Tripterygium wilfordii transcription factor MYB92 and application thereof

Abstract

The invention discloses a tripterygium wilfordii transcription factor MYB92 and application thereof. The full length of the disclosed TwMYB92 coding gene is 1002bp, and 333 amino acids are coded. The invention finds that the transcription factor can be specifically combined with a promoter region of tripterygium wilfordii terpenoid synthetase and has remarkable transcriptional regulation activity. By regulating and controlling the expression of the TwMYB92 transcription factor, the expression of the terpene synthetase gene can be effectively activated, so that the accumulation of terpene substances is promoted. By identifying the function of the TwMYB92 transcription factor, a foundation is laid for improving the biosynthesis of tripterygium wilfordii terpenoids through a genetic engineering means, a feasible scheme is provided for protecting wild tripterygium wilfordii resources, and the application prospect is wide and the economic value is important.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and particularly relates to a Tripterygium wilfordii transcription factor MYB92 and its applications, as well as its applications in plant metabolism regulation and plant breeding. Background Art

[0002] Tripterygium wilfordii Hook.f. is a plant of the genus Tripterygium in the Celastraceae family, a vine shrub, and is an important medicinal plant and a plant with insecticidal activity. Tripterygium wilfordii contains more than 400 active terpenoid compounds, and sesquiterpenes and their alkaloid derivatives are its important active ingredients, which have strong anti-inflammatory, anti-tumor, immunosuppressive and anti-cancer and other biological activities and insecticidal, rodenticidal, antibacterial and other agricultural activities. Despite its important biological activities and economic value, Tripterygium wilfordii is mostly collected from wild resources. The lack of natural resources, slow growth, low content, complex structure, uneconomical chemical synthesis and other problems have led to a serious shortage of Tripterygium wilfordii resources, which is not enough to meet the market demand. Therefore, it is urgent to solve the problem of limited resources through metabolic engineering and synthetic biology strategies to achieve sustainable production. However, there has been no report on the research related to the biosynthesis regulation of sesquiterpenes and their alkaloid derivatives in Tripterygium wilfordii. Summary of the Invention

[0003] The present invention provides a Tripterygium wilfordii transcription factor MYB92 and its applications. The amino acid sequence of the Tripterygium wilfordii MYB92 transcription factor is one of the following amino acid sequences:

[0004] (1) The amino acid sequence shown in SEQ ID NO.1;

[0005] (2) The amino acid sequence of the fusion protein obtained by fusing a protein tag at the carboxyl terminus and / or amino terminus of the amino acid sequence shown in SEQ ID NO.1;

[0006] (3) The amino acid sequence shown in SEQ ID NO.1 with one or more amino acids deleted, added or replaced and having the same protein function.

[0007] Optionally, the gene sequence encoding the amino acid sequence of the Tripterygium wilfordii transcription factor MYB92 is selected from one of the following sequences:

[0008] (1) The nucleotide sequence shown in SEQ ID NO.2;

[0009] (2) The nucleotide sequence obtained by deleting, adding or replacing one or more nucleotides in the nucleotide sequence shown in SEQ ID NO.2 and expressing the same functional protein.

[0010] A tobacco transient expression vector containing the gene encoding the amino acid sequence of the Tripterygium wilfordii transcription factor MYB92 of the present invention, and the expression vector is a recombinant plasmid pBin-eGFP, pGreenⅡ-62-sk;

[0011] The 5' end of the pBin-eGFP expression vector is assembled with an overexpression promoter CaMV 35S promoter, the 3' end is assembled with a terminator NOS terminator and an eGFP tag; the 5' end of the pGreenⅡ-62-sk expression vector is assembled with an overexpression promoter CaMV 35S promoter, and the 3' end is assembled with a terminator NOS terminator.

[0012] A yeast one-hybrid vector containing the gene encoding the amino acid sequence of the Tripterygium wilfordii transcription factor MYB92 of the present invention;

[0013] The expression vector is pGADT7, which contains a Leu2 promoter, a Leu2 tag, an ADH1 promoter, an ADH1 terminator, a T7 promoter and an AmpR resistance tag;

[0014] A plant overexpression vector and an RNAi vector containing the gene encoding the amino acid sequence of the Tripterygium wilfordii transcription factor MYB92 of the present invention;

[0015] The plant overexpression vector is PJCV53, which contains a CaMV 35S promoter, a NOS terminator, a SmR resistance tag, a NeoR / KanaR resistance tag, an mRFP1 tag, attR1\attR2 and a ccdb tag;

[0016] The plant RNAi vector is pRedroot, which contains a pAtUbq10 promoter, a NOS terminator, a SmR resistance tag, a NeoR / KanaR resistance tag, ttR1\attR2, a ccdb tag and a DsRed tag.

[0017] A prokaryotic expression vector pET28a-mcherry containing the gene encoding the amino acid sequence of the Tripterygium wilfordii transcription factor MYB92 of the present invention; containing a T7 promoter, a lac operator, a 6xHis tag, an mCherry tag, a KanaR resistance tag and a lacI tag.

