Directional degradation system as well as screening method and application thereof

Abstract

The invention provides a targeted degradation system constructed by the multispecific fusion protein containing the p62 nano antibody, a method for screening the fusion protein, and a method and application for targeted degradation of a target protein by using the fusion protein.

Description

Technical Field

[0001] The present invention relates to a targeted degradation system constructed by a multi-specific fusion protein comprising a p62 nanobody, a method for screening the fusion protein, and a method and application for using the fusion protein to target and degrade a target protein. Background Art

[0002] In the past few decades, great breakthroughs have been made in the discovery of drug targets, and new targets are discovered every year. However, about 62% of these target proteins closely related to diseases are undruggable or difficult to drug, mainly because most of these protein molecules have a large number of disordered structures, resulting in the inability to resolve three-dimensional crystals for drug development, or the lack of suitable protein-ligand interaction regions (for example, the lack of a clear hydrophobic pocket), making it a huge challenge to design specific targeted drugs against them.

[0003] Targeted-protein degradation (TPD), represented by PROTAC, is considered one of the technologies most likely to achieve breakthroughs for these undruggable targets. PROTACs are bifunctional molecules obtained by connecting ligands of the protein of interest (POI) and E3 ligase through various linkers. In studies using PROTACs, it has been found that the mechanism of targeted degradation lies in bringing the POI and E3 ligase into physical proximity through two targeting moieties, thereby triggering the E3 ligase to polyubiquitinate the POI. This proximity can be transient and does not require the ligand molecules serving as PROTAC targeting moieties to have the property of directly inhibiting the activity of the POI or being able to maintain a long-term and high-intensity binding to the POI. Therefore, many small molecule compounds that failed in the development as target inhibitors and E3 ligase inhibitors can also be reused for the development of PROTAC molecules (see the literature Liu, Z et al., An overview of PROTACs: a promising drug discovery paradigm. Mol Biomed 3, 46 (2022)). Peptide molecules (such as peptide substrate-binding motifs of the POI and / or E3 ligase, or antibodies against the POI and / or E3 ligase) can also specifically target the POI and E3 ligase, but they are clearly not considered good choices as PROTAC targeting moieties. So far, all PROTACs in the clinical stage use only small molecules rather than peptide ligands. One reason may be that the success rate of constructing PROTACs using peptide ligands as targeting moieties is extremely low. For example, S Matsuzawa et al. (Method for targeting protein destruction by using a ubiquitin-independent, proteasome-mediated degradation pathway. PNAS (2005), vol. 102, no. 42, 14982-14987) reported that dozens of chimeric peptides combinatorially assembled from 12 different POI-binding motifs and 7 different E3 ligase-binding motifs were all unable to degrade the target protein.On the other hand, the use of peptide components will inevitably affect pharmacokinetics (such as difficulty in crossing membranes and oral administration). In this regard, when the PROTAC concept first emerged, it was clearly pointed out that the ultimate goal of developing such bifunctional molecules is to identify small molecules that can replace the E3-targeting activity of peptide motifs (K M Sakamoto et al., Protacs: Chimeric molecules that target proteins to the Skp1–Cullin–F box complex for ubiquitination and degradation. Proc Natl Acad Sci U S A. 2001 Jul 17;98(15):8554-8559).

[0004] In addition, the use of bispecific antibodies as bifunctional molecules for targeted degradation has also been reported, mainly including the AbTAC technology that simultaneously has specificity for targeting the cell membrane surface E3 ligase RNF43 and specificity for targeting cell membrane surface proteins (see CN114867752A), the PROTAB technology that simultaneously has specificity for targeting the cell membrane surface E3 ligase RNF43 or ZNRF3 and specificity for targeting cell membrane surface proteins (see CN116761825A), and the KineTAC technology that simultaneously has specificity for targeting cell membrane surface receptors (such as CXCL12) and specificity for targeting cell membrane surface or extracellular proteins (see WO2022212593A1). The first two are still based on the design idea of the ubiquitin-proteasome pathway. After the POI and the E3 ligase are spatially close through the two arms of the bispecific antibody molecule, ubiquitination and proteasome degradation occur. The third uses the property of antibody internalization, and the POI protein bound by the bispecific antibody is degraded as it enters the endosome with internalization. It can be seen that the current bispecific antibody-based targeted degradation technology is mainly limited to using cell membrane surface E3 ligases or receptors to degrade adjacent membrane proteins or extracellular proteins. This may mainly be due to the poor membrane permeability of antibody molecules and the inability to reach an effective concentration inside cells.

