Rice high environment temperature response gene TOMS1 and application thereof

Abstract

The invention relates to a gene for regulating and responding to environment temperature change and application thereof. Specifically, the invention provides the application of the TOMS1 (Thomson MeSocotyl1) or the allele of the TOMS1 in the aspect of regulating and controlling the rice to respond to the environment temperature change so as to improve the yield. The invention further discloses a method for cultivating the plants suitable for growing at the high environment temperature. The TOMS1 gene has a wide application prospect in high environment temperature adaptation and high-yield plant breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering. Specifically, it relates to a rice gene TOMS1 (Thermal Oversensitive MeSocotyl1) that responds to environmental temperature changes, the encoded protein and functional analogs of this gene, vectors containing the nucleotide sequence of this gene, and host cells containing the nucleotide sequence of this gene or the vector. The present invention also provides a method for cultivating rice varieties that can normally respond and grow under high environmental temperatures by using the gene TOMS1 that promotes the high environmental temperature adaptability response of rice. Background Art

[0002] Due to the continuous emission of greenhouse gases such as carbon dioxide and methane generated by human burning of fossil fuels into the atmosphere, the global temperature has risen, glaciers have melted, and sea levels have risen. According to the IPCC6 (Intergovernmental Panel on Climate Change) report, the global average temperature from 2011 - 2020 has risen by 1.1 °C compared to 1850 - 1900, and it is expected that the global average temperature will rise by 3 - 4 °C by the end of this century. The increase in the global average temperature will have a serious negative impact on the yield of crops. There have been reports that without considering carbon dioxide utilization, effective adaptation, and genetic improvement, for every 1 °C increase in the global average temperature, the global yields of the major crops wheat (Triticum aestivum L.), rice (Oryza sativa L.), maize (Zea mays L.), and soybean (Glycine max (Linn.) Merr.) will decrease by 6.0%, 3.2%, 7.4%, and 3.1% respectively (Zhao et al., 2017). Rice is the main food crop in China. Currently, the total planting area of rice in China exceeds 30 million hectares, accounting for 20% of the total global rice planting area. The annual rice yield is about 200 million tons, accounting for about 40% of the total national grain output, and it can provide staple food for more than 65% of the population in China (Hu Weian et al., 2020). The reduction in rice production will trigger serious food security problems. Therefore, studying the molecular mechanism of rice's response to environmental temperature changes has important practical significance for ensuring the stability of rice production in China.

[0003] Since plants are sessile and cannot move like animals to avoid the surrounding adverse environment, they can only adapt to the changing ambient temperature by regulating their own growth and development. As the ambient temperature rises, it induces changes in the morphological structure of plants, and the forms of these changes vary slightly among different plants (Erwin, et al., 1989; Quint, et al., 2016). For example, in Lilium longiflorum, the morphological changes induced by high ambient temperature mainly include increased plant height, elongated internodes, and changed leaf orientation; in Arabidopsis thaliana, they mainly include hypocotyl elongation, petiole elongation, downward-biased leaf growth, root elongation, and early flowering; in rice, they mainly include increased seedling height, coleoptile and mesocotyl elongation (Erwin, et al., 1989; Quint, et al., 2016). Current research suggests that these morphological changes induced by high ambient temperature may help plants accelerate heat dissipation and thus improve their adaptability to high ambient temperature (Gray, et al., 1998).

[0004] At present, the molecular mechanism of plant response to environmental temperature changes has been relatively well studied in the model plant Arabidopsis thaliana. Three temperature sensors have been identified: phytochrome phyB (Phytochrome B), ELF3 (EARLY FLOWERING 3), and the hairpin structure formed by the 5'-untranslated region of the mRNA encoding the transcription factor PIF7 (PHYTOCHROME INTERACTING FACTOR 7) (Jung et al., 2020; Jung et al., 2016; Legris et al., 2016). The phytochrome phyB protein exists in two forms: the active Pfr and the inactive Pr. At low environmental temperatures, it is in the active state and can interact with the core transcription factor PIF4 in the environmental temperature response, promoting the degradation of PIF4 protein and thus repressing the transcription of downstream growth-promoting genes, ultimately resulting in the inhibition of hypocotyl elongation. As the environmental temperature rises, it transforms from the active state to the inactive state, increasing the protein content of PIF4, promoting the expression of downstream growth-promoting genes, and ultimately leading to hypocotyl elongation (Jung et al., 2016; Legris et al., 2016). The polyglutamine repeat sequence (polyQ) in the ELF3 protein can form a prion domain (PrD), which can act as a temperature sensor to perceive changes in the surrounding environmental temperature (Jung et al., 2020). At low environmental temperatures, ELF3 interacts with ELF4 and binds to the promoter of PIF4 to inhibit its transcription. After the environmental temperature rises, ELF3 undergoes a phase transition process dependent on the PrD domain to form droplets, releasing the inhibition of PIF4 and promoting its transcription, ultimately promoting hypocotyl elongation. The non-coding sequence at the 5'-end of PIF7 mRNA forms a stem-loop structure at low environmental temperatures, inhibiting its translation into protein. After the temperature rises, the stem-loop structure opens, promoting the translation of its mRNA into protein, thereby promoting protein accumulation. The increased PIF7 protein can form a heterodimer with PIF4 to jointly promote the transcription of downstream growth-promoting genes, resulting in hypocotyl elongation (Chung et al., 2020).

[0005] PIF4 promotes elongation under high ambient temperature by regulating auxin biosynthesis. After PIF4 mutation, the phenotypes of hypocotyl elongation, petiole elongation, and leaf hyponasty induced by high ambient temperature in Arabidopsis thaliana are lost, and the transcription of the auxin-responsive gene IAA29 induced by high ambient temperature is also significantly inhibited (Franklin et al., 2011; Koini et al., 2009). PIF4 activates the transcription of the auxin synthesis genes TAA1 (TRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS1), CYP79B2 (CYTOCHROME P450 FAMILY 79B), and YUC8 (YUCCA8) by directly binding to their promoters, thereby increasing the concentration of auxin and promoting hypocotyl elongation (Gray et al., 1998; Sun et al., 2012).

