Recombinant humanized type a xvii collagen and its construction and use

Abstract

The application relates to a recombinant humanized type XVII collagen of type A and construction and application thereof, and an amino acid sequence as shown in SEQ No. 1. Not only having hair follicle repair and hair regeneration but also having good biological activities such as cell proliferation and cell adhesion, the recombinant type XVII collagen of type A can be widely applied to the fields of medicine, medical devices, biological materials, tissue engineering, cosmetics and the like. The gene sequence of the recombinant type XVII collagen of type A is 100% same with the corresponding part of the gene sequence of human type XVII collagen, therefore, has good hydrophilicity and high activity, so that the recombinant type XVII collagen of type A has application potential in the fields of biomedical materials, beauty cosmetics and skin care products and the like.

Description

TECHNICAL FIELD

[0001] The present disclosure relates to the field of bioengineering, in particular to a recombinant humanized type A type XVII collagen strain and a construction method and application thereof. BACKGROUND

[0002] Type XVII collagen (COL17A1) is a transmembrane glycoprotein, with its N-terminal in the cytoplasm and C-terminal in the extracellular matrix, forming a hemidesmosome structure and playing a role of "double-sided adhesive". This structure needs to maintain the connection between the epidermis and the dermis, stem cell anchoring and other functions, resulting in a higher synthesis difficulty than traditional collagen. Type XVII collagen is composed of 1497 amino acids, including complex functional regions such as triple helix, trimer, and transmembrane domain. As a key driver factor for epidermal stem cell competition, type XVII collagen realizes "root anti-aging" by activating COL1 and COL3 neogenesis, maintains hair follicle stem cell activity, and delays hair follicle miniaturization, which may overturn the traditional minoxidil treatment scheme. The technical breakthrough of recombinant type XVII collagen marks the paradigm shift from traditional animal extraction to precise biological manufacturing. Its technical barriers are concentrated in complex structure expression, large-scale production process and clinical transformation verification, and in the future, it will give birth to a new generation of biomaterials in the fields of anti-aging, hair growth, and skin repair.

[0003] Unlike type I and type III collagen, type XVII collagen cannot be mass-produced by animal extraction because of its extremely low content (less than 1% of the total collagen content of mammals) and non-extracellular secretion protein, and must rely on recombinant technology. The existing technology cannot synthesize full-length and functionally complete molecules, and usually needs to express key functional domains by gene recombination technology. SUMMARY

[0004] To solve the above problems, the present application provides a recombinant type A humanized type XVII collagen strain construction method and its application.

[0005] In one aspect of the present application, a recombinant type A humanized type XVII collagen is provided, and the amino acid sequence of the recombinant type A humanized type XVII collagen is shown in SEQ No. 1.

[0006] In another aspect of the present application, a nucleotide sequence encoding the recombinant type A humanized type XVII collagen is provided, and the nucleotide sequence is shown in SEQ No. 2.

[0007] In another aspect of the present application, a nucleic acid molecule is also provided, which comprises the above-mentioned nucleotide monomer obtained by encoding.

[0008] In another aspect of the present application, a vector is also provided, which comprises the above-mentioned nucleic acid molecule.

[0009] Another aspect of the present application provides a host cell comprising the recombinant humanized type A collagen XVII or the nucleic acid molecule or the vector.

[0010] Preferably, the host cell is a prokaryotic cell or a eukaryotic cell.

[0011] Preferably, the eukaryotic cell is Pichia pastoris.

[0012] Another aspect of the present application provides a method for constructing a recombinant humanized type A collagen XVII, comprising the following steps:

[0013] (1) encoding a nucleotide sequence as shown in SEQ No. 2 in a host cell to obtain a recombinant plasmid encoding a recombinant humanized type A collagen XVII;

[0014] (2) expressing the recombinant humanized type A collagen XVII based on the host cell to obtain a corresponding genetically engineered bacterium;

[0015] (3) fermenting and culturing the genetically engineered bacterium to realize the induced expression of the recombinant humanized type A collagen XVII to obtain a fermentation broth containing the recombinant humanized type A collagen XVII;

[0016] (4) centrifuging, ion exchange column, and ultrafiltration liquid change on the fermentation broth to obtain a recombinant humanized type A collagen XVII solution;

[0017] (5) freeze-drying the recombinant humanized type A collagen XVII solution by a freeze-drying machine to obtain a recombinant humanized type A collagen XVII strain in a freeze-dried powder state.

[0018] Another aspect of the present application provides a recombinant humanized type A collagen XVII, or a recombinant humanized type A collagen XVII obtained by the above-mentioned encoding nucleotide sequence, or a nucleotide monomer contained in the above-mentioned nucleic acid molecule, or a recombinant humanized type A collagen XVII produced by the above-mentioned host cell, and application thereof in the preparation of medicines, foods, cosmetics, health products, and medical devices.