[0005] In addition to the above ubiquitin-proteasome pathway, the targeted degradation technology can also be achieved through the lysosomal pathway, which is further divided into the endosome-lysosome pathway and the autophagy-lysosome pathway. Among them, the autophagy-lysosome pathway involves the autophagosome wrapping the intracellular target to be degraded, and then fusing with the lysosome to form the autolysosome. Technologies based on the autophagy-lysosome pathway include AUTAC, AUTOTAC, and ATTEC. Among them, the structure of ATTEC is similar to that of PROTAC, and it is a dual-target molecule obtained by connecting a small molecule ligand of LC3 protein and a POI ligand through a linker. The autophagy marker LC3 protein is located on the autophagosome membrane after activation and is a key factor in inducing the autophagosome to wrap the target protein and form autophagosomes. The autophagosomes are then transported to the lysosomes to achieve the degradation of the target protein (see Zhaoyang Lia et al., ATTEC: a potential new approach to target proteinopathies. AUTOPHAGY (2020), Vol. 16, No. 1, 185-187). Both of the dual-targets of AUTAC use small molecule ligands, but one of its ligands is cGMP (cysteine-S-guanine) that can trigger K63 ubiquitination. By triggering K63 ubiquitination through this small molecule, the target protein is then directed to selective autophagy (see Daiki Takahashi et al., AUTACs: Cargo-Specific Degraders Using Selective Autophagy. Molecular Cell (2019), Vol. 76, No. 5, P797-810.E10). AUTOTAC uses a peptide motif that specifically recognizes the p62 protein at one of its targets. This peptide motif not only needs to specifically recognize and bind to the p62 protein, but also be able to activate the usually inactive p62 protein and cause conformational changes. The allosteric p62 protein can self-aggregate and specifically bind to the LC3 protein, enter the autophagosomes induced by LC3, and ultimately lead to the degradation of the target protein bound by AUTOTAC.

[0006] One of the advantages of the autophagy-lysosome pathway compared to the ubiquitin-proteasome pathway is that the objects it degrades are not restricted by the pore size of the proteasome in terms of molecular size. Moreover, this pathway can degrade not only soluble proteins or membrane proteins, but also many targets including extracellular membrane proteins, protein aggregates, organelles, and non-proteins (such as lipid droplets), having a wider application scenario than the ubiquitin-proteasome pathway. However, whether considering the lack of accumulation of inhibitor ligands as rich as those of ubiquitin ligases for autophagy markers, or considering the high difficulty of developing specific ligands for intractable drug targets (especially proteins mainly composed of disordered structures) (Joshi, P., Vendruscolo, M. (2015). Druggability of Intrinsically Disordered Proteins. In: Felli, I., Pierattelli, R. (eds) Intrinsically Disordered Proteins Studied by NMR Spectroscopy. Advances in Experimental Medicine and Biology, vol 870. Springer, Cham.), it can be seen that the difficulty of constructing high-throughput libraries of such bifunctional molecules severely restricts the related drug development. In addition, the roles of LC3 protein and p62 protein in the corresponding pathways are different from those of E3 ligases. As mentioned above, PROTAC can achieve targeted degradation as long as it can bring the target protein, which is the substrate of ubiquitination, close to the E3 ligase in physical space to facilitate the occurrence of ubiquitination enzymatic reactions; while for several bifunctional molecules targeting autophagy pathway proteins, especially the AUTOTAC molecules targeting p62 protein, this is obviously not sufficient to enable them to achieve the targeted degradation function.

