Application of phallus impudicus NCED3 protein in plant tillering promotion
By cloning the NCED3 protein gene of Xisun and overexpressing it in Arabidopsis, the problem of tillering regulation in garden plants was solved, the increase in tillering in Arabidopsis was achieved, and the ornamental value was enhanced.
Patent Information
- Application Number
- CN202510474367.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-15
- Publication Date
- 2025-07-04
AI Technical Summary
The prior art is difficult to effectively regulate the tillering of garden plants such as creek sun through genetic engineering, affecting its ornamental value.
By cloning the gene of Xisun NCED3 protein and constructing a recombinant plant overexpression vector, it was introduced into Arabidopsis by Agrobacterium infection to achieve overexpression of NCED3 protein, thereby promoting tillering of Arabidopsis.
The increase in tillering was successfully achieved in Arabidopsis, providing the theoretical basis and genetic resources for tillering breeding of creeping simians, and laying the foundation for improving the ornamental value of garden plants.
Smart Images

Figure CN120248067A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of plant genetic engineering, and particularly relates to an Iris sanguinea NCED3 protein and its application in promoting tillering of plants. Background Art
[0002] For landscape plants, tillering can directly affect the overall ornamental effect, and graceful and neat tillering is the basis for improving the ornamental value of ornamental plants. In the past, the change of plant tillering was mostly regulated by traditional breeding methods or by measures such as external nutrition and hormone application. With the development of science and technology, through genetic engineering technology, the limitations of traditional breeding technology can be broken through. Therefore, changing plant tillering at the molecular level to increase its ornamental value has become one of the important means of tillering improvement.
[0003] Iris sanguinea Donn ex Hornem. is a perennial herb of the genus Iris. It has a strange flower shape, diverse flower colors, strong cold tolerance, and has low requirements for soil. It can be used for greening wetlands and shallow waters such as lakesides, riverbanks, and pond edges, as well as flower beds and flower borders, and can also be used as cut flowers. It has high ornamental value and is an excellent material for cold-region landscape greening with broad application prospects. In recent years, the research on Iris sanguinea has mainly focused on germplasm resource conservation and innovation, resistance physiology, cross-breeding, micropropagation technology, quality improvement, etc. When it is used as an ornamental and cut flower material, there is often a market demand for increasing tillering. To meet the requirements of landscape application for the tillering of Iris sanguinea, it is very important to carry out genetic engineering tillering breeding. The excavation and functional verification of tillering regulatory genes can lay a foundation for the development of genetic engineering breeding.
[0004] In recent years, with the in-depth study of rice and the model plant Arabidopsis thaliana, the basic pathway and molecular mechanism of abscisic acid (ABA) signal transduction have been gradually clarified. It has been confirmed that multiple genes related to ABA can affect the tillering of various plants. The synthesis pathway of ABA starts from the biosynthesis of carotenoids, undergoes a cleavage reaction catalyzed by NCED to generate xanthoxide, and finally forms ABA through the action of short-chain dehydrogenase reductase (SDR) and aldehyde oxidase (AAO). This process is regulated by various environmental factors and internal signals to ensure that plants can quickly adjust the ABA level under different conditions, and can optimize the tillering pattern of crops. The present invention provides an Iris sanguinea NCED3 protein and verifies its tillering regulatory function in the model plant Arabidopsis thaliana, aiming to provide a theoretical reference and important gene resources for the tillering breeding of Iris sanguinea. Summary of the Invention
[0005] The object of the present invention is to provide an application of Iris sanguinea NCED3 protein in promoting tillering of plants. The present invention provides a new way for tillering of garden plant plants, which is of great significance for exploring the function of Iris sanguinea NCED3 protein, revealing the tillering formation mechanism of plant plants, and providing an important reference for molecular breeding of Arabidopsis thaliana plants.
[0006] One object of the present invention is to provide an Iris sanguinea NCED3 protein.
[0007] Another object of the present invention is to provide a gene encoding Iris sanguinea NCED3 protein.
[0008] Another object of the present invention is to provide a biological material related to the Iris sanguinea NCED3 protein.
[0009] Another object of the present invention is to obtain an Arabidopsis thaliana transgenic plant containing the Iris sanguinea NCED3 gene.
[0010] Another object of the present invention is to provide an application of Iris sanguinea NCED3 protein in promoting tillering of plants.
[0011] The object of the present invention will be achieved by the following technical solutions:
[0012] Provide an Iris sanguinea NCED3 protein, characterized in that it has the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing.
[0013] Provide a gene encoding Iris sanguinea NCED3 protein, characterized in that it has the amino acid sequence shown in SEQ ID NO.2 in the sequence listing.