[0006] The mesocotyl of rice is the tissue between the coleoptile node and the scutellum of the seed. Different from the hypocotyl of Arabidopsis thaliana, it only grows under dark conditions. Mesocotyl elongation is beneficial for germinated rice seeds to emerge above the soil surface or water surface, and this characteristic plays an important role in the direct seeding cultivation process of rice. Mesocotyl elongation is affected by various environmental factors, among which temperature is one of the main influencing factors. Whether it is indica rice or japonica rice, mesocotyl elongation is induced by high ambient temperature, but the molecular mechanism of the mesocotyl of rice responding to environmental temperature changes is still unclear. Summary of the Invention

[0007] The inventors of the present invention used ethyl methanesulfonate (EMS) mutagenesis and genetic screening to isolate and identify a mutant toms1 (thermal oversensitive mesocotyl1) that is hypersensitive to high ambient temperature in the mesocotyl of rice. On this basis, by the method of map-based cloning, the key gene TOMS1 that regulates the response of rice to environmental temperature changes was cloned, and it was clarified that the protein encoded by the TOMS1 gene is regulated by environmental temperature changes, and the content of the protein encoded by this gene shows a decreasing trend with the increase of environmental temperature. Through phenotypic analysis of the mutant and genetic complementation experiments, the function of this gene was demonstrated.

[0008] Therefore, the purpose of the present invention is to provide a key factor for improving the adaptability of rice to high ambient temperature, and to provide gene resources and theoretical guidance for cultivating rice varieties that better adapt to environmental temperature changes.

[0009] In a first aspect, the present inventors identified the gene TOMS1 that controls the response of rice to high ambient temperature, the protein shown in SEQ ID No.2 encoded by the gene, or a protein derived from SEQ ID No.2 that is encoded by an amino acid sequence in which one or more amino acids are substituted, deleted or added and has the same function as the protein shown in SEQ ID No.2. The protein shown in SEQ ID No.2 consists of 451 amino acids. The gene is shown as any one of the following:

[0010] 1) The nucleotide sequence shown in SEQ ID NO.1;

[0011] 2) A nucleotide sequence that is different from the nucleotide sequence shown in SEQ ID NO.1 due to substitution, deletion and / or insertion of one or more nucleotide sequences, but whose encoded protein has the same activity as the protein encoded by the nucleotide sequence shown in SEQ ID NO.1;

[0012] 3) A nucleotide sequence that has at least 90%, preferably at least 99% identity with the nucleotide sequence shown in SEQ ID NO.1, and whose encoded protein has the same activity as the protein encoded by the nucleotide sequence shown in SEQ ID NO.1;

[0013] 4) A nucleotide sequence that is different from SEQ ID NO.1 in sequence due to the degeneracy of the genetic code;

[0014] 5) An active fragment containing any one of the nucleotide sequences in 1)-4);

[0015] 6) A nucleotide sequence that contains a complementary sequence to any one of the nucleotide sequences in 1)-5) and hybridizes under medium stringency conditions, preferably high stringency hybridization conditions; or

[0016] 7) A nucleotide sequence that contains a nucleotide sequence complementary to any one of the nucleotide sequences in 1)-5).

[0017] The gene TOMS1 that controls the response of rice to high ambient temperature is an isolated nucleotide sequence. In a preferred embodiment, the gene TOMS1 that controls the response of rice to high ambient temperature is the nucleotide sequence shown in SEQ ID No.1. Moreover, those skilled in the art should understand that in a broader sense, the gene TOMS1 that controls the response of rice to high ambient temperature is a nucleotide sequence that has more than 90%, preferably more than 99% homology with the nucleotide sequence shown in SEQ ID No.1 and encodes a protein with the same function.

[0018] In a second aspect, the present invention provides a protein encoded by the gene TOMS1 that controls the response of rice to high ambient temperature as described in the first aspect, and the protein is shown as any one of the following:

[0019] 1) The amino acid sequence shown in SEQ ID NO.2;

[0020] 2) An amino acid sequence that is different from the amino acid sequence shown in SEQ ID NO.2 due to substitution, deletion, and / or insertion of one or more amino acid residues, but has the same activity as the protein composed of the amino acid sequence shown in SEQ ID NO.2;

[0021] 3) An amino acid sequence that has at least 90%, preferably at least 99% identity with the amino acid sequence shown in SEQ ID NO.2 and has the same activity as the protein composed of the amino acid sequence shown in SEQ ID NO.2; or

[0022] 4) An active fragment containing any one of the amino acid sequences described in 1)-3).

[0023] In a preferred embodiment, the protein encoded by the gene TOMS1 that controls the response of rice to high ambient temperature as described in the first aspect is an isolated protein, and its amino acid sequence is shown in SEQ ID No.2.

[0024] In a third aspect, the present invention provides a recombinant vector containing the gene TOMS1 that controls the response of rice to high ambient temperature as described in the first aspect. The vector is shown as any one of the following:

[0025] 1) The plant expression vector described in claim 1 or 2 (such as pCAMBIA1300), and the plant expression vector contains the TOMS1 promoter or the gene sequence encoding a tag protein (such as GFP);

[0026] 2) A plant gene editing vector for the target sequence of gene editing of the polynucleotide sequence described in claim 1 or 2, and the plant gene editing vector contains an enhanced promoter (such as Ubiquitin).

[0027] Preferably, the exogenous nucleotide fragment contained in the recombinant vector encodes the amino acid sequence shown in SEQ ID No.2. More preferably, the exogenous nucleotide fragment contained in the recombinant vector is shown in SEQ ID No.1.

