the corresponding principal component analysis result diagram (PCA diagram) and orthogonal partial least squares discriminant analysis result diagram (OPLS-DA diagram), and differential metabolites were searched and identified through the HMDB database. KEGG pathway enrichment analysis, Heatmap analysis, etc. were performed on the differential metabolites.

[0112] Data analysis was completed using Excel and GraphPad Prism 8.3.0 (538) software.

[0113] 3. Experimental results:

[0114] 3.1 Observation of clinical symptoms in mice after infection

[0115] No clinical symptoms such as piloerection, loss of appetite, and slow movement were observed in all mice after infection, and no deaths occurred. For the spontaneous atherosclerosis group, 4 days before infection, the body weights of mice in all groups showed a slight decrease. On the 5th day after infection, the body weights of 750 spontaneous atherosclerosis mice decreased significantly after infection, with an average decrease of nearly 5%, while the body weights of other control groups increased slightly ( Figure 2 in A). Compared with the wild-type C57 group, 750 spontaneous atherosclerosis mice showed more severe clinical symptoms after infection. In the type II diabetes induction group, the body weights of all mice increased steadily within a small range, and no significant decrease occurred ( Figure 2 in C).

[0116] 3.2 Virus infection situation in the lungs of mice after infection

[0117] On the 6th day after virus challenge, the lungs and brains of mice were taken for quantitative detection of viral genome copy numbers. The results showed that in the spontaneous atherosclerosis group, the average viral loads in the lungs of wild-type C57 mice and 750 spontaneous atherosclerosis mice were 7.6×10 5 and 3.8×10 5 copies / μg RNA, respectively. The viral load in the lungs of feral mice was slightly lower than that of wild-type mice, but there was no statistical difference ( Figure 2In B). In the group with type 2 diabetes induced after infection, the average viral loads in the lungs of C57BL / 6-hACE2 KI mice and C57BL / 6-hACE2 KI-T2DM mice were 3.9×10 5 and 3.1×10 5 copies / μg RNA, respectively. The viral load in the lungs of diabetic mice was slightly lower than that in healthy mice, but there was no statistical difference ( Figure 2 in D).

[0118] 3.3 Histopathological analysis of mouse lung tissues after infection

[0119] For the mice in the spontaneous atherosclerosis group, on the 5th day after infection, gross observation of lung tissues showed that diffuse dark red lesions appeared in the lungs of the SARS-CoV-2-infected group, and the area of dark red lesions in the lungs of the C57 wild-type mouse-infected group was significantly smaller than that in the spontaneous atherosclerosis mouse-infected group; further sectioning and staining of lung tissues also showed similar results ( Figure 3 in A):

[0120] Except for mild damage in two mice, C57 wild-type mice not infected with SARS-CoV-2 did not show obvious alveolar damage, and the results of the vast majority of alveoli were normal, with an average pathological score value of 0.5 per mouse; while in some 750 atherosclerotic mice not infected with SARS-CoV-2, "mild to moderate" alveolar damage was also shown in the lungs, which may be related to the infection with high-titer AdV-hACE2, with an average pathological score value of 1.8 per mouse; after SARS-CoV-2 infection, "mild" lesions appeared in the lungs of wild-type mice: most alveoli were normal, with hyperplasia of a small number of bronchiolar epithelia, and scattered inflammatory cell infiltration was visible around bronchi and blood vessels, with an average pathological score value of 2.3 per mouse; after infection of 750 spontaneous atherosclerosis mice, the pathological damage in the lungs was significantly more severe than that in wild-type mice. Except for one mouse showing "mild" diffuse alveolar damage, the other 5 mice all showed "moderate to severe" pathological damage: thickening of some alveolar walls, hyperplasia of bronchiolar epithelia, and a large number of inflammatory cell infiltration were visible around bronchi and blood vessels, with an average pathological score value of 4 per mouse. Figure 3 in C).

[0121] For the mice in the type 2 diabetes induced group, on the 5th day after infection, no obvious lesions were observed by gross observation of lung tissues. The HE staining results also showed that "mild" lesions appeared in the lungs of both C57BL / 6-hACE2 KI mice and C57BL / 6-hACE2 KI-T2DM mice after infection: most alveoli were normal, with hyperplasia of a small number of bronchiolar epithelia, and scattered inflammatory cell infiltration was visible around bronchi and blood vessels, with no obvious difference. Figure 3In B), the average pathological score values were 0.6 and 1, respectively. Figure 3 In D).