[0014] Provide a biological material related to the Iris sanguinea NCED3 protein, characterized in that it includes any one of the following (A1) to (A5):
[0015] (A1) A recombinant cloning vector containing the gene encoding Iris sanguinea NCED3 protein;
[0016] (A2) A recombinant plant overexpression vector containing the gene encoding Iris sanguinea NCED3 protein;
[0017] (A3) A recombinant plant overexpression vector obtained by connecting a tag to the N-terminus and / or C-terminus of the gene described in (A2);
[0018] (A4) A bioengineered bacterium containing the recombinant plant overexpression vector described in (A2) or (A3);
[0019] (A5) A transgenic plant containing the recombinant plant overexpression vector described in (A2) or (A3).
[0020] The plant overexpression vector containing the gene encoding the above-mentioned Iris sanguinea NCED3 protein as described in (A2) and / or (A3) refers to a DNA that can overexpress the above-mentioned Iris sanguinea NCED3 protein in a host cell. This DNA may not only contain a promoter that initiates the transcription of the NCED3 gene but also contain a terminator that terminates the transcription of the NCED3 gene.
[0021] The plant expression vector described above is pCAMBIA1300-GFP.
[0022] The bioengineered bacterium described above is Agrobacterium tumefaciens EHA105 (Vidi, China).
[0023] The application of the Iris sanguinea NCED3 protein in promoting tillering of plants;
[0024] A method for regulating plant tillering, comprising the following steps:
[0025] (B1) Introducing the recombinant plant overexpression vector containing the Iris sanguinea NCED3 gene into a recipient plant;
[0026] The method for introducing the plant expression vector into a recipient plant is characterized in that:
[0027] The plant expression vector containing the Iris sanguinea NCED3 gene is used to transform plant tissues by the floral dip method, and the transformed plant tissues are cultivated into plants.
[0028] According to the technical solution of the invention, the recipient plant is a monocotyledonous plant or a dicotyledonous plant, preferably Iris sanguinea or Arabidopsis thaliana.
[0029] The present invention has the following beneficial effects:
[0030] (1) The present invention cloned the NCED3 gene from the flower buds of Iris sanguinea, constructed the GV1300-NCED3-GFP plant expression vector, transformed Agrobacterium tumefaciens EHA105 (Vidi, China) by the freeze-thaw method, and transformed the GV1300-NCED3-GFP plant expression vector into Arabidopsis thaliana by the floral dip method. The results showed that the overexpression of the NCED3 gene in Arabidopsis thaliana increased the tillering of Arabidopsis thaliana plants.
[0031] (2) The tillering of the transgenic Arabidopsis thaliana plants indicates that the Iris sanguinea NCED3 gene has the function of promoting plant tillering. Description of the Drawings
[0032] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for the embodiments will be briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings.
[0033] Figure 1 Shown is the PCR identification electrophoresis map of Iris sanguinea NCED3 gene Arabidopsis thaliana in the present invention, where M is DL2000 Maker, 1 - 2 are wild-type Arabidopsis thaliana, 3 is the GV1300-NCED3-GFP recombinant plasmid, and 4 - 10 are transgenic Arabidopsis thaliana lines.
[0034] Figure 2 Shown is the comparison chart of tillering phenotypes of IsNCED3 transgenic Arabidopsis thaliana, where WT is wild-type Arabidopsis thaliana, EV is transgenic Arabidopsis thaliana with empty vector, and OE is transgenic Arabidopsis thaliana. Specific Embodiments
[0035] The present invention will be further described in detail below in conjunction with embodiments and the accompanying drawings. However, it should be understood that the protection scope of the present invention is not limited by the specific embodiments. The experimental methods in the following implementation methods are all conventional methods. The materials, reagents, etc. used in the embodiments can be obtained from commercial channels without special instructions.
[0036] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an application of Iris sanguinea NCED3 protein in promoting tillering of plants.
[0037] The preparation methods of relevant culture media in the embodiments are as follows:
[0038] LB liquid medium: 5 g / L yeast extract + 10 g / L tryptone + 10 g / L sodium chloride;
[0039] LB solid medium: 5 g / L yeast extract + 10 g / L tryptone + 10 g / L sodium chloride + 15 g / L agar;
[0040] YEP liquid medium: 10 g / L yeast extract + 10 g / L tryptone + 5 g / L sodium chloride;
[0041] YEP solid medium: 10 g / L yeast extract + 10 g / L tryptone + 5 g / L sodium chloride + 15 g / L agar;
[0042] 1 / 2MS solid medium: 2.47 g / L 1 / 2MS + 20 g / L sucrose + 7.8 g / L agar.
[0043] The specific test scheme of this embodiment is as follows:
[0044] Example 1: Cloning of the Iris sanguinea NCED3 gene
[0045] I. Extraction of total plant RNA
[0046] The total plant RNA was extracted using the OminiPlant RNAKit (Dnase I) (ComWin Biotech, China) kit, and the operation steps were carried out according to the instructions.