[0018] The application of the Tripterygium wilfordii transcription factor MYB92 of the present invention in increasing the content of terpenoids in Tripterygium wilfordii.

[0019] The application of the Tripterygium wilfordii transcription factor MYB92 of the present invention is used for plant genetic engineering regulation of the biosynthesis of terpenoids in Tripterygium wilfordii hairy roots, Tripterygium wilfordii plants and / or Tripterygium wilfordii suspension cells.

[0020] The application of the Tripterygium wilfordii transcription factor MYB92 of the present invention is used for breeding Tripterygium wilfordii with high-content terpenoids.

[0021] A breeding method for Tripterygium wilfordii, which overexpresses the gene encoding the amino acid sequence of the Tripterygium wilfordii transcription factor MYB92 of the present invention in Tripterygium wilfordii hairy roots, Tripterygium wilfordii plants and / or Tripterygium wilfordii suspension cells.

[0022] The MYB92 transcription factor for regulating the content of terpenoids in Tripterygium wilfordii and its application of the present invention verify the function of the MYB92 transcription factor through various experimental methods, and create Tripterygium wilfordii overexpression and RNAi transgenic materials, providing a new method for regulating the content of terpenoids in Tripterygium wilfordii. Description of the Drawings

[0023] Figure 1 It is the agarose gel electrophoresis pattern of Tripterygium wilfordii TwMYB92 in the embodiment of the present invention (Marker is 2000 DNA marker, and the size of the target gene band is 1002 bp);

[0024] Figure 2 It is the visualization analysis of the promoter structure of some terpene compound synthesis catalytic enzymes in the embodiment of the present invention;

[0025] Figure 3 It is the tobacco subcellular localization map of Tripterygium wilfordii TwMYB92 in the embodiment of the present invention;

[0026] Figure 4 (a) is the screening of the aureobasidin inhibition concentration of the bait vector pAbAi-3*myb of the cis-acting element 3*myb (GATACCTAACGATACCTAAC GATACCTAAC) shared by multiple terpene synthases in the embodiment of the present invention; (b) is the yeast one-hybrid analysis map of TwMYB92 and the cis-acting element; (c) is the schematic diagram of the structure of the dual-luciferase reporter gene analysis test vector; (d) is the result map of the dual-luciferase reporter gene test; (e) is the result map of the in vivo imaging of the dual-luciferase reporter gene; (f) is the SDS-PAGE map of the purified protein after prokaryotic expression of TwMYB92:mcherry; (g) is the binding analysis map of TwMYB92 and 3*myb (GATACCTAAC GATACCTAACGATACCTAAC) verified by EMSA technology;

[0027] Figure 5(a) The overexpression and RNAi vectors of TwMYB92 were used to transform explants with Agrobacterium tumefaciens ATCC15834. The explants were cultured on MS solid plates (containing 100 μM AS) in the dark at 25 °C for 3 days, and then transferred to callus induced by MS (containing 1 mg / L 2,4-D + 0.5 mg / L KT). Figure 5 (b) The results of HPLC analysis for detecting wilforine are shown. Sample WT is the callus induced from wild-type explants, sample pJCV53-TwMYB92 is the callus induced from overexpressing explants, and sample pRedroot-TwMYB92 is the callus induced from RNAi explants. Detailed implementation manners

[0028] Unless otherwise specified, scientific and technical terms in this article are understood according to the knowledge of those of ordinary skill in the relevant fields. To better understand the essence of the invention, the technical content of the invention will be described in detail below with examples, but the invention is not limited to these examples.

[0029] The experimental methods used in the following implementation cases are all conventional methods unless otherwise specified.

[0030] The materials, reagents, etc. used in the following implementation cases can all be obtained from commercial channels unless otherwise specified.

[0031] The Tripterygium wilfordii tissues in the following implementation cases were collected from Tripterygium wilfordii plants grown in the experimental field of the Shaanxi Bio-Pesticide Engineering and Technology Center, Northwest A&F University.

[0032] On the one hand, the present invention provides a Tripterygium wilfordii MYB92 transcription factor. The amino acid sequence of the Tripterygium wilfordii MYB92 transcription factor is one of the following amino acid sequences:

[0033] (1) The amino acid sequence shown in SEQ ID NO.1;

[0034] (2) A fusion protein obtained by fusing a protein tag at the carboxyl terminus and / or amino terminus of the amino acid sequence shown in SEQ ID NO.1;

[0035] (3) An amino acid sequence obtained by deleting, adding or substituting one or more amino acids in the amino acid sequence shown in SEQ ID NO.1 and having the same protein function.

[0036] The present invention also provides a gene encoding the above-mentioned Tripterygium wilfordii MYB92 transcription factor, and the nucleotide sequence of the gene is selected from one of the following sequences:

[0037] (1) The nucleotide sequence shown in SEQ ID NO.2;

[0038] (2) Nucleotide sequences in which one or more nucleotides in the nucleotide sequence shown in SEQ ID NO.2 are deleted, added or replaced and which express the same functional protein.