[0028] In an embodiment, the plasmid used to construct the recombinant vector can be selected from, but not limited to, pCAMBIA1300.

[0029] Host cells containing the recombinant vector are also within the scope of the present invention. Host cells containing the recombinant vector can be obtained by transforming or transfecting the recombinant vector into cells for further applications such as amplifying the expression vector, expressing the protein, or obtaining transgenic plants. The cells used for transformation or transfection can be selected from, but are not limited to, bacterial cells such as Escherichia coli cells or Agrobacterium cells, fungal cells such as yeast cells, or plant cells such as rice cells, and so on.

[0030] In a fourth aspect, the present invention provides the use of the gene TOMS1 that controls the high environmental temperature adaptability of rice in cultivating rice varieties that can normally respond and grow under high environmental temperatures.

[0031] In a fifth aspect, the present invention provides a method for cultivating a rice variety that can normally respond and grow under high environmental temperatures, the method comprising reducing the content of the protein encoded by the TOMS1 gene. The reduction of the content of the protein encoded by the TOMS1 gene can be achieved by the following: using the CRISPR / Cas9 gene editing technology to knockout the TOMS1 gene.

[0032] The transformation or transfection of the TOMS1 gene and the TOMS1 gene editing vector can be carried out by the Agrobacterium-mediated method or the gene gun method.

[0033] The present invention provides a theoretical and material basis for cultivating crop varieties with high environmental temperature adaptability. When the gene of the present invention is used to improve the response of rice to high environmental temperatures, the following methods can be adopted: (1) constructing a vector for gene editing of the TOMS1 gene; (2) transforming the constructed vector into renewable rice tissues or organs; (3) culturing the transformed tissues or organs into plants and screening for mutant plants.

[0034] In summary, the technical solutions adopted by the present invention to solve its technical problems are as follows:

[0035] 1. An isolated gene that controls the response of rice to high environmental temperature adaptability, wherein the gene encodes the protein shown in SEQ ID No. 2, or encodes a protein derived from SEQ ID No. 2 with the same function, which is obtained by inserting, deleting, or substituting one or several amino acids in the amino acid sequence shown in SEQ ID No. 2.

[0036] 2. The gene according to item 1, which has a homology of more than 90%, preferably more than 99% with the nucleotide sequence shown in SEQ ID No. 1, and encodes a protein with the same function.

[0037] 3. The gene according to item 2, which is the nucleotide sequence shown in SEQ ID No. 1.

[0038] 4. An isolated protein encoded by the gene described in item 1 that controls the high environmental temperature adaptability response of rice, which is the protein shown in SEQ ID No. 2, or a protein derived from SEQ ID No. 2 with the same function as the protein shown in SEQ ID No. 2 after insertion, deletion, or substitution of one or several amino acids in the amino acid sequence shown in SEQ ID No. 2.

[0039] 5. The protein according to item 4, which is the protein shown in SEQ ID No. 2.

[0040] 6. A recombinant vector containing the gene described in any one of items 1-3 or a fragment thereof.

[0041] 7. The recombinant vector according to item 6, wherein the recombinant vector is a plant expression vector, preferably a vector suitable for expression in rice.

[0042] 8. The vector according to item 7, wherein the recombinant vector is constructed from plasmid pCAMBIA1300.

[0043] 9. A host cell containing the gene described in any one of items 1-3 or a fragment thereof or containing the recombinant vector described in any one of items 6-7.

[0044] 10. The host cell according to item 9, wherein the host cell is selected from bacteria, fungi, or plant cells, preferably selected from Escherichia coli, Agrobacterium, or plant cells.

[0045] 11. A method for cultivating a plant with excellent high environmental temperature adaptability response, the method comprising using gene editing technology to design gene editing targets with the gene described in any one of items 1-3 or a fragment thereof as a template and constructing a vector, then transforming the cells or tissues of the plant, and cultivating the transformed plant cells or tissues into plants with TOMS1 function deletion and enhanced high environmental temperature adaptability of rice.

[0046] 12. The method according to item 11, wherein the transformation is carried out by Agrobacterium-mediated method or particle bombardment method.

[0047] 13. The method according to item 11 or 12, wherein the plant is a gramineous plant, preferably rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 . Comparison of the mesocotyl phenotypes of toms1 and ZH11.

[0049] (a) TOMS1 inhibits the mesocotyl response to high ambient temperature. The left and right figures show the mesocotyl morphology and statistical analysis of ZH11 and toms1 grown at different temperatures, respectively. The mesocotyl is the part between the white triangle and the seed scutellum in the figure, and the white triangle indicates the coleoptile node. The number of etiolated seedlings analyzed was ≥21. The scale bar is 1 cm. (b) TOMS1 inhibits cell elongation and division. Statistical analysis of the mesocotyl cell morphology, cell length, and number of ZH11 and toms1 grown at 28 / 23 °C and 35 / 30 °C. The number of mesocotyls counted was 3, the number of cells was ≥70, and the scale bar was 50 μm.

[0050] Figure 2 . Gene mapping of TOMS1 and identification of candidate genes.

[0051] Map-based cloning of TOMS1. The horizontal line represents the chromosome, the circle represents the centromere, and the vertical line represents the molecular marker. In the gene structure of TOMS1, the black squares, white squares, and black lines represent exons, non-coding regions, and introns, respectively.

[0052] Figure 3 . Functional complementation vector of the TOMS1 gene.

[0053] Figure 4 . Complementation verification of the function of the TOMS1 gene.

[0054] TOMS1 can complement the phenotype of toms1. Mesocotyl morphology and statistical analysis of ZH11, toms1, and transgenic complementation lines (TOMS1 / toms1 and TOMS1-GFP / toms1). The number of etiolated seedlings analyzed was ≥20, and the scale bar was 1 cm. Significance analysis was performed using Duncan’s test (p < 0.05).