[0047] II. cDNA synthesis
[0048] cDNA was synthesized using the PrimeScript TM RT reagent Kit with gDNA Eraser (Perfect RealTime) (Takara, Japan) kit. The operation steps were carried out according to the instructions. After diluting the cDNA 10-fold, it was used as the template for gene cloning.
[0049] III. Gene cloning
[0050] Specific primers for cloning the Iris sanguinea NCED3 gene were designed using Primer 5, and the primer sequences are as follows:
[0051] NCED3-F1: 5’-CTCCTCATCCTTCTCGCATTCCTT-3’
[0052] NCED3-R1: 5’-CGGGGACCTCAGCAGCATATC-3’
[0053] A 50 μL PCR reaction system was prepared, including 2 μL of template cDNA, 25 μL of 2×PCR buffer for KODFX, 10 μL of 2 mM dNTPs, 1 μL of each upstream and downstream primer, 1 μL of KOD FX, and 10 μL of ddH2O. The above reaction solution was prepared on ice. After mixing the reaction solution evenly, low-speed centrifugation (2500 rpm) was carried out.
[0054] The PCR reaction program was: 95°C for 5 min; 95°C for 30 s, 59°C for 45 s, 72°C for 90 s, with 35 cycles; 72°C for 10 min.
[0055] After PCR amplification, an amplification product was obtained. The amplification result was detected by 1% agarose gel electrophoresis, and the target band was recovered by gel extraction. Then, the recovered product was ligated to the cloning vector pEASY-Blunt Zero Cloning Vector (TransGen Biotech, China), transformed into Escherichia coli TOP10 (TIANGEN, China), and spread on LB solid medium containing 100 mg / L Amp resistance. It was cultured upside down in an incubator at 37 °C for 10 - 12 h. Single clone strains were picked for colony PCR identification. The positive clones were cultured in 10 mL of LB liquid medium containing 100 mg / L Amp resistance for expansion, and then sent to a biological company for sequencing.
[0056] The nucleotide sequence of the Iris sanguinea NCED3 gene is shown as follows:
[0057]
[0058] The ORF region of the Iris sanguinea NCED3 gene contains 1,680 bases and encodes 559 amino acids. The amino acid sequence is shown as follows:
[0059]
[0060] Example 2 Construction of the plant overexpression vector of the Iris sanguinea NCED3 gene
[0061] (1) Using the method of homologous recombination, vector homologous arm primers with Sal I and BamH I restriction sites were designed, and the plasmid of the cloning vector ligated with the Iris sanguinea NCED3 gene was used as a template for PCR amplification. The PCR reaction system and reaction program were the same as those for gene cloning. After PCR, the target fragment was recovered by gel extraction. The sequences of the vector homologous arm primers (the underlined parts are Sal I and BamH I restriction sites) are as follows:
[0062] NCED3-F2: 5’- TTGATACATATGCCCGTCGAC ATGATTCGCTCTTCTTATTCCTCT-3’
[0063] NCED3-R2: 5’- CCCTTGCTCACCATGGATCC TGCCTGCGTCTCCAAATC-3’
[0064] (2) Digest the expression vector GV1300-GFP plasmid with Sal I and BamH I restriction endonucleases, recover the vector fragment, ligate the linearized vector with the NCED3 gene fragment added with vector homologous arms, transform the competent Escherichia coli DH5α and coat it on LB solid containing 100 mg / L Amp resistance, incubate it upside down in a 37 °C incubator for 10 - 12 h, pick monoclonal strains for colony PCR identification, expand the positive clones in 10 mL of LB liquid medium containing 100 mg / L Amp resistance, and then send them to a biological company for sequencing. The vector construction uses the ClonExpress II One Step Cloning Kit (Vazyme, China) homologous recombination kit and is carried out according to the instructions.
[0065] Example 3 Application of Iris sanguinea NCED3 gene in tiller regulation
[0066] I. Cultivation of Arabidopsis thaliana
[0067] In a laminar flow hood, place an appropriate amount of Arabidopsis thaliana transformed with empty vector and wild-type Arabidopsis thaliana seeds (Columbia type Col-0) in a 1.5 mL centrifuge tube, disinfect with 75% alcohol for 1 min, rinse 3 times with sterile water, add 0.8% sodium hypochlorite solution (Xilong) to disinfect for 10 min, and rinse 5 times with sterile water. Inoculate the disinfected wild-type Arabidopsis thaliana seeds on 1 / 2 MS solid medium, vernalize them at 4 °C in the dark for 2 - 3 d, and then place them in a plant culture room for cultivation. After 7 - 9 d, transplant the germinated Arabidopsis thaliana seedlings into flower pots filled with cultivation substrate (peat soil: vermiculite: perlite mixed at 5:3:2 and sterilized by high temperature and high pressure), and place them in the plant culture room for continued cultivation for 3 weeks. When the Arabidopsis thaliana bolts and produces more flower buds, prepare for genetic transformation. The environmental conditions of the plant culture room are: 16 h light / 8 h dark, 20 - 22 °C.