[0039] The present invention provides expression vectors of the above genes, including but not limited to plant expression vectors and prokaryotic expression vectors. Tobacco transient expression vectors such as recombinant plasmid pBin-Egfp-TwMYB92 contain the promoter CaMV 35Spromoter, the TwMYB92 gene and the terminator NOS terminator; and the pGreenⅡ-62-sk expression vector contains the overexpression promoter CaMV 35S promoter assembled at the 5' end and the terminator NOS terminator assembled at the 3' end. The Tripterygium wilfordii overexpression vector is pJCV53, which contains CaMV 35S promoter, NOS terminator, SmR resistance tag, NeoR / KanaR resistance tag, mRFP1 tag, attR1\attR2, ccdb tag; the Tripterygium wilfordii RNAi vector is pRedroot, which contains pAtUbq10 promoter, NOS terminator, SmR resistance tag, NeoR / KanaR resistance tag, attR1\attR2, ccdb tag, DsRed tag. The prokaryotic expression vector is pET28a-mcherry, which contains T7 promoter, lac operator, 6xHis tag, mCherry tag, KanaR resistance tag, lacI tag.

[0040] The present invention provides a method for visualizing the promoter structure of Tripterygium wilfordii secondary metabolite synthase. Cis-acting element analysis of the promoter is performed through Plantcare (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ), and then cis-acting element mapping is performed through Tbtools. The results are as Figure 2 shown. The left side shows the evolutionary relationship of the synthase promoter, the middle part shows the position distribution of different cis-acting elements on the synthase promoter, and the rightmost side shows the legend.

[0041] The present invention also provides methods for the identification and functional verification of the above MYB92 transcription factor and the creation and application of transgenic materials.

[0042] The Tripterygium wilfordii MYB92 transcription factor or its coding gene of the present invention can be used for the application of increasing the content of terpenoids in Tripterygium wilfordii. In a specific scheme, the transcription factor of the present invention is overexpressed in plants such as Tripterygium wilfordii, thereby increasing the content of terpenoids in the corresponding plants.

[0043] Example 1: Full-length cDNA cloning of the Tripterygium wilfordii TwMYB92 encoding gene

[0044] Based on the nucleotide sequence SEQ ID NO.2 of the TwMYB92 gene obtained by transcriptome sequencing, primers were designed to amplify the target gene, and the primer sequences are as follows:

[0045] TwMYB92-F: 5’AGTGGATCCCCCGGGCTGCAGATGGGAAGATCTCCTTGCT 3’(SEQ ID NO.3);

[0046] TwMYB92-R:

[0047] 5’GGTATCGATAAGCTTGATATCCTAAGAAATCTCACGAAACAAAG 3’(SEQ ID NO.4);

[0048] The total RNA of Tripterygium wilfordii roots was extracted using the RNAprep Pure Polysaccharide Polyphenol Plant Total RNA Extraction Kit from Tiangen Biochemical Technology (Beijing) Co., Ltd., and the first-strand cDNA was synthesized using the PrimeScript TM 1st Strand cDNA Synthesis Kit (TaKaRa) and used as a template for gene cloning;

[0049] PCR amplification was performed with the above primers, and the reaction conditions were 96°C for 3 min; 96°C for 10 s; 56°C for 10 s; 72°C for 2 min; 32 cycles; 72°C for 5 min; and stored at 16°C. The size of the PCR product was detected by agarose gel electrophoresis as Figure 1 shown. The product sequence was determined to be correct as shown in SEQ ID NO.2 by sequencing and named TwMYB92. The full length of this gene is 1002 bp and encodes 333 amino acids.

[0050] Example 2: Binding and transcriptional activity analysis of TwMYB92

[0051] 1. Yeast one-hybrid analysis

[0052] All relevant vectors used in this case are publicly available on Snapgene (https: / / www.snapgene.com / ). Primers were designed according to the relevant sequences as follows:

[0053] pAbAi-3xMyb-F: 5’-GGTACC GATACCTAACGATACCTAACGATACCTAAC-3’(SEQ IDNO.5);

[0054] pAbAi-3xMyb-R: 5’-GTCGACGTTGACCAGTTGACCAGTTGACCA-3’ (SEQ ID NO.6);

[0055] PGADT7-TwMYB92-F:

[0056] 5’-ATGGCCATGGAGGCCAGTGAATTCATGGGAAGATCTCCTTGCT-3’ (SEQ ID NO.7);

[0057] PGADT7-TwMYB92-R: 5’-CTGCAGCTCGAGCTCGATGGATCCCTAAGAAATCTCACGAAA CAAAG-3’ (SEQ ID NO.8);