[0055] Figure 5 . High ambient temperature induces a decrease in the content of TOMS1 protein.

[0056] (a) The transcription of TOMS1 is not affected by changes in ambient temperature. (b) The content of TOMS1 protein decreases at high ambient temperature. Transgenic complementation lines (TOMS1-GFP / toms1) and control lines (GFP) of seedlings were grown at 25 °C for 2 days and then transferred to 35 °C for 5 hours, and GFP fluorescence signals were analyzed using a laser confocal microscope. The number of seedlings counted was >8, 2 photos were taken for each seedling, and analysis was performed using ImageJ. The scale bar was 20 μm.

[0057] Figure 6 . Phenotypic analysis of toms1 allelic mutations.

[0058] ZH11, toms1 toms1 cr-1 and toms1 cr Morphology and statistical analysis of the mesocotyls of -2. The number of etiolated seedlings analyzed was ≥20, and the scale bar was 1 cm. Significance analysis was performed using Duncan’s test (p<0.05). Detailed implementation manners

[0059] To make the objectives, technical solutions and advantages of the present invention more clear and understandable, the present invention will be further described in detail below with reference to specific embodiments and the accompanying drawings.

[0060] Unless otherwise specified, the experimental methods in the following embodiments are all conventional experimental methods. The reagents, reagent kits, and experimental instruments used in the experiments can all be purchased from biological instrument and reagent companies unless otherwise specified.

[0061] Example 1. Isolation and genetic analysis of genes controlling the response of rice to high environmental temperature

[0062] The present inventors first screened a mesocotyl elongation mutant from an EMS (Ethylmethylsulfone)-mutagenized japonica rice ZH11 mutant library. To further determine whether the mesocotyls of this mutant are sensitive to changes in environmental temperature, we dark-cultured it for 3-4 days under four temperature conditions: 25 / 20 °C (25 °C for 12 h and 20 °C for 12 h, simulating diurnal cycle conditions), 28 / 23 °C, 30 / 25 °C, and 35 / 30 °C. Phenotypic statistical analysis found that the mesocotyls of this mutant were significantly longer than those of the wild type at high environmental temperatures, while their lengths were similar to those of the wild type at low environmental temperatures, indicating that the mesocotyls of this mutant are hypersensitive to high environmental temperatures ( Figure 1 a). To further study whether the mesocotyl elongation is caused by cell division or cell elongation, we performed resin section analysis on the mesocotyl cortical cells of the wild type and the mutant. The results showed that the mesocotyl elongation of this mutant was caused by both an increase in cell length and cell number ( Figure 1 b).

[0063] To study the molecular-level reasons for the toms1 phenotype, we crossed it with ZH11 and constructed an F2 population, and then counted the number of individual plants in the population that were phenotypically similar to toms1 and ZH11, respectively. Chi-square fitness test analysis found that the ratio of the number of individual plants with the toms1 and ZH11 phenotypes was consistent with 3:1, indicating that toms1 is controlled by a recessive single nuclear gene.

[0064] To further determine the mutant gene of toms1, we crossed toms1 with indica rice Tetep to construct an F2 population, and determined the candidate gene of toms1 between molecular markers R2 and R3 by map-based cloning. Figure 2)。Combined with the whole-genome resequencing results of toms1, it was found that this interval contains 3 SNPs, and one SNP located in the exon region of the gene TOMS1 (Os05g48500) caused the amino acid at position 412 to mutate from glycine to aspartic acid ( Figure 2 ). This gene encodes the transcriptional regulator OsNINJA (Novel Interactor of JAZ) in the jasmonic acid signaling pathway, so we identified this gene as a candidate gene for toms1.

[0065] Example 2. Construction of the complementary vector of TOMS1 and genetic transformation of rice

[0066] The complete gene of TOMS1, which is the nucleotide sequence shown in SEQ ID No.1 (including its own promoter sequence, genomic sequence and 3' non-coding region sequence), was PCR amplified from wild-type ZH11 using DNA polymerase, and then digested and ligated to the multiple cloning site of the pCAMBIA1300 plasmid (purchased from CAMBIA) to obtain the complementary vector pTOMS1::TOMS1 ( Figure 3 ). At the same time, the TOMS1 promoter sequence, genomic sequence and GFP tag sequence were also ligated to the pCAMBIA1300 plasmid to obtain the complementary vector pTOMS1::TOMS1-GFP ( Figure 3 ).

[0067] The above-constructed complementary vector was transformed into competent E. coli DH5α cells, and positive clones were screened using kanamycin. The plasmid was extracted and sequenced for identification to obtain positive clones with the correct TOMS1 sequence in the cloning vector. Then, the plasmid of this positive clone was electrotransformed into competent EHA105 Agrobacterium cells (prepared by conventional methods referring to "Plant Genetic Engineering", Wang Guanlin, Fang Hongyun, Science Press, 2nd edition, 2004). Next, the successfully transformed clone was used for transgenic operation with toms1 as the receptor by the method of Agrobacterium infection.

[0068] The method of transgenic operation is as follows:

[0069] (1) Seed sterilization: Weigh 20 - 30 g of dried rice seeds, remove the seed coats using a small-scale seed huller in the laboratory, soak the dehulled seeds in 70% ethanol for 1 minute, then soak them in 30% sodium hypochlorite (the original solution has 10% available chlorine, add 1 drop of Tween 20 per 50 mL) for 30 minutes, and gently shake on a shaker. After that, rinse with sterilized water 5 - 6 times; then disinfect with 30% sodium hypochlorite (without adding Tween 20) once and rinse with sterilized water 5 - 6 times, and transfer the seeds to filter paper in a laminar flow bench to air dry.