[0019] Technical effects of the present application:

[0020] The present application overcomes the defects in the preparation of recombinant type A collagen XVII in the prior art and provides a large-scale, simple, and low-cost preparation of recombinant type A collagen XVII.

[0021] The application has not only hair follicle repair and hair regeneration but also good cell proliferation, cell adhesion and other biological activities, and can be widely applied in the fields of medicine, medical devices, biological materials, tissue engineering, cosmetics and the like. The recombinant type A XVII collagen gene sequence is 100% identical to the corresponding part of the recombinant type A XVII collagen gene sequence, and therefore has good hydrophilicity and high activity, so that it has application potential in the fields of biomedical materials, beauty and cosmetic products and skin care products.

[0022] Other features and aspects of the present disclosure will become apparent from the following detailed description of exemplary embodiments with reference to the drawings. BRIEF DESCRIPTION OF DRAWINGS

[0023] The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate exemplary embodiments, features, and aspects of the present disclosure and serve to explain the principles of the present disclosure.

[0024] Figure 1 It is a schematic diagram of recombinant type A XVII collagen expression plasmid construction;

[0025] Figure 2 It is a genomic sequencing diagram of expression strain COL III-XVII (placed horizontally);

[0026] Figure 3 It is a schematic diagram of SDS-PAGE running gel of fermentation product of expression strain COL III-XVII;

[0027] Figure 4 It is a schematic diagram of relative proliferation rate (100%) of HFSC cells;

[0028] Figure 5 It is a schematic diagram of relative proliferation rate (100%) of HSF cells;

[0029] Figure 6 It is a schematic diagram of relative adhesion rate (100%) of HSF cells;

[0030] Figure 7 It is a schematic diagram of relative adhesion rate (100%) of HFSC cells. DETAILED DESCRIPTION

[0031] Various exemplary embodiments, features and aspects of the present disclosure will be explained in detail below with reference to the accompanying drawings. The same reference numbers in the drawings indicate functionally similar or identical elements. Although various aspects of the embodiments are shown in the drawings, the drawings are not necessarily drawn to scale unless specifically indicated.

[0032] The word "exemplary" is used herein in the sense of being an example, instance, or illustration. Any implementation described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other implementations.

[0033] In addition, for a better understanding of the present disclosure, numerous specific details are given in the following detailed description. It will be understood by those skilled in the art that the present disclosure can be practiced without certain specific details. In some instances, well-known means, elements and circuits are not described in detail in order to emphasize the principles of the present disclosure.

[0034] The present application provides a recombinant collagen XVII type A, which is selected from a high activity and high expression site of collagen XVII, and contains at least 72 (preferably 171) amino acid sequences and is repeated three times. Preferably, the recombinant collagen XVII type A of the present application has an amino acid sequence as shown in SEQ No. 1. The screening method thereof will be described in the following examples.

[0035] In another aspect, the present application also provides a Pichia pastoris expression strain containing a gene capable of efficiently secreting and expressing a recombinant human collagen, and the amino acid sequence of the recombinant collagen XVII type A is as shown in SEQ No. 1.

[0036] Preferably, the gene of the recombinant collagen XVII type A of the present application is a codon-optimized nucleotide sequence, and the codon-optimized nucleotide sequence is as shown in SEQ No. 2.

[0037] In another aspect, the present application also provides a method for preparing the Pichia pastoris expression strain, which comprises the following steps:

[0038] 1) cloning the gene sequence shown in SEQ No. 2 into a eukaryotic expression vector to obtain a recombinant plasmid containing a gene encoding the recombinant collagen XVII type A;

[0039] 2) transfecting the recombinant plasmid into Pichia pastoris cells to obtain a Pichia pastoris expression strain;

[0040] 3) culturing and high-copy screening the Pichia pastoris expression strain of step 2) to obtain an expression strain COLIII-XVII capable of efficiently secreting and expressing the recombinant collagen XVII type A;

[0041] The eukaryotic expression vector of the present application is pPIC9K.

[0042] In another aspect, the present application also provides a method for preparing the recombinant collagen XVII type A using the Pichia pastoris expression strain, which comprises the following steps:

[0043] The recombinant collagen XVII type A is expressed by the host cell, and then separated and purified.

[0044] In still another aspect, the present application also provides the use of the recombinant collagen type A XVII in the field of medicine, cosmetics, and medical devices.

[0045] The application embodiments will be described in detail below.