[0058] The key enzyme promoter sequence of the triptolide synthesis pathway was constructed onto the pAbAi vector by one-step cloning to form the recombinant plasmid pAbAi-bait. It was linearized by single digestion with the restriction enzyme Bbs I, and the digested product was recovered. 100 ng of the recovered digested product was transformed into the Y1HGold yeast strain, spread on the SD / -Ura medium, and cultured upside down at 28 °C for 3 - 5 d. Single colonies were picked for colony PCR detection to ensure that the promoter fragment was successfully integrated into the yeast genome, and the Y1HGold[pAbAi-bait] bait strain was preserved. The correct Y1HGold[pAbAi-bait] bait strain was re-streaked on the SD / -Ura medium, single colonies were picked and resuspended with ddH2O, and the OD600 was adjusted to 0.002. 100 μL of the bacterial solution was respectively spread on the SD / -Ura, SD / -Ura / AbA (50, 100, 200, 300, 400, 500, 600, 700, 800 ng / mL) media, and cultured upside down at 28 °C for 3 - 5 d to determine the lowest AbA concentration that inhibits the growth of the bait strain. The p53-AbAi recombinant plasmid was linearized and then transformed into the Y1HGold yeast strain as a control, and the lowest AbA inhibition concentration of Y1HGold[p53-AbAi] was known to be 100 ng / mL.

[0059] The yeast competent cells were prepared from the Y1HGold [pAbAi-bait] bait strain. The ORF sequence of the transcription factor TwMYB92 was constructed into the pGADT7 vector by one-step cloning method. The recombinant plasmid of pGADT7-TwMYB92 was transferred into the above yeast competent cells. Positive monoclonal colonies were picked and cultured in SD / -Leu liquid medium for expansion. After dilution to an OD600 of 0.02, they were spotted onto plates of SD / -Leu and SD / -Leu / AbA containing the minimum inhibitory concentration, and cultured upside down at 28 °C for 3 - 5 days. Then, according to the colony growth situation, the interaction between TwMYB92 and pAbAi-3xMyb was detected. The Y1H-Gold yeast obtained after co-transformation of pAbAi-p53 and pGADT7-p53 plasmids was used as a positive control, and the Y1H-Gold yeast obtained after co-transformation of the pGADT7 empty vector and pAbAi-bait plasmid was used as a negative control.

[0060] The test results are as Figure 4 (a) and (b) shown. Figure 4 (a) shows the screening of the inhibitory concentration of aureobasidin. First, the constructed p53-pAbAi was integrated into the genome of the Y1H strain as a positive control; then the constructed 3*myb-pAbAi was integrated into the genome of the Y1H strain as the experimental group; the correctly detected monoclonal colonies were prepared into competent cells and transformed with the pGADT7 empty vector, and then spread on SD / -Leu medium, SD / -Leu + 100 mg / L aureobasidin medium, and SD / -Leu + 200 mg / L aureobasidin medium, and the results were counted after culturing upside down at 28 °C for 2 days. The results showed that 3*myb-pAbAi could completely inhibit autoactivation at the aureobasidin concentration of 200 mg / L. Figure 4 (b) shows the analysis of the yeast one-hybrid results. The upper part shows the structural characteristics after 3*myb-pAbAi was integrated into the Y1H strain; the lower part shows the analysis of the yeast one-hybrid results. p53-pAbAi + p53-pGADT7 was used as a positive control, 3*myb-pAbAi + pGADT7 was used as a negative control, and 3*myb-pAbAi + TwMYB92-pGADT7 was used as the experimental group. The results showed that TwMYB92 could bind to the 3*myb element at the aureobasidin concentration of 200 mg / L.

[0061] 2. Subcellular localization analysis

[0062] 2.1 Construction of the pBin-eGFP vector

[0063] The CDS sequence of the TwMYB92 transcription factor with the stop codon removed was cloned by PCR. The relevant primer sequences are as follows:

[0064] pBin-TwMYB92-F: 5’-ATTTACGAACGATAGACTAGTATGGGAAGATCTCCTTGCT-3’ (SEQ ID NO.9);

[0065] pBin-TwMYB92-R: 5’-CTTGCTCACCATGGGACTAGTAGAAATCTCACGAAACAAAGGAT-3’ (SEQ ID NO.10);

[0066] The PCR product was ligated to the pBin-eGFP vector by one-step cloning method. The ligation product was transformed into Escherichia coli DH5α by heat shock method and cultured overnight at 37 °C for 12 - 16 h on LB solid medium containing 100 mg / L Kana at a final concentration. Single colonies were picked for colony PCR detection, and the positive clones were sent to the company for sequencing. The plasmid of the correctly sequenced expression vector TwMYB92-pBIN-GFP was extracted and stored at -20 °C for later use.

[0067] 2.2 Agrobacterium-mediated transient expression in tobacco

[0068] (1) The successfully constructed recombinant expression vector Tw MYB92-pBin-eGFP was transformed into Agrobacterium tumefaciens GV3101 (pSoup-p19) by the freeze-thaw method and cultured upside down at 28 °C for 2 - 3 d on LB solid medium containing 100 mg / L Rif and 100 mg / L Kana at a final concentration.