[0070] (2) Callus induction: Transfer the seeds to the pre-prepared N6D medium, and then culture them in a light incubator at a temperature of 32°C with continuous light for 24 hours for 5 - 7 days until golden callus grows from the seeds.

[0071] (3) Agrobacterium infection: Streak the Agrobacterium EHA105 containing the specific plasmid on the YEB medium containing the antibiotics rifampicin (Rif 25 - 50 mg / L) and kanamycin (Kan 50 mg / L), and then place it in an oven at a temperature of 28°C for dark culture for 2 - 3 days; Pick a monoclonal strain into a 5 - 6 mL liquid YEB medium containing the same resistance, and culture it overnight in a shaker at 28°C and 220 rpm for about 12 hours. Inoculate the bacterial liquid into 50 mL of AAM medium at a ratio of 1:100, and culture it overnight with shaking in a shaker at 28°C and 220 rpm until the OD 600 is about 0.1; Immerse the well - developed callus in the Agrobacterium bacterial liquid for 2 minutes, and then quickly take out the callus with forceps and place it on sterile filter paper to air - dry. After the callus is air - dried, transfer it to the N6D - As medium pre - lined with sterile filter paper (soaked with AAM), wrap the culture dish containing the callus with sealing film and aluminum foil, and culture it in the dark at 25°C for 2 - 2.5 days.

[0072] (4) Screening and differentiation: First, rinse the callus co - cultured with Agrobacterium 3 - 4 times in sterile double - distilled water, then rinse it 2 - 3 times with sterile double - distilled water containing carbenicillin (500 mg / L) and start soaking, soak for 30 minutes each time, repeat 3 - 5 times to try to wash the Agrobacterium on the surface of the callus as clean as possible. Blot the washed callus with sterile filter paper to remove moisture and air - dry it, and then transfer it to the N6DS medium containing the antibiotics hygromycin B (50 mg / L) and carbenicillin (400 mg / L), and culture it in a light incubator at a temperature of 32°C with continuous light for 2 - 3 weeks. Transfer the well - growing callus to the regeneration RE medium containing hygromycin B (50 mg / L) and carbenicillin (250 mg / L), continuously culture it in a 32°C incubator for 1 month to induce differentiation, and change the RE medium about once every two weeks until green seedlings appear; Transfer the callus with differentiated green seedlings to the MS (sucrose 30 g / L) medium containing hygromycin B (50 mg / L) and carbenicillin (200 mg / L) to induce rooting, and transfer the seedlings to the MS medium without antibiotics for culture when they grow to a certain size.

[0073] Table 1 Media related to the transformation of rice by Agrobacterium infection method

[0074]

[0075]

[0076] Example 3. Phenotypic analysis of TOMS1 complementary transgenic plants

[0077] To examine whether TOMS1 can complement the phenotype of toms1, the positive plants TOMS1 / toms1 and TOMS1-GFP / toms1 obtained from the transgenic experiment in Example 2, along with ZH11 (wild type) and toms1, were subjected to dark culture at different temperatures. Mesocotyl phenotypic analysis revealed that TOMS1 can restore the phenotype of mesocotyl elongation in toms1 ( Figure 4 ). This result indicates that TOMS1 is a key gene controlling rice response to high ambient temperature.

[0078] Example 4. Analysis of TOMS1 protein content at different temperatures

[0079] To determine how TOMS1 responds to environmental temperature changes, we first detected the expression level of TOMS1 at 28 / 23 °C and 35 / 30 °C. The results of qRT-PCR analysis showed that the expression levels of TOMS1 in the mesocotyl of ZH11 were similar at these two temperatures, indicating that its transcription is not affected by environmental temperature changes ( Figure 5 a). Then, we observed the changes in protein content at 25 °C and 35 °C using the transgenic complementation line toms1 / TOMS1-GFP ( Figure 5 b). Interestingly, compared with the GFP transgenic line, the fluorescence signal intensity at the root tip of the complementation line was significantly reduced at high ambient temperature, indicating that TOMS1 is degraded under high temperature conditions.

[0080] Example 5. Knocking out the TOMS1 gene can improve the adaptability of rice to high ambient temperature

[0081] The inventors constructed two allelic mutants of toms1, toms1 cr -1 and toms1 cr -2 (BaiGe CRISPR / Cas vector construction kit Cat#BGK03) using the CRISPR / Cas9 gene editing technology according to conventional molecular biology and genetics operation methods (prepared by conventional methods with reference to "Plant Genetic Engineering", Wang Guanlin, Fang Hongyun, Science Press, 2nd edition, 2004). In toms1 cr -1, a base T was inserted at the 315 bp position of the CDS of the TOMS1 gene, resulting in premature termination of the encoded protein; in toms1 cr -2, a deletion of 1 base C occurred at the 719 bp position of the CDS of the TOMS1 gene, resulting in premature termination of the encoded protein ( Figure 2 , 6). Among them, toms1 cr -1 and toms1 cr-2 The gRNA guide sequences used for gene editing are shown as the following sequences:

[0082] (1) To obtain the gRNA guide sequence for toms1 cr -1: AGAAGCCAGTCTCTAGTAAACGG (SEQ ID NO.3)

[0083] (2) To obtain the gRNA guide sequence for toms1 cr -2: GCCATATCAAGTCCCGTCTCAGG (SEQ ID NO.4)

[0084] To examine the effect of the loss of function of TOMS1 on rice's response to high ambient temperature, ZH11, toms1, toms1 cr -1 and toms1 cr -2 were dark-cultured at different temperatures. After analyzing the mesocotyl phenotypes, it was found that the mesocotyl phenotypes of toms1 cr -1 and toms1 cr -2 were similar to that of toms1, that is, the mesocotyl was significantly longer than that of the wild type at high ambient temperature, while the length was similar to that of the wild type at low ambient temperature, indicating that toms1 cr -1 and toms1 cr -2 grew faster at high ambient temperature and had better adaptability ( Figure 6 ).