[0007] "Liquid-Liquid Phase Separation" (LLPS, also simply referred to as "phase separation" in this article) describes the process in which multivalent biomacromolecules aggregate through intermolecular or intramolecular interactions, thereby separating from the ordinary solution phase around the molecules and forming an independent liquid phase enriched with the macromolecules, which can also be called "phase transition". After LLPS occurs, a large number of small droplets enriched with the macromolecules can be observed inside the cell, with diameters reaching several micrometers or even larger. Such highly recognizable small droplets are called "phase transition droplets". It has been reported that activated p62 and polyubiquitinated proteins are key factors for condensing p62 bodies, and the latter plays the role of a nucleation site in selective autophagy (see Agudo-Canalejo J et al., Wetting regulates autophagy of phase-separated compartments and the cytosol. Nature. 2021 Mar; 591(7848):142-146; Turco E et al., FIP200 Claw Domain Binding to p62 Promotes Autophagosome Formation at Ubiquitin Condensates. Mol Cell. 2019 Apr 18; 74(2):330-346.e11). However, it has not been reported that for proteins that are prone to LLPS themselves (such as intrinsically disordered proteins), autophagy can be directly triggered without relying on p62 activation and / or polyubiquitination to achieve the targeted degradation of the target protein. Summary of the Invention

[0008] Through in-depth research, the inventors of the present invention found that by using a multispecific fusion protein that simultaneously has the targeting property of the autophagy receptor p62 protein and the targeting property of an intrinsically disordered protein or a protein with an intrinsically disordered region, the aggregation tendency of the intrinsically disordered protein can be utilized to promote the condensation necessary for the activation of the p62 protein, promote p62 activation, and thus allow the specifically targeted intrinsically disordered protein or the protein with an intrinsically disordered region to be degraded through the autophagy pathway, achieving the regulation of the biological activities or signaling pathways involved by the intrinsically disordered protein or the protein with an intrinsically disordered region.

[0009] Therefore, an object of the present invention is to provide a multispecific fusion protein, which comprises at least one first affinity peptide that specifically binds to the autophagy receptor p62 protein and at least one second affinity peptide that specifically binds to the target, and the first affinity peptide and the second affinity peptide are covalently linked through a linking sequence / linker. In some embodiments, the first affinity peptide and the second affinity peptide are directly linked by a covalent bond.

[0010] In some embodiments, when the multispecific fusion proteins disclosed herein coexist with p62 protein and a target, they can form a ternary complex comprising the fusion protein, the p62 protein, and the target. In some embodiments, the multispecific fusion proteins disclosed herein increase the liquid-liquid phase separation of the p62 protein compared to the situation where the fusion protein is absent. In some embodiments, the increase in liquid-liquid phase separation is selected from any one of an increase in the number of liquid-liquid phase separation droplets containing the p62 protein, an increase in the area of the liquid-liquid phase separation droplets containing the p62 protein, an increase in the degree of oligomerization of the p62 protein in the liquid-liquid phase separation droplets containing the p62 protein, or a decrease in the mobility of the p62 protein in the liquid-liquid phase separation droplets containing the p62 protein, or any combination thereof. In some embodiments, the target is an intrinsically disordered protein, or an aggregate protein, membrane complex, and / or organelle comprising an intrinsically disordered protein as a monomer or component. In some embodiments, the target is selected from cytoplasmic proteins, nuclear proteins, membrane proteins, or organelles. In some embodiments, the target is selected from TDP43, hnRNPK, G3BP1, HTT-Q103, TSPAN4, PD-L1, APP, or STAT3.

[0011] In some embodiments, the first affinity peptide and the second affinity peptide in the multispecific fusion proteins disclosed herein are each independently selected from nanobodies or synthetic binding proteins. In some embodiments, the nanobody is selected from single-domain antibodies, single-chain antibodies (scFv), minibodies, half-antibodies, or antigen-binding fragments of antibodies. In some embodiments, the synthetic binding protein is selected from monobody, affibody, anticalin, or DARPin. In a preferred embodiment, the single-domain antibody is selected from V H H domain antibodies, heavy-chain variable domain (VH) antibodies, V NAR domain antibodies, V L domain antibodies.