[0069] (2) Single colonies were picked and cultured in 500 μL of LB liquid medium containing the same antibiotics at 28 °C with shaking at 220 rpm for 12 h, and positive clones were identified by PCR.

[0070] (3) 300 μL of the bacterial solution identified correctly by PCR was added to 50 mL of LB liquid medium containing the same antibiotics and cultured at 28 °C with shaking at 220 rpm until the OD600 reached 1.0 - 1.2, then centrifuged at 8000 rpm for 10 min to remove the supernatant.

[0071] (4) The cells were resuspended and washed with 30 mL of resuspension solution (resuspension solution formula: 10 mM MgCl2; 10 mM MES pH = 5.8; 120 μM acetosyringone), centrifuged at 8000 rpm for 5 min to remove the supernatant.

[0072] (5) The cells were resuspended in the resuspension solution until the OD600 reached 0.6 and allowed to stand at room temperature in the dark for 2 - 3 h.

[0073] (6) Inject Nicotiana benthamiana that has been growing for about 4 weeks from the back of the tobacco leaf using a syringe. After 1 day in the dark, place it under normal conditions for 2 days of cultivation. Observe the fluorescence under a laser scanning confocal microscope (Zessi LSM880), and save the fluorescence images.

[0074] The test results are as Figure 3 shown. Figure 3 For the subcellular localization analysis of Agrobacterium-mediated tobacco transient expression, Flouresence is the GFP fluorescence channel, DAPI is the DAPI fluorescence channel, Bright light is the bright field channel, and Merge is the superposition of the three channels. The first row of GFP is the positive control, and the subcellular localization result is the nuclear plasma membrane; the second row is the experimental group, TwMYB92:GFP is the recombinant protein with GFP fused to the C-terminus, and the subcellular localization result is the cell nucleus.

[0075] 3. Dual-Luciferase Reporter (DLR) assay

[0076] The Dual-Luciferase Reporter (DLR) system analyzes whether a transcription factor can act on a promoter by detecting the effect of changes in the expression level of the transcription factor on the expression level of the luciferase gene.

[0077] (1) Construct the CDS sequence of TwMYB92 into the pGreenII-62-SK vector as the effector plasmid, and construct the key enzyme promoter sequence into the pGreenII-0800-Luc vector as the reporter gene plasmid. The relevant primer sequences are as follows:

[0078] SK-TwMYB92-F: 5’-CGCTCTAGAACTAGTGGATCCATGGGAAGATCTCCTTGCT-3’ (SEQ ID NO.11);

[0079] SK-TwMYB92-R: 5’-GATAAGCTTGATATCGAATTCAGAAATCTCACGAAACAAAGGAT-3’ (SEQ ID NO.12);

[0080] LUC-TwSeTPS1-F: 5’-GGTATCGATAAGCTTGATATCCTGCAGTAGAAGCTCGCAAATTAG-3’ (SEQ ID NO.13);

[0081] LUC-TwSeTPS1-R: 5’-AGTGGATCCCCCGGGCTGCAGGGTGTGCTTAGTATATTTGTTGGTCTAGC-3’ (SEQ ID NO.14);

[0082] (2) Transform Agrobacterium tumefaciens GV3101 (pSoup-p19) by the freeze-thaw method, and culture the positive clones with correct PCR detection in liquid medium. The experimental group was: co-transforming tobacco leaves with pGreenII-62-SK-TwMYB92 + pGreenII-0800-Luc-proTwTPS12; the control groups were: co-transforming tobacco leaves with pGreenII-62-SK + pGreenII-0800-Luc, pGreenII-62-SK + pGreenII-0800-Luc-proTwTPS12, and pGreenII-62-SK-TwMYB92 + pGreenII-0800-Luc-proTwTPS12. According to the method of Agrobacterium-mediated transient expression in tobacco, inject tobacco plants that have grown for about 4 weeks, and the volume ratio of the Agrobacterium carrying the effector plasmid to the Agrobacterium carrying the reporter gene plasmid is 9:1.

[0083] (3) Two days after injection, take samples near the injection site using a punch, and refer to the instructions of the Dual-Luciferase Reporter Assay Kit ( Reporter Assay) to measure the chemiluminescence values of Firefly luciferase (LUC) and Renilla luciferase (REN) using a microplate luminometer (Promega GloMaxNavigator), and record and calculate the ratio of LUC to REN.

[0084] (4) At the same time, evenly apply the luciferase substrate D-luciferin potassium salt with a working solution concentration of 0.3 mg / mL to the back of the injected tobacco leaves, let it stand in the dark for 5 minutes, and take pictures using a plant in vivo molecular marker imaging system (CCD) (Lumazone Pylon 2048B).