[0085] This result shows that TOMS1 plays a negative role in controlling rice's response to high ambient temperature.

[0086] Rice is one of the most important food crops in China, and its normal adaptive response to ambient temperature is the basis for normal growth, development, and maturation. The present invention cloned the key factor controlling rice's adaptability to high ambient temperature, providing important guidance for improving rice's adaptability to ambient temperature through rice genetic engineering and molecular breeding.

[0087] It should be understood that although the present invention has been specifically shown and described with reference to its exemplary embodiments, those of ordinary skill in the art should understand that various changes in form and detail can be made therein, and any combination of various embodiments can be made without departing from the spirit and scope of the present invention as defined by the appended claims.

[0088] References:

[0089] Chung, B.Y.W., Balcerowicz, M., Di Antonio, M., Jaeger, K.E., Geng, F., Franaszek, K., Marriott, P., Brierley, I., Firth, A.E., and Wigge, P.A. (2020). An RNA thermoswitch regulates daytime growth in Arabidopsis. Nat. Plants 6, 522 - 532.

[0090] Erwin, J.E., Heins, R.D., and Karlsson, M.G. (1989). Thermomorphogenesis in Lilium longiflorum. Am. J. Bot. 76, 47 - 52.

[0091] Franklin, K.A., Lee, S.H., Patel, D., Kumar, S.V., Spartz, A.K., Gu, C., Ye, S., Yu, P., Breen, G., Cohen, J.D., et al. (2011). Phytochrome - interacting factor 4 (PIF4) regulates auxin biosynthesis at high temperature. Proc. Natl. Acad. Sci. USA 108, 20231 - 20235.

[0092] Gray, W.M., Ostin, A., Sandberg, G., Romano, C.P., and Estelle, M. (1998). High temperature promotes auxin - mediated hypocotyl elongation in Arabidopsis. Proc. Natl. Acad. Sci. USA 95, 7197 - 7202.

[0093] Jung, J.H., Barbosa, A.D., Hutin, S., Kumita, J.R., Gao, M., Derwort, D., Silva, C.S., Lai, X., Pierre, E., Geng, F., et al. (2020). A prion-like domain in ELF3 functions as a thermosensor in Arabidopsis. Nature 585, 256 - 260.

[0094] Jung, J.H., Domijan, M., Klose, C., Biswas, S., Ezer, D., Gao, M., Khattak, A.K., Box, M.S., Charoensawan, V., Cortijo, S., et al. (2016). Phytochromes function as thermosensors in Arabidopsis. Science (New York, N.Y.) 354, 886 - 889.

[0095] Koini, M.A., Alvey, L., Allen, T., Tilley, C.A., Harberd, N.P., Whitelam, G.C., and Franklin, K.A. (2009). High temperature-mediated adaptations in plant architecture require the bHLH transcription factor PIF4. Curr. Biol. 19, 408 - 413.

[0096] Legris, M., Klose, C., Burgie, E.S., Rojas, C.C., Neme, M., Hiltbrunner, A., Wigge, P.A., E., Vierstra, R.D., and Casal, J.J. (2016). Phytochrome B integrates light and temperature signals in Arabidopsis. Science (New York, N.Y.) 354, 897 - 900.

[0097] Quint, M., Delker, C., Franklin, K. A., Wigge, P. A., Halliday, K. J., and van Zanten, M. (2016). Molecular and genetic control of plant thermomorphogenesis. Nat. Plants 2, 15190.

[0098] Sun, J., Qi, L., Li, Y., Chu, J., and Li, C. (2012). PIF4-mediated activation of YUCCA8 expression integrates temperature into the auxin pathway in regulating Arabidopsis hypocotyl growth. PLoS Genet. 8, e1002594.

[0099] Zhao, C., Liu, B., Piao, S., Wang, X., Lobell, D. B., Huang, Y., Huang, M., Yao, Y., Bassu, S., Ciais, P., et al. (2017). Temperature increase reduces global yields of major crops in four independent estimates. Proc. Natl. Acad. Sci. USA 114, 9326 - 9331.

[0100] IPCC, 2023: Sections. In: Climate Change 2023: Synthesis Report. Contribution of Working Groups I, II and III to the Sixth Assessment Report of the Intergovernmental Panel on Climate Change [Core Writing Team, H. Lee and J. Romero (eds.)]. IPCC, Geneva, Switzerland, pp. 35 - 115, doi:10.59327 / IPCC / AR6 - 9789291691647

[0101] Hu Weian. Significance and Measures for Promoting the Direct Seeding Cultivation Technology of Rice. World Tropical Agriculture Information, 2.

[0102] Sequence Listing:

[0103] SEQ ID No.1: Genomic nucleotide sequence of rice TOMS1 gene, which also includes promoter and 3'UTR sequence sequence

[0104]

[0105] agcttccaccgcatcgtcgctcgccggtgagcatccctccctacccacacctcatcaggtattctgctttatccctcaaaaagt

[0106] ttgggggttcaaccgaaacagggttagatctgcctctgcccagctccacctactttcaagttgttaattttgatttccgtttttagc

[0107] atatgtaatttggttactgaatctcatccaaacacccttatagaacgaaaaatgtaagctcacataatttttactcatccaaactca

[0108] cgtaaatttctttaagaagaatctagaccacaaactacccatagtcacacaaaatatctttttatcaacttatattcttataagtaat

[0109] ttttattccacaaaatttctaaaggacatacggtgacacttggcattaatctaatttaacttttttttctttgtcaggttataaattttcta

[0110] agacatttgtgccacttggcatgaatctaatttaacattctttctttatcaggttataaattgaaaccattgaacgtactcccaactt