[0012] In some embodiments, the first affinity peptide comprises CDR1, CDR2, and CDR3 selected from any one of SEQ ID NO: 9, 11, 13, 67, or 72. In a preferred embodiment, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences shown in SEQ ID NO: 51, 52, and 53, respectively. In some other preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences shown in SEQ ID NO: 54, 55, and 56, respectively. In some other preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences shown in SEQ ID NO: 57, 58, and 59, respectively. In some other preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences shown in SEQ ID NO: 68, 69, and 70, respectively. In some other preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences shown in SEQ ID NO: 73, 74, and 75, respectively. In some embodiments, the first affinity peptide comprises the amino acid sequence shown in SEQ ID NO: 9, 11, 13, 67, or 72. In some embodiments, the first affinity peptide comprises an amino acid sequence having at least 90%, 95%, 98%, 99% identity with the amino acid sequence shown in SEQ ID NO: 9, 11, 13, 67, or 72. In some embodiments, the first affinity peptide comprises an amino acid sequence having one or several (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) deletions, substitutions, or additions compared to the amino acid sequence shown in SEQ ID NO: 9, 11, 13, 67, or 72.

[0013] In some embodiments, the second affinity peptide comprises CDR1, CDR2, and CDR3 selected from SEQ ID NO: 19 or 77. In a preferred embodiment, the second affinity peptide comprises the amino acid sequence shown in SEQ ID NO: 19 or 77. In some embodiments, the second affinity peptide comprises an amino acid sequence having at least 90%, 95%, 98%, 99% identity with the amino acid sequence shown in SEQ ID NO: 19 or 77. In some embodiments, the second affinity peptide comprises an amino acid sequence having one or several (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) deletions, substitutions, or additions compared to the amino acid sequence shown in SEQ ID NO: 19 or 77.

[0014] In some embodiments, the fusion proteins disclosed herein further comprise an oligomerization element. In some embodiments, the oligomerization element is directly covalently linked to the first affinity peptide and / or the second affinity peptide. In some embodiments, the oligomerization element is covalently linked to the first affinity peptide and / or the second affinity peptide via a linker sequence / spacer. In some embodiments, the oligomerization element is derived from the oligomerization domain of a protein capable of oligomerizing. In some embodiments, the oligomerization element is an artificially constructed coiled-coil domain. In some embodiments, the oligomerization element enables the fusion protein to form dimers to hexamers. In some embodiments, the oligomerization element is an oligomerization domain of a dimer or higher oligomer. In a preferred embodiment, the oligomerization element is an oligomerization domain of a tetramer or higher oligomer. In a more preferred embodiment, the oligomerization element is an oligomerization domain of an octamer or higher oligomer. In a most preferred embodiment, the oligomerization element is an oligomerization domain of a 12-mer or higher oligomer. In some embodiments, each fusion protein comprises one or more oligomerization elements. In a preferred embodiment, each fusion protein comprises one oligomerization element. In some embodiments, the oligomerization element comprises the amino acid sequence shown in any one of SEQ ID NOs: 60 to 62. In some embodiments, the oligomerization element comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to any one of SEQ ID NOs: 60 to 62. In some embodiments, the oligomerization element comprises an amino acid sequence having one or several deletions, substitutions, additions compared to any one of SEQ ID NOs: 60 to 62, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 deletions, substitutions or additions.