[0085] The experimental results are shown in Figure 4 (c), (d), and (e). Figure 4 (c) is a schematic diagram of the reporter plasmid and the effector plasmid structures, and the labels in the figure are common vector labels. Figure 4(d) shows the Luc / Ren statistical results. pGreenII-62-SK + pGreenII-0800-Luc is the control group, pGreenII-62-SK + pGreenII-0800-Luc-proTwTPS12 is experimental group 1, and pGreenII-62-SK-TwMYB92 + pGreenII-0800-Luc-proTwTPS12. Calculate the Luc / Ren results for each group respectively. Taking the control group as a reference, divide the Luc / Ren results of experimental group 1 and experimental group 2 by the Luc / Ren result of the control group to obtain the relative Luc / Ren activities of experimental group 1 and experimental group 2. The results show that TwMYB92 can significantly activate the promoter of TwTPS12. Figure 4 (e) shows the in vivo imaging analysis. The experimental group is: tobacco leaves co-transformed with pGreenII-62-SK-TwMYB92 + pGreenII-0800-Luc-proTwTPS12; the control groups are: pGreenII-62-SK + pGreenII-0800-Luc, pGreenII-62-SK + pGreenII-0800-Luc-proTwTPS12, pGreenII-62-SK-TwMYB92 + pGreenII-0800-Luc-proTwTPS12. Conduct in vivo imaging analysis 48 h after injecting the tobacco with an equal volume mixture of the two bacterial solutions. The results show that the fluorescence activity of the experimental group pGreenII-62-SK-TwMYB92 + pGreenII-0800-Luc-proTwTPS12 is significantly higher than that of the control groups, indicating that TwMYB92 can significantly activate the promoter of TwTPS12.

[0086] 4. EMSA analysis of TwMYB92

[0087] 4.1 Protein prokaryotic expression and purification

[0088] Clone the CDS sequence of TwMYB92 without the terminator into the pET28a-mcherry vector to obtain the pET28a-TwMYB92-mcherry fusion protein expression vector. The specific primer sequences are as follows:

[0089] 28a-TwMYB92-F: 5’-GGTGGACAGCAAATGGGTCGCGGATCCATGGGAAGATCTCCTTGCTG-3’ (SEQ ID NO.15);

[0090] 28a-TwMYB92-R: 5'-CTCCTCGCCCTTGCTCACCATGGATCCAGAAATCTCACGAAACAAAGGATC-3' (SEQ ID NO.16);

[0091] The recombinant plasmid was transformed into BL21(DE3) competent cells and spread on an LB plate containing 100 mg / L Kanaamycin / Cm at a final concentration. Incubate overnight at 37 °C for 12 - 16 h. Pick monoclonal colonies for colony PCR detection, and culture the positive clones in liquid medium. Culture the bacterial solution containing the recombinant plasmid until the OD600 is approximately 0.6, add IPTG at a final concentration of 0.1 mM, and transfer it to a shaker at 16 °C and shake at 180 rpm for 16 h to induce protein expression. Centrifuge the cells at 10,000 rpm for 10 min at 4 °C to collect the cells. Assemble the chromatography column according to the kit instructions and perform protein purification.

[0092] The test results are as Figure 4 (f) shown. Figure 4 (f) shows the SDS-PAGE results after purification of the prokaryotic expressed protein. The position marked by Maker is 70 kd, and the band after purification is single, meeting the requirements of subsequent experiments.

[0093] 4.2 Gel retardation mobility assay (EMSA) experiment

[0094] (1) Probe preparation: Design a 5' Fam-modified probe for the cis-acting element obtained by yeast one-hybrid analysis. A competitive cold probe can be obtained by PCR using unmodified primer pairs. The specific probe sequences are as follows:

[0095] 5'Fam-3xmyb-F: 5'-GATACCTAACGATACCTAACGATACCTAAC-3' (SEQ ID NO.17);

[0096] 3xmyb-R: 5'-GTTAGGTATCGTTAGGTATCGTTAGGTATC-3' (SEQ ID NO.18);

[0097] (2) Pre-electrophoresis: Prepare a 6% non-denaturing polyacrylamide gel and pre-electrophorese at a constant voltage of 80 V for 30 min in pre-cooled 0.5×TBE buffer. After pre-electrophoresis, rinse the sample wells.

[0098] (3) Incubate according to the instructions of the Chemiluminescence EMSA Kit from Beyotime. Add various reagents in the order of Nuclease-Free Water, EMSA / Gel-Shift Binding Buffer, purified protein, labeled probe, and competitive cold probe. Place at room temperature for 10 min to eliminate non-specific binding. After adding the labeled probe, mix well and place at room temperature for 20 min. Finally, add 1 μL of loading buffer, mix well and load the sample immediately.

[0099] (4) Electrophoresis: Place the electrophoresis tank on ice and perform electrophoresis at a constant voltage of 80 V until the bromophenol blue indicator band is 2 - 3 cm away from the bottom of the gel, then stop electrophoresis.

[0100] (5) Place it in a chemiluminescence detector for taking pictures.