[0111] cccaattagttttgctagtaaatataaacaaacattagttttgtgcacacaattcacgtgctcccaacttcccaagtccacatcac

[0112] ccttcacccattcctccacttgagccaaaacaccacgttatcctaaaaccccaactgacagataagccccacccgacagtcc

[0113] atccacgggcccactccatccgcgcgggcccactgtccagtgacacagtgaacacaatcgtcatatttgcaccgtttgggt

[0114] agggtggggatggggtgtgtgctagcaatcccggtggatcgagtggtaggcgaaattacaaaattaccctcgctgttttgat

[0115] ggctctgtctcgtggtcgtgcgtgagttatgcttcttgagtttgcccttgcctacccacccgcctccgccgatccccattccaa

[0116] cccgcgactgcgagcgaggcgagtagggcggcttcgtcgttcgtcctgctgcttccgccgcatccatcctggtgagcacat

[0117] cctcttccgccgccgtcgcctgcggccgatccccatccatcacgcgcgagctcgtcctggtcctgctgccgtcgcctgcag

[0118] ccgatccccatccatcacgcgcgagctcgtcctggtcctgctgcttccgcagcatccgttacgcgcatcctctttcccatctct

[0119] ccctgtgtctacctacgaacttatttttctcgaatttgtgcgttaaccctagcttctgttgtagaaatctgccttaaaccttaatacta

[0120] gtaacagtttgatgggagcgttaaccctagcttctgttgtagaaatctgccttaaaccttaatactagtaacagtttgatggctcc

[0121] caaaaaggtttcccatgctagatccgccactgtagtattacgactataagttttttttgttttcacagcaacttaaagaaataagc

[0122] actgcgcaacacagtagaatagccataaaacaagccttagtgccatggtttggagcattttgctgctggcgtgagaagatgtt

[0123] tccattctgttggttcagcattttagctggcgtttagctagatgtgcaacctaaggacgtctggtttagcaagtttaatgtccaag

[0124] ttattattctatagttagaaataaaggtctgttgattaaattacagtagtttagcaagtttaatcacaccttaatactagtaacagttt

[0125] gatggctcccaaaaaggtttcccatgctagatccgccactgtagtattacgactataagtttttttttgttttcacagcaacttaaa

[0126] gaaataagcactgcgcaacacagtagaatagccataaaacgagccttagtgccatggtttggagcattttgctgctggcgtg

[0127] agaagatgtttccattctgttggttcagcattttagctggcgtttggctagatgtgcaacctaaggatgtctggtttagcaaattta

[0128] atgtccaagttattattctatagttagaaataaaggtctgttgattaaattatagtagtttagcaagtttaatcaccaattagggtta

[0129] gattcaatcgactggtttggggcaaagtgtttactttattgtagatcttgttgcttaaattacatcggccggagaggttccgactt

[0130] aacatgctgtagcatcgatgtagtgtattccaagcctctctctctctctaattaacccatccacattatctaaaaaaaattaaccc

[0131] atccaactttttggagatttctttaaaaaaaattaacccatccaactttttggagatttctttggtgggtggtcaggcggtaataac

[0132] agtttgtttccaaaagttttggagattcagcggatacacatgaaacatgtttgccatgcttagtctcttaccaaaggctttttttttct

[0133] tgcagatatgacttgttgagtggaaagaatcaatatagtacaatctattttcttctcaatgtgtagaagaaacagtctgtaaccat

[0134] acatacttattaatacgactagtgaaatctagacatggacgatgagaatggccttgagcttagcttgggtctctctttgggtgg

[0135] gacatcaggaaagtctaaggctagagatgctcctctagaacctaaagcagagcctcaagtggaagagagcagtagcaaa

[0136] ggtgtttcacaaactcctgaggctccttttgtgcattactatcaaacaaatgcagagaaccaagaacacagtagcaagcaga

[0137] gacacagccctgctgcaccaccgtttgggaacttttggggacagccagggagttcttctgttcctgtggcagatggatccaa

[0138] tgaacagaagccagtctctagtaaacggaaattactttctgaggagataagttttcagaagaaacctaatacagctgctgagc

[0139] aacctgatgcatttagtaagagctctgacggtggtgtaaaaaacgctcctatttcaattagcacggatgatggttcaacaggt

[0140] gaaaacgaggatgttgcagaatcagaagcagaaggctcaaactcttggttggttgcacagcgtgaagacagtgctaaggg

[0141] atctgttgtcaatagaggatctgacagaaaacgatccagtgatgatgctgcagttggttttcaaggaaagaggcagccaagt

[0142] ttctcaggaagtgaatccagctctggaaaattgccacaaggaaatcctttgtcattgcaagcatcaaatgttgttgctgtgccat

[0143] atcaagtcccgtctcaggtttcagctcctcccagtattaccaatgcatcaaatttcactccagtatgtacagtgcagttgaggcc

[0144] acctacaaacaatggactagctgttacaatgggcagtacctctcaggtagcttttggttatccagctgtccagctaccaacact

[0145] tgaaacaagctcttcatgggcttttggtgctccacctcaggctatgtcctcttttactgcaaaagacaaagttgaacgagcagg

[0146] aatcagtcaagctgacgatggcaagaaaactcaaggttagtttacctgtgaacaacgcccacactctcagaacaaagaaca

[0147] aaaaatgtactgttacctgttgtggttcatctctaaataacaaatatatttgaagtcaacaagaattaagatacttggtctgggttt

[0148] gatcactacatttttagcaaaaaaactctatggttatgtcgcaaatgtcgttgggtttggtatgatagaagtatactttgagacat

[0149] gccactgatctcatttagtttcagaatatttatgagtagttggaagctgcattgctgcttgtatgcatacaagaactgcctttgtct

[0150] atggtattttatgatctggtaacgtaaaataagtggagattacttcttatgcgctgctgtttttatgcctaaacaatcatatgtttga