[0015] In some embodiments, the fusion proteins disclosed herein further comprise a phase separation element. In some embodiments, the phase separation element is directly covalently linked to the first affinity peptide and / or the second affinity peptide. In some embodiments, the phase separation element is covalently linked to the first affinity peptide and / or the second affinity peptide via a linker sequence / spacer. In some embodiments, each fusion protein comprises one or more phase separation elements, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the phase separation units are in series with each other. In some embodiments, the phase separation element is selected from the intrinsically disordered regions of proteins with phase separation ability, or tandemly repeated interacting domains with phase separation ability. In some embodiments, the phase separation element comprises the amino acid sequence shown in any one of SEQ ID NOs: 63 to 66. In some embodiments, the phase separation element comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any one of SEQ ID NOs: 63 to 66. In some embodiments, the phase separation element comprises an amino acid sequence having one or several deletions, substitutions, or additions compared to any one of SEQ ID NOs: 63 to 66, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deletions, substitutions, or additions.

[0016] In some embodiments, the linker sequence or spacer in the multispecific fusion proteins disclosed herein is a rigid spacer or a flexible spacer. In a preferred embodiment, the linker sequence or spacer is a flexible spacer. In a more preferred embodiment, the linker sequence or spacer is a spacer comprising the sequence shown in SEQ ID NO: 50.

[0017] In some embodiments, the multispecific fusion proteins disclosed herein comprise one first affinity peptide and one second affinity peptide. In some embodiments, the multispecific fusion proteins disclosed herein comprise one first affinity peptide and more than two identical or different second affinity peptides. In some embodiments, the multispecific fusion proteins disclosed herein comprise more than two identical or different first affinity peptides and one second affinity peptide. In some embodiments, the multispecific fusion proteins disclosed herein comprise more than two identical or different first affinity peptides and more than two identical or different second affinity peptides.

[0018] Another object of the present invention is to provide a nucleic acid comprising a nucleotide sequence encoding the multispecific fusion protein disclosed herein. In some embodiments, the coding nucleotide sequence is operably linked to a promoter.

[0019] Another object of the present invention is to provide a recombinant vector comprising the nucleic acids disclosed herein. In some embodiments, the recombinant vector is a recombinant viral vector.

[0020] Another object of the present invention is to provide an engineered cell that expresses the fusion protein, nucleic acid, or recombinant vector disclosed herein.

[0021] Another object of the present invention is to provide a method for producing the multispecific fusion protein disclosed herein, the method comprising the step of expressing the nucleic acid or recombinant vector disclosed herein in a suitable host cell, or comprising the step of culturing the engineered cell disclosed herein, and the step of purifying the fusion protein.

[0022] Another object of the present invention is to provide a composition comprising the multispecific fusion protein, nucleic acid, recombinant vector, or engineered cell disclosed herein.

[0023] Another object of the present invention is to provide a method for degrading a target in a cell, the method comprising causing a cell to express the multispecific fusion protein, nucleic acid, or recombinant vector disclosed herein, such that the amount of the target is reduced compared to the case where the fusion protein, nucleic acid, or recombinant vector is not present. In a preferred embodiment, the method disclosed herein reduces the amount of the target by at least about 30 to about 90%.

[0024] Another object of the present invention is to provide a method for preventing and / or treating a disease, the method comprising administering to a subject the multispecific fusion protein, nucleic acid, recombinant vector, engineered cell, or composition disclosed herein.

[0025] Another object of the present invention is to provide the use of the multispecific fusion protein, nucleic acid, recombinant vector, engineered cell, or composition disclosed herein in the preparation of a medicament for preventing and / or treating a disease.