[0068] II. Preparation of infection bacterial liquid
[0069] Transform the competent Agrobacterium tumefaciens EHA105 (Vidi, China), and refer to the instructions for the transformation steps. Then coat it on YEP solid medium containing 50 mg / L Kana and 25 mg / L Rif, and incubate it upside down at 28 °C for 36 h; pick monoclonal strains for colony PCR verification, expand the positive colonies containing the target gene in 10 mL of YEP (or LB) liquid medium containing Kana, and the culture conditions are 28 °C, shaking culture at 180 rpm for 12 - 16 h; pipette 1 ml of the cultured bacterial liquid and add it to 50 mL of fresh YEP (or LB) liquid medium containing the corresponding antibiotics, and continue shaking culture until OD 600Approximately 0.6 - 0.8; Centrifuge the cultured bacterial liquid at 5000 rpm for 5 min, discard the supernatant and collect the bacterial cells in a laminar flow hood, resuspend the bacterial cells with an equal volume (50 mL) of infection solution (pH 5.8) containing 5% sucrose and 3% silwet-77, and wait to infect Arabidopsis thaliana.
[0070] III. Infection of Arabidopsis thaliana
[0071] Take the wild-type Arabidopsis thaliana plants to be transformed, and remove the already opened flowers based on the standard that the flower buds show white tips. Immerse the flower stalks of the Arabidopsis thaliana to be transformed in the infection solution for 1 min, then cover them with an opaque black plastic bag for 24 h and then uncover, and culture them in a plant culture room. At the same time, set the wild-type Arabidopsis thaliana without Agrobacterium infection as a negative control. Extract the DNA of the transgenic Arabidopsis thaliana plants, and perform PCR identification using the homologous arm primers of the NCED3 gene to obtain transgenic positive Arabidopsis thaliana plants.
[0072] IV. Identification of Transgenic Positive Arabidopsis thaliana Plants
[0073] Extract the DNA of the 7 obtained transgenic Arabidopsis thaliana plants, and perform PCR identification using the homologous arm primers (NCED3-F2 and NCED3-R2). The wild-type Arabidopsis thaliana is used as a negative control, and the GV1300-NCED3-GFP recombinant plasmid is used as a positive control. As a result, 7 transgenic Arabidopsis thaliana lines contain the target bands, indicating that the NCED3 gene has been successfully inserted into the genomes of 7 Arabidopsis thaliana plants containing the target fragment ( Figure 1 ).
[0074] V. Observation of the Tillering Phenotype of Transgenic Positive Arabidopsis thaliana Plants
[0075] Through comparative observation of the tillering of Arabidopsis thaliana plants transformed with empty vectors, wild-type Arabidopsis thaliana, and transgenic Arabidopsis thaliana plants ( Figure 2 ), neither the wild-type Arabidopsis thaliana nor the Arabidopsis thaliana transformed with the empty vector showed a tillering phenotype, while the Arabidopsis thaliana plants overexpressing the IsNCED3 gene significantly induced the occurrence of tillering. The tillering numbers of 3 independent transgenic lines were 2, 3, and 4 respectively, showing a significant increase compared with the control group. This result indicates that the overexpression of the IsNCED3 gene in Arabidopsis thaliana can effectively promote the formation and growth of tillers.
Claims
1. A Iris sanguinea NCED3 protein, whose gene sequence is shown in SEQ ID NO.
1.
2. The gene encoding the Iris sanguinea NCED3 protein as claimed in claim 1, characterized in that, The amino acid sequence is shown in SEQ ID NO.
2.
3. A biological material related to the Iris sanguinea NCED3 protein according to claim 1, characterized in that, It includes any one of the following (A1) to (A2): (A1) A recombinant plant overexpression vector containing the gene encoding the Iris sanguinea NCED3 protein; (A2) A bioengineered bacterium containing the recombinant plant overexpression vector described in (A1).
4. The biological material related to the Iris sanguinea NCED3 protein according to claim 3, wherein: The plant expression vector is pCAMBIA1300-GFP.
5. The biological material related to the Iris sanguinea NCED3 protein according to claim 3, wherein: The bioengineered bacterium is Agrobacterium tumefaciens EHA105.
6. The application of the biological material related to the Iris sanguinea NCED3 protein according to any one of claims 3 to 5 in promoting tillering of plants, wherein, A recombinant plant overexpression vector containing the gene encoding the Iris sanguinea NCED3 protein is introduced into Arabidopsis thaliana.
7. The application according to claim 6, characterized in that, The plant tissue is transformed by using Agrobacterium-mediated transformation, and the transformed plant tissue is cultivated into a plant.