[0046] Example 1: Construction of Pichia pastoris expression system containing recombinant collagen type A XVII

[0047] Taking pPIC9K (purchased from Invitrogen Company) as the backbone, the optimized gene sequence was introduced into the multiple cloning site, respectively, to obtain pPIC9K-COL III-XVII, which was finally transformed into Pichia pastoris GS115. The detailed steps are as follows:

[0048] 1. According to the mature peptide sequence of human collagen type XVII published by the protein resource database UniProt (website https: / / www.uniprot.org / ), a high-activity sequence was selected and repeated three times to obtain the optimized human collagen type XVII amino acid sequence as shown in SEQ No. 1;

[0049] 2. The online design tool Jcat (http: / / www.jcat.de / ) was used to design the gene sequence in reverse. The preferred codons required for the expression of the host Pichia pastoris were selected, and the Xhol and NotI enzyme digestion sites were removed in the design process. The optimized COL III-XVII gene was synthesized by Jinsuirui Biotechnology Co., Ltd., and the optimized gene sequence is shown in SEQ No. 2:

[0050] Construction of recombinant strain: the target gene shown in SEQ No. 2 was introduced into the Xhol and NotI double enzyme digestion sites, and inserted into the expression vector pPIC9K (pPIC9K-COL III-XVII) to obtain a recombinant plasmid (schematic diagram see Figure 1 ), the linearized recombinant plasmid was respectively electroporated into Pichia pastoris GS115, and identified by colony PCR and sent to Beijing Qikexin Biotechnology Co., Ltd. for sequencing (schematic diagram see Figure 2 , wherein SEQ No. 3: ATTGTTTATAAATACTACTATTGCC; SEQ No. 4: TTCTCGTAAGTGCCCAACTTGAACT), the base sequences of primers F and R are shown in SEQ No. 3 and SEQ No. 4.

[0051] Example 2: Screening of Pichia pastoris expression bacteria containing recombinant collagen type A XVII

[0052] The recombinants were coated on YPD solid plates containing G418 at concentrations of 0.5 mg / ml, 1 mg / ml, 2 mg / ml and 4 mg / ml, respectively, and incubated in a 30°C incubator for 2-3 days, and the growth state of the recombinants was observed.

[0053] Example 3: Preliminary expression of Pichia pastoris expression bacteria containing recombinant collagen type A XVII

[0054] The identified positive strains (1#, 2#, 3#) were inoculated into conical flasks containing 10 ml of BMGY, and incubated at 30°C and 220 r / min overnight until OD600=2-6 (logarithmic growth, about 16-18 h). The cells were collected by centrifugation at 5000 r / min for 5 min at room temperature, and the supernatant was removed. The cells were resuspended in 10 ml of BMMY, and induced for expression. 1 ml of the culture medium was sampled every 24 h, and methanol was added to a final concentration of 0.5% for continued induction. The samples at time points of 0, 24, 48, 72 and 96 h were centrifuged at 10000 r / min for 2 min to collect the supernatant, which was subjected to 96 h SDS-PAGE to verify the expression (schematic diagram shown in Figure 3 Compared with the empty pPIC9K, the experimental group showed a protein size consistent with the theory.

[0055] Example 4: Purification of recombinant collagen type A XVII

[0056] The fermentation broth of the 2# strain in Example 3 was centrifuged to collect the supernatant. The supernatant was filtered through a filter membrane, and then subjected to gel column chromatography for separation and purification. The finished product was obtained by freeze-drying. The specific purification steps of the human recombinant collagen protein are as follows: The fermentation broth was centrifuged at 4200 rpm for 30 min to collect the supernatant. The supernatant was concentrated and washed by ultrafiltration membrane to remove salt and pigment. An appropriate amount of the collagen protein solution was subjected to SP resin column chromatography for separation and purification. The eluate containing collagen protein was collected, washed, desalted and concentrated by ultrafiltration membrane. The target protein was collected by freeze-drying.

[0057] Example 5: Relative proliferation rate of recombinant collagen type A XVII

[0058] HSF cells (human skin fibroblasts) and HSFC cells (rat hair follicle stem cells) in the logarithmic growth phase were inoculated in 96-well plates at a density of 1 x 105 / mL, 100 μL per well, and divided into a control group and an experimental group. They were placed in a carbon dioxide cell culture box and cultured at 37°C and 5% CO2 for 24 hours. The recombinant type A collagen XVII sample solution obtained in Example 4 was prepared with serum-free culture solution at a concentration of 0.5 mg / ml, and the solution was filtered with a 0.22 μm filter to remove bacteria. Commercial BSA was also configured at a concentration of 0.5 mg / ml, and the solution was filtered with a 0.22 μm filter to remove bacteria. Figure 4 / 5) within the selected concentration range, had a certain cell proliferation ability and no cytotoxicity. Compared with the control group and BSA, the addition of recombinant type A collagen XVII (referred to as 17_8 in the figure) could significantly promote HSF cell and HSFC cell proliferation.