[0026] In some embodiments, the disease to be prevented and / or treated is selected from diseases associated with protein misfolding, misaggregation, or misproduction. In a preferred embodiment, the disease to be prevented and / or treated is selected from neurodegenerative diseases, cardiovascular diseases, neuromuscular diseases, tumors, metabolic diseases, or autoimmune diseases. In some embodiments, the neurodegenerative disease is selected from Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis, hereditary ataxia, Vici syndrome, or BPAN syndrome. In some embodiments, the cardiovascular disease is selected from coronary artery disease, atherosclerosis, or pulmonary arterial hypertension. In some embodiments, the neuromuscular disease is selected from hereditary cardiomyopathy, distal myopathy, muscular dystrophy, congenital myopathy, spinal muscular atrophy (SMAs), motor neuron disease, Duchenne muscular dystrophy, Becker muscular dystrophy, limb-girdle muscular dystrophy, myotonic dystrophy, myotubular myopathy, central core myopathy, nemaline myopathy, selenoprotein N-related myopathy, Pompe disease, glycogen storage disease III, or amyotrophic lateral sclerosis. In some embodiments, the tumor is selected from lung cancer, colorectal cancer, head and neck cancer (e.g., head and neck squamous cell carcinoma), glioma (e.g., glioblastoma), neuroblastoma, melanoma, breast cancer, bladder cancer, kidney cancer, ovarian cancer, pancreatic cancer, cervical cancer, esophageal cancer, sarcoma, esophageal cancer (e.g., esophageal squamous cell carcinoma), thyroid cancer (e.g., papillary thyroid carcinoma), or prostate cancer, B-cell lymphoma, chronic lymphocytic leukemia (CLL), chronic myeloid leukemia, diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, myelodysplastic syndrome (MDS), non-Hodgkin lymphoma (NHL), acute lymphoblastic leukemia (ALL), acute monocytic leukemia, multiple myeloma, acute myeloid leukemia (AML), mixed lineage leukemia, NUT midline carcinoma, Burkitt lymphoma, or mycosis fungoides (MF), or metastatic forms thereof. In some embodiments, the metabolic disease is selected from hyperlipidemia, atherosclerosis, non-alcoholic fatty liver, or diabetes. In some embodiments, the autoimmune disease is selected from systemic lupus erythematosus, atopic dermatitis, myasthenia gravis, or type I diabetes.

[0027] Another object of the present invention is to provide a method for screening multi-specific fusion proteins, the method comprising the following steps: (a) obtaining one or more first affinity peptides capable of specifically binding to the autophagy receptor p62 protein, and one or more second affinity peptides capable of specifically binding to a target, and linking at least one of the first affinity peptides with at least one of the second affinity peptides to obtain a candidate fusion protein library; (b) selecting, from the library, candidate fusion proteins that significantly increase the co-localization of p62 protein and the target compared to a control in which the candidate fusion protein is absent; (c) selecting, from the candidate fusion proteins selected in step (b), fusion proteins that increase the liquid-liquid phase separation of p62 protein compared to a control in which the candidate fusion protein is absent.

[0028] In some embodiments, in step (c) of the screening method disclosed herein, the increase in liquid-liquid phase separation is selected from: an increase in the number of liquid-liquid phase separation droplets containing p62 protein, an increase in the area of the liquid-liquid phase separation droplets containing p62 protein, an increase in the degree of oligomerization of p62 protein in the liquid-liquid phase separation droplets containing p62 protein, a decrease in the mobility of p62 protein in the liquid-liquid phase separation droplets containing p62 protein, any one of them, or any combination thereof.

[0029] In some embodiments, the target of the screening method disclosed herein is an intrinsically disordered protein, or an aggregate protein, membrane complex, and / or organelle containing an intrinsically disordered protein as a monomer or component. In some embodiments, the target of the screening method disclosed herein is selected from cytoplasmic proteins, nuclear proteins, or organelles. In some embodiments, the target is selected from TDP43, hnRNPK, G3BP1, HTT-Q103, TSPAN4, PD-L1, APP, or STAT3.

[0030] In some embodiments, the screening method disclosed herein further comprises step (d): measuring the level of the target, and selecting a fusion protein in which the amount of the target is reduced compared to a control in which the candidate fusion protein is absent. In a preferred embodiment, the fusion protein selected in step (d) is a fusion protein that reduces the amount of the target by at least about 30% to about 90%.

[0031] In some embodiments, the linkage in step a is a direct covalent linkage between the first affinity peptide and the second affinity peptide. In some embodiments, the linkage in step a is a covalent linkage between the first affinity peptide and the second affinity peptide via a linking sequence or linker. In some embodiments, the linkage in step a further includes linking the first affinity peptide and / or the second affinity peptide to an oligomerization element or a phase separation element. In some embodiments, the oligomerization element or the phase separation element is covalently linked to the affinity peptide or to each other via a linking sequence or linker.