[0101] The test results are as Figure 4 (g) shown. Figure 4 (g) is the gel retardation mobility assay. TwMYB92:his is the fusion protein of prokaryotically expressed TwMYB92 and his. Probe is the fluorescent probe. Competitor probe is the non-fluorescent competitive probe. Plus and minus signs correspond to addition and non-addition respectively. 500X, 300X, and 100X in the competitor probe row are the concentrations of the competitive probe relative to the fluorescent probe. DNA-protein complex is the binding band, and free probe is the free probe band. The results show that the migration rate of the DNA band in the experimental group is significantly slowed down, forming a specific band, while there is no obvious change in the control group. After adding an excessive amount of unlabeled competitive probe, the binding band weakens, indicating specific binding. TwMYB92 can specifically bind to the cis-acting element in the TPS12 promoter.

[0102] Example 3: Induction of TwMYB92 overexpression and RNAi calli

[0103] (1) Induction of TwMYB92 overexpression calli

[0104] Primers were designed according to the carrier restriction sites and the TwMYB92 sequence. The full-length ORF of TwMYB92 was cloned by TwMYB92-OE-F / R and ligated into the plant overexpression vector pJCV53 using the Gateway method. The recombinant plasmid pJCV53-TwMYB92 was transferred into Agrobacterium tumefaciens EHA105, and monoclonal colonies were obtained by streptomycin screening for hairy root induction. The silencing fragment of TwMYB92 was cloned by TwMYB92-RNAi-F / R and ligated into the plant RNAi vector pRedRoot using the Gateway method to obtain the recombinant plasmid pRedRoot-TwMYB92. Monoclonal colonies were obtained by streptomycin screening for callus induction. The specific primer sequences are as follows:

[0105] TwMYB92-OE-F:

[0106] 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGGAAGATCTCCTTGCTGTG-3’(SEQ IDNO.19);

[0107] TwMYB92-OE-R:

[0108] 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTAAGAAATCTCACGAAACAAAGGATC-3’(SEQ IDNO.20);

[0109] TwMYB92-RNAi-F:

[0110] 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCTCATCAACTACATCC AAAAG-3’(SEQ IDNO.21);

[0111] TwMYB92-RNAi-R: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCAAGTGAGGCAG GCTTGAG-3’(SEQ ID NO.22);

[0112] The leaves of Tripterygium wilfordii sterile seedlings were cut into 1×1 cm pieces as explants and pre-cultured on MS solid medium containing 1.0 mg / L 2,4-Dichlorophenoxyacetic acid (2,4-D) + 0.1 mg / L Kinetin (KT) for 3 d. The Agrobacterium rhizogenes ATCC15834 containing the recombinant plasmids pJCV53-TwMYB92 and pRedRoot-TwMYB92 was cultured to OD 600When OD = 0.6, the bacteria were collected and resuspended with an equal volume of osmotic buffer (10 mM MgCl2, 10 mM 2-(N-morpholino)ethanesulfonic acid MES, 100 μM AS, pH 5.8); the explants were placed into the suspension of Agrobacterium rhizogenes containing the recombinant plasmid for vacuum infiltration, and the excess bacterial liquid was blotted with sterile filter paper, then transferred to a hormone-free MS solid medium containing 100 μM AS. After co-culturing in the dark at 25 °C for 3 days, the explants were transferred to an MS solid medium containing 100 mg / L streptomycin and 400 mg / L ticarcillin and cultured in the dark; primers pJCV53-F / R and pRedRoot-PT-F / R were used for positive detection, and the specific primer sequences were as follows:

[0113] pJCV53-F: 5’-GTCGACCTGCAGGCGGCCGCACTAG-3’ (SEQ ID NO.23);

[0114] pJCV53-R: 5’-CAAGCGTAATCTGGAACATCATATGG-3’ (SEQ ID NO.24);

[0115] pRedRoot-PT-F: 5’-CATTTTGAGGCATTTCAGTCAGT-3’ (SEQ ID NO.25);

[0116] pRedRoot-PT-R: 5’-TTAGGGTTCTTATAGGGTTTCGC-3’ (SEQ ID NO.26);

[0117] The calli with correct verification were subcultured and could be used for metabolite detection. The calli were as shown in Figure 5 (a), and calli with uniform growth had been obtained.