[0059] Example 6, Adhesion Experiment of Recombinant Type A Collagen XVII

[0060] HSF cells (human skin fibroblasts) and HSFC cells (rat hair follicle stem cells) in the logarithmic growth phase were inoculated in 96-well plates at a density of 1 x 105 / mL, 100 μL per well, and divided into a control group and an experimental group. They were placed in a carbon dioxide cell culture box and cultured at 37°C and 5% CO2 for 24 hours. The recombinant type A collagen XVII sample solution obtained in Example 4 was prepared with serum-free culture solution at a concentration of 0.5 mg / ml, and the solution was filtered with a 0.22 μm filter to remove bacteria. Commercial BSA was also configured at a concentration of 0.5 mg / ml, and the solution was filtered with a 0.22 μm filter to remove bacteria.

[0061] After HSF cells, HSFC cells were routinely cultured for 24 h, the old culture solution was discarded, 100 μL of serum-free culture solution or 100 μL of commercial protein BSA solution was added, the control group was added with equal amount of serum-free culture solution, and the experimental group was added with 100 μL of recombinant type A collagen XVII sample solution, 3 parallel samples in each group. After 24 h of continuous culture, the culture solution was discarded, 100 μL of CCK-8 (purchased from Shengong Bioengineering (Shanghai) Co., Ltd.) diluted 10 times with serum-free culture solution was added to each well, and the cell culture box was placed in the incubator for 2 h. The absorbance was measured at 450 nm wavelength by using an enzyme-labeled instrument. Thus, the relative cell adhesion rate (schematic diagram is shown in Figure 6 / 7, compared with the control group and BSA, the addition of recombinant type A collagen XVII (referred to as 17_8 in the figure) can obviously promote cell adhesion of HSF cells and HSFC cells. The cell adhesion rate can reflect the activity of the collagen. The higher the activity of the protein, the better the external environment provided for the cells in a short time, and the better the cell adhesion. The cell adhesion rate can reflect the activity of the collagen. Taking the adhesion rate of the blank group as 1, the relative cell adhesion activity of the recombinant type A collagen XVII can be calculated.

[0062] From the above cell relative proliferation and cell relative adhesion experiments, it can be seen that the recombinant type A collagen XVII of the present application not only has the ability to promote skin fibroblast proliferation, but also has the ability to promote rat hair follicle stem cell proliferation. Therefore, the recombinant type A collagen XVII of the present application has great potential application in skin care and hair growth.

[0063] The above is only a general description and implementation method of the present application, and does not limit the patent protection scope of the present application. Any equivalent changes made according to the description and drawings of the present application, or direct or indirect use of the present application patent to other related technical fields, are considered to be within the protection scope of the present application patent.

[0064] The choice of terms used in this paper is intended to best explain the principles, practical applications or technical improvements in the market of each embodiment, or to enable other ordinary skilled persons in the art to understand each embodiment disclosed herein.

Claims

1. A recombinant humanized collagen type XVII of type A, characterized in that, The amino acid sequence of the recombinant humanized type A type XVII collagen is shown as SEQ No.

1.

2. A gene encoding the recombinant humanized collagen type XVII according to claim 1, characterized in that, The nucleotide sequence of the gene is shown as SEQ No.

2.

3. A vector, characterized in that, The vector comprises the gene of claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant humanized type A type XVII collagen of claim 1 or the gene of claim 2 or the vector of claim 3.

5. The host cell of claim 4, wherein, The host cell is a prokaryotic cell or a eukaryotic cell.

6. The host cell of claim 5, wherein, The eukaryotic cell is Pichia pastoris.

7. The method of constructing the recombinant humanized collagen type XVII according to claim 1, wherein, The method comprises the following steps: (1) constructing a recombinant plasmid comprising the nucleotide sequence shown as SEQ No. 2; (2) transforming the recombinant plasmid into a host cell to construct a genetically engineered bacterium for expressing the recombinant humanized type A type XVII collagen; (3) performing fermentation culture on the genetically engineered bacterium to realize the induced expression of the recombinant humanized type A type XVII collagen, and obtaining a fermentation broth containing the recombinant humanized type A type XVII collagen; (4) subjecting the fermentation broth to centrifugation, ion exchange column chromatography, ultrafiltration concentration and washing to obtain a recombinant humanized type A type XVII collagen solution; (5) performing freeze-drying on the recombinant humanized type A type XVII collagen solution by using a freeze-drying machine to obtain a recombinant humanized type A type XVII collagen in a freeze-dried powder state.

8. Use of the recombinant humanized type A type XVII collagen of claim 1 or the gene of claim 2 in the preparation of biomedical materials, food, cosmetics or medical devices.

9. Use according to claim 8, characterized in that, The food comprises health products.

Images