[0122] In summary, for the constructed SARS-CoV-2 combined with underlying disease model, after SARS-CoV-2 infection, the lungs showed more severe pathological damage, much higher than that of wild-type mice (C57BL / 6 mice) without hACE2 transfection. This indicates that the animal model constructed by the present invention based on 750 atherosclerotic mice transfected with the hACE2 gene can more realistically simulate the clinical symptoms of COVID-19 infection with underlying diseases after SARS-CoV-2 infection.

[0123] In Comparative Example 1, a traditional method (high-fat + STZ induction) was used for modeling. After SARS-CoV-2 infection, there was no significant difference in the clinical effects between C57BL / 6-hACE2KI-T2DM mice and mice without high-fat induction, and the pathological damage was relatively mild. It shows that the modeling method provided by the present invention can realistically simulate the clinical symptoms of COVID-19 infection with underlying diseases, and these symptoms are consistent with the clinical manifestations of human patients, such as significant weight loss, more severe pulmonary pathological damage, affecting the activation and function of immune cells, increasing inflammation and promoting pulmonary fibrosis.

[0124] 3.4 Analysis of the proteome and phosphoproteome of the lung tissue of mice in the spontaneous atherosclerosis group after infection.

[0125] After infection, the spontaneous atherosclerotic mice showed more characteristics that can simulate the clinical situation. Therefore, the lung tissue of the challenged mice was collected and inactivated, and proteins were extracted in a BLS-2 laboratory, and peptides were obtained by enzymatic digestion. Some peptides were enriched for phosphorylated peptides using TiO2 microspheres. The DIA technology scheme was used for data collection of the proteome and phosphoproteome, and a total of more than 5000 proteins and more than 20000 phosphorylated sites were obtained. From the changes in the proteome, the number of up-regulated and down-regulated differentially expressed proteins in the lung tissue of 750 atherosclerotic mice before and after challenge was significantly less than that of the wild-type mouse group ( Figure 4 In A, left). The proteome pathway enrichment of the two showed similar characteristics, and the protein expression levels of immune-related pathways in the lung tissue after infection were significantly increased ( Figure 4 In B). However, at the phosphoproteome level, the number of differentially phosphorylated sites in 750 atherosclerotic mice before and after infection was significantly higher than that of the wild-type mouse group ( Figure 4 In A, right). The enrichment characteristics of the phosphorylation pathway showed a consistent change trend in 750 and wild-type mice, and the changes in 750 atherosclerotic mice before and after challenge were more significant. Figure 4In C). The up-regulated phosphorylation sites are mainly enriched in the pathways related to mRNA splicing. The down-regulated phosphorylation sites are related not only to RNA splicing but also to cell migration and cell shape regulation. These results suggest that abnormal phosphorylation after 750 mouse infection may more easily affect the activation and function of immune cells, increase inflammation and promote pulmonary fibrosis.

[0126] 3.5 Blood metabolite analysis of mice in the spontaneous atherosclerosis group.

[0127] The results of principal component analysis (PCA) of plasma showed that the sera and lung tissues of the uninfected and infected groups of 750 spontaneous atherosclerosis mice could be completely separated, indicating metabolic differences after infection. We screened differential metabolites according to the differential metabolite screening conditions VIP≥1 and the absolute value of P(corr)≥0.7, and performed secondary mass spectrometry identification of the differential metabolites. The heat map results showed significant changes in the metabolites related to the phospholipid biosynthesis pathway, purine metabolism, etc. before and after 750 mouse infection ( Figure 5 ).

[0128] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A method for constructing a SARS-CoV-2 combined with underlying diseases model, characterized in that, It includes the following steps: Using 750 atherosclerotic mice and their offspring individuals as the objects to be modeled, introducing the hACE2 gene into the modeling objects, and then infecting them with SARS-CoV-2; the strain number of the 750 atherosclerotic mice is C57BL / 6JGpt-Chr1YP1 / Gpt|Strain NO.D000750.