[0118] Example 4: Detection of Metabolites in TwMYB92 Overexpressing and RNAi Calli

[0119] Weigh 100 mg of the positive callus obtained in Example 3, grind it in liquid nitrogen, and extract it thoroughly with 1 mL of n-hexane. Centrifuge at 12,000 rpm at room temperature to collect the supernatant. Repeat this process 5 times and then combine the supernatants. Evaporate the solvent using a nitrogen blower, and then dissolve the sample in 500 μL of chromatographic acetonitrile. After dissolution, filter the sample through a 0.22 μm microporous filter membrane, and then perform high-performance liquid chromatography (HPLC) analysis. The chromatographic column is an Agilent Zorbax SB-CL8 column (150 mm × 4.6 mm, 5 μm). The HPLC system uses a Waters 600E (Waters, USA) equipped with a Waters 2478 ultraviolet detector. The eluent is a 25% acetonitrile / water solution, the sample injection volume is 10 μL, the flow rate is 1 mL / min, and the column temperature is 25 °C. The detection wavelength is 219 nm. The detection results are as Figure 5 (b) shown. WT is the untransformed wild-type Tripterygium wilfordii callus, pJCV53-TwMYB92 is the overexpressing transgenic callus, and pRedroot-TwMYB92 is the RNAi transgenic callus. Compared with the wild type, the wilforine content in the overexpressing callus is approximately 11.22 μg / g, which is 2.20 times that of the wild type; the wilforine content in the RNAi callus is approximately 2.33 μg / g, which is 0.46 times that of the wild type. The results indicate that changing the expression level of TwMYB92 through genetic engineering technology can significantly affect the accumulation of wilforine.

[0120] Although the present invention has been described in detail above with general descriptions and specific embodiments, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of the present invention claimed.

Claims

1. A Tripterygium wilfordii transcription factor MYB92, characterized in that, The amino acid sequence of the Tripterygium wilfordii transcription factor MYB92 is selected from one of the sequences described in (1)-(3): (1) The amino acid sequence shown in SEQ ID NO.1; (2) The amino acid sequence of the fusion protein obtained by fusing a protein tag to the carboxyl terminus and / or amino terminus of the amino acid sequence shown in SEQ ID NO.1; (3) The amino acid sequence shown in SEQ ID NO.1 with one or more amino acids deleted, added or substituted and having the same protein function.

2. The Tripterygium wilfordii transcription factor MYB92 according to claim 1, wherein The gene sequence encoding the amino acid sequence of the Tripterygium wilfordii transcription factor MYB92 is selected from one of the following sequences: (1) The nucleotide sequence shown in SEQ ID NO.2; (2) The nucleotide sequence in which one or more nucleotides are deleted, added or substituted in the nucleotide sequence shown in SEQ ID NO.2 and expressing the same functional protein.

3. A tobacco transient expression vector containing the gene encoding the amino acid sequence of the Tripterygium wilfordii transcription factor MYB92 as claimed in claim 2, and the expression vector is the recombinant plasmid pBin-eGFP, pGreenⅡ-62-sk; The 5' end of the pBin-eGFP expression vector is assembled with the overexpression promoter CaMV 35S promoter, the 3' end is assembled with the terminator NOS terminator and the eGFP tag; the 5' end of the pGreenⅡ-62-sk expression vector is assembled with the overexpression promoter CaMV 35S promoter, and the 3' end is assembled with the terminator NOS terminator.

4. A yeast one-hybrid vector containing the gene encoding the amino acid sequence of the Tripterygium wilfordii transcription factor MYB92 as claimed in claim 2; The expression vector is pGADT7 and contains the Leu2 promoter, Leu2 tag, ADH1 promoter, ADH1 terminator, T7 promoter and AmpR resistance tag.

5. A plant overexpression vector and an RNAi vector containing the gene encoding the amino acid sequence of the Tripterygium wilfordii transcription factor MYB92 as claimed in claim 2; The plant overexpression vector is PJCV53 and contains the CaMV 35S promoter, NOS terminator, SmR resistance tag, NeoR / KanaR resistance tag, mRFP1 tag, attR1\attR2 and ccdb tag; The plant RNAi vector is pRedroot and contains the pAtUbq10 promoter, NOS terminator, SmR resistance tag, NeoR / KanaR resistance tag, ttR1\attR2, ccdb tag and DsRed tag.

6. A prokaryotic expression vector pET28a-mcherry containing the gene encoding the amino acid sequence of the Tripterygium wilfordii transcription factor MYB92 recited in claim 2; it contains a T7 promoter, a lac operator, a 6xHis tag, a mCherry tag, a KanaR resistance tag, and a lacI tag.

7. Use of the Tripterygium wilfordii transcription factor MYB92 recited in claim 1 for increasing the content of terpenoids in Tripterygium wilfordii.

8. Use of the Tripterygium wilfordii transcription factor MYB92 recited in claim 1 for genetically engineering the biosynthesis of terpenoids in Tripterygium wilfordii hairy roots, Tripterygium wilfordii plants, and / or Tripterygium wilfordii suspension cells.

9. Use of the Tripterygium wilfordii transcription factor MYB92 recited in claim 1 for breeding Tripterygium wilfordii with high content of terpenoids.

10. A breeding method for Tripterygium wilfordii, characterized in that, Overexpressing the gene encoding the amino acid sequence of the Tripterygium wilfordii transcription factor MYB92 recited in claim 2 in Tripterygium wilfordii hairy roots, Tripterygium wilfordii plants, and / or Tripterygium wilfordii suspension cells.

Images