[0151] atttgaaattttcagtatttacaatttgcatactgattcattttttcccccaacttcagaggctggtgcttcctcttctgctcttgtgga

[0152] ggatgacaagaagtctgatagggcattacctctcatgggttctgctataaggccaggcattgcaccaaatgtcaaattcgga

[0153] ggatctggatcgtatcctgaccttccctgggtttctaccactggtactgggccaaatggcagaaccatatcaggtgtaacatat

[0154]

[0155] SEQ ID No.2: Amino acid sequence of the protein encoded by rice TOMS1 gene

[0156] MDDENGLELSLGLSLGGTSGKSKARDAPLEPKAEPQVEESSSKGVSQTPEAPFVHYYQTNAENQEHSSKQRHSPAAPPFGNFWGQPGSSSVPVADGSNEQKPVSSKRKLLSEEISFQKKPNTAAEQPDAFSKSSDGGVKNAPISISTDDGSTGENEDVAESEAEGSNSWLVAQREDSAKGSVVNRGSDRKRSSDDAAVGFQGKRQPSFSGSESSSGKLPQGNPLSLQASNVVAVPYQVPSQVSAPPSITNASNFTPVCTVQLRPPTNNGLAVTMGSTSQVAFGYPAVQLPTLETSSSWAFGAPPQAMSSFTAKDKVERAGISQADDGKKTQEAGASSSALVEDDKKSDRALPLMGSAIRPGIAPNVKFGGSGSYPDLPWVSTTGTGPNGRTISGVTYKFGRNEVKIVCACHGTHMTPEEFMRHASADAPGQENSATLPAFPVGNQAASAQN

[0157] SEQ ID NO.3: To obtain toms1 cr gRNA guide sequence of -1

[0158] AGAAGCCAGTCTCTAGTAAACGG

[0159] SEQ ID NO.4: To obtain toms1 cr gRNA of -2

[0160] GCCATATCAAGTCCCGTCTCAGG

Claims

1. TOMS1 (Thermal Oversensitive MeSocotyl1) or its alleles, the amino acid sequence of the encoded protein is shown as any one of the following: 1) The amino acid sequence shown in SEQ ID NO.2; 2) An amino acid sequence that is different from the amino acid sequence shown in SEQ ID NO.2 due to substitution, deletion, and / or insertion of one or more amino acid residues, but has the same activity as the protein composed of the amino acid sequence shown in SEQ ID NO.2; 3) An amino acid sequence that has at least 90%, preferably at least 99% identity with the amino acid sequence shown in SEQ ID NO.2, and has the same activity as the protein composed of the amino acid sequence shown in SEQ ID NO.2; or 4) An active fragment containing any one of the amino acid sequences in 1)-3).

2. The gene according to claim 1, the nucleotide sequence of which is shown as any one of the following: 1) The nucleotide sequence shown in SEQ ID NO.1; 2) A nucleotide sequence that is different from the nucleotide sequence shown in SEQ ID NO.1 due to substitution, deletion, and / or insertion of one or more nucleotide sequences, but has the same activity as the protein encoded by the nucleotide sequence shown in SEQ ID NO.1; 3) A nucleotide sequence that has at least 90%, preferably at least 99% identity with the nucleotide sequence shown in SEQ ID NO.1, and has the same activity as the protein encoded by the nucleotide sequence shown in SEQ ID NO.1; 4) A nucleotide sequence that is different from SEQ ID NO.1 in sequence due to the degeneracy of the genetic code; 5) An active fragment containing any one of the nucleotide sequences in 1)-4); 6) A nucleotide sequence containing a complementary sequence that hybridizes with any one of the nucleotide sequences in 1)-5) under medium stringency conditions, preferably high stringency hybridization conditions; or 7) A nucleotide sequence containing a complementary sequence to any one of the nucleotide sequences in 1)-5).

3. A recombinant vector containing the TOMS1 gene or its alleles according to claim 1 or 2, the vector includes any one of the following: 1) A plant expression vector containing the gene according to claim 1 or 2 (such as pCAMBIA1300), the plant expression vector contains the TOMS1 promoter or a gene sequence encoding a tag protein (such as GFP); 2) A plant gene editing vector for the target sequence of gene editing of the polynucleotide sequence according to claim 1 or 2, the plant gene editing vector contains an enhanced promoter (such as Ubiquitin).

4. A host cell containing the TOMS1 gene or its alleles according to claim 1 or 2 or the vector according to claim 3, such as a bacterium, a fungus or a plant cell, preferably an Escherichia coli cell, an Agrobacterium tumefaciens cell or a rice cell.

5. A method for cultivating a plant with excellent high environmental temperature adaptability response, the method comprising knocking out or reducing the expression of the TOMS1 gene or its allele in the crop, preferably knocking out or reducing the expression of the TOMS1 gene or its allele as claimed in claim 2.

6. The method according to claim 5, wherein the method comprises: Transfecting the vector as claimed in claim 3 or the host cell as claimed in claim 4 into a plant cell to obtain a transgenic plant, such that the TOMS1 gene is not expressed in the transgenic plant, thereby obtaining a plant with high environmental temperature adaptability, wherein the crop is a gramineous plant, preferably rice.

7. The method as claimed in claim 5 or 6, wherein the transgenic plant is obtained by an Agrobacterium-mediated method or a particle bombardment method.

8. The transgenic plant according to claim 6, characterized in that Compared with the wild type of the transgenic plant, the high environmental temperature adaptability of the transgenic plant is improved.

9. Use of a TMOS1 gene or a protein encoded thereby in cultivating a plant with excellent high environmental temperature adaptability response, wherein the plant is a gramineous plant, preferably rice.

10. The use as claimed in claim 9, wherein the TOMS1 gene or its allele is the TOMS1 gene or its allele as claimed in claim 2.

Images