2. The method for constructing a SARS-CoV-2 combined with underlying diseases model according to claim 1, wherein The method for introducing the hACE2 gene into the modeling object is selected from any of the following: (1) Introducing the hACE2 gene into the modeling object by means of a recombinant viral vector, and the recombinant viral vector contains the hACE2 gene; (2) Introducing the hACE2 gene into the modeling object by means of gene editing, and the gene editing method is selected from: the gene editing technology is selected from at least one of CRISPR / Cas9 technology, CRISPR / Cas12a technology, CRISPR / Cas13a technology, zinc finger nuclease technology mediated by artificial nucleases, transcription activator-like effector nuclease technology, and Cre-loxp gene knockout technology; Preferably, the recombinant viral vector is a recombinant lentiviral vector, a recombinant adeno-associated viral vector or a recombinant adenoviral vector.

3. The method for constructing the SARS-CoV-2 combined with underlying diseases model according to claim 2, wherein, When using the recombinant viral vector method, first infect the object to be modeled with the recombinant viral vector or the viral particles carrying the recombinant viral vector, and after 5 - 7 days, infect with SARS-CoV-2.

4. The method for constructing a SARS-CoV-2 combined with underlying diseases model according to claim 3, wherein When the recombinant viral vector is a recombinant adenovirus vector, the inoculation dose for infecting the object to be modeled is 2×10 8 -5×10 8 TCID 50 / animal; Preferably, the inoculation dose of the SARS-CoV-2 is 1×10 5 -1×10 6 TCID 50 / animal.

5. The method for constructing the SARS-CoV-2 combined with underlying diseases model according to claim 4, wherein, The infection methods of the recombinant viral vector, the viral particles carrying the recombinant viral vector or the SARS-CoV-2 are all nasal drip infection.

6. The method for constructing a SARS-CoV-2 combined with underlying diseases model according to claim 1, wherein The underlying disease is selected from metabolic-related underlying diseases.

7. The method for constructing a SARS-CoV-2 combined comorbidity model according to claim 6, wherein, The metabolic-related underlying diseases are selected from obesity, diabetes or cardiovascular and cerebrovascular diseases; Preferably, the cardiovascular and cerebrovascular diseases are selected from thromboembolic diseases; The thromboembolic diseases are selected from hereditary angioedema, late diabetic macular edema, myocardial infarction, angina pectoris, reocclusion and restenosis after angioplasty or aortocoronary bypass surgery, disseminated intravascular coagulation, stroke, transient ischemic attack, peripheral arterial occlusive disease, pulmonary embolism or deep vein thrombosis.

8. The method for constructing a SARS-CoV-2 combined underlying disease model according to claim 7, wherein, The cardiovascular and cerebrovascular diseases are selected from at least one of coronary heart disease, atrial fibrillation, heart failure, hyperlipidemia, aortic atherosclerosis, coronary atherosclerosis, carotid atherosclerosis, cerebral atherosclerosis, renal artery atherosclerosis and peripheral artery atherosclerosis.

9. Use of the SARS-CoV-2 combined underlying disease model constructed by the method for constructing a SARS-CoV-2 combined underlying disease model according to any one of claims 1 - 8 in screening drugs for preventing and / or treating SARS-CoV-2 combined underlying diseases.

10. The application according to claim 9, wherein, The underlying disease is selected from metabolic-related underlying diseases; Preferably, the metabolic-related underlying diseases are selected from obesity, diabetes or cardiovascular and cerebrovascular diseases; Preferably, the cardiovascular and cerebrovascular diseases are selected from thromboembolic diseases; The thromboembolic diseases are selected from hereditary angioedema, advanced diabetic macular edema, myocardial infarction, angina pectoris, reocclusion and restenosis after angioplasty or aortocoronary bypass, disseminated intravascular coagulation, stroke, transient ischemic attack, peripheral arterial occlusive disease, pulmonary embolism or deep vein thrombosis; Preferably, the cardiovascular and cerebrovascular diseases are selected from at least one of coronary heart disease, atrial fibrillation, heart failure or hyperlipidemia, aortic atherosclerosis, coronary atherosclerosis, carotid atherosclerosis, cerebral atherosclerosis, renal artery atherosclerosis and peripheral arterial atherosclerosis.

Images