[0032] In some embodiments, the first affinity peptide and the second affinity peptide in the screening methods disclosed herein are each independently selected from nanobodies or synthetic binding proteins. In some embodiments, the nanobody is selected from single domain antibodies, single chain antibodies (scFv), minibodies, half antibodies, or antigen-binding fragments of antibodies. In a preferred embodiment, the single domain antibody is selected from V H H domain antibodies, heavy chain variable domain (VH) antibodies, V NAR domain antibodies, V L domain antibodies. In some embodiments, the synthetic binding protein is selected from monobodies, affibodies, anticalins, or DARPins.

[0033] In some embodiments, the first affinity peptide comprises CDR1, CDR2, and CDR3 selected from any one of SEQ ID NO: 9, 11, 13, 67, or 72. In a preferred embodiment, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences shown in 51, 52, and 53, respectively. In some other preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences shown in SEQ ID NO: 54, 55, and 56, respectively. In some other preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences shown in SEQ ID NO: 57, 58, and 59, respectively. In some other preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences shown in SEQ ID NO: 68, 69, and 70, respectively. In some other preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences shown in SEQ ID NO: 73, 74, and 75, respectively.

[0034] In some embodiments, the second affinity peptide comprises CDR1, CDR2, and CDR3 selected from SEQ ID NO: 19 or 77. In a preferred embodiment, the second affinity peptide has the amino acid sequence shown in SEQ ID NO: 19 or 77.

[0035] In some embodiments, the linking sequence or linker is a rigid linker or a flexible linker. In a preferred embodiment, the linking sequence or linker is a flexible linker. In a more preferred embodiment, the linking sequence or linker is a linker comprising the sequence shown in SEQ ID NO:50.

[0036] In some embodiments, the candidate fusion proteins in the library obtained in step (a) may comprise a first affinity peptide and a second affinity peptide, a first affinity peptide and two or more identical or different second affinity peptides, two or more identical or different first affinity peptides and a second affinity peptide, or two or more identical or different first affinity peptides and two or more identical or different second affinity peptides.

[0037] Another object of the present invention is to provide a fusion protein obtained by the screening method disclosed herein.

[0038] Another object of the present invention is to provide an affinity peptide disclosed herein, which comprises CDR1, CDR2 and CDR3 as described in any one of SEQ ID NO:9, 11, 13, 67 or 72. In some embodiments, CDR1, CDR2 and CDR3 of the first affinity peptide have the amino acid sequences shown in SEQ ID NO:51, 52, 53, respectively. In some other preferred embodiments, CDR1, CDR2 and CDR3 comprised by the first affinity peptide have the amino acid sequences shown in SEQ ID NO:54, 55, 56, respectively. In some other preferred embodiments, CDR1, CDR2 and CDR3 comprised by the first affinity peptide have the amino acid sequences shown in SEQ ID NO:57, 58, 59, respectively. In some other preferred embodiments, CDR1, CDR2 and CDR3 comprised by the first affinity peptide have the amino acid sequences shown in SEQ ID NO:68, 69, 70, respectively. In some other preferred embodiments, CDR1, CDR2 and CDR3 comprised by the first affinity peptide have the amino acid sequences shown in SEQ ID NO:73, 74, 75, respectively.

[0039] Another object of the present invention is to provide a nucleic acid molecule encoding the affinity peptide disclosed herein, which comprises the nucleotide sequence shown in any one of SEQ ID NO:10, 12, 14, 71 or 76.

[0040] Another object of the present invention is to provide a recombinant vector comprising the nucleic acid molecule disclosed herein, an engineered cell expressing the nanobody, nucleic acid molecule or recombinant vector disclosed herein, and a composition comprising the nanobody, nucleic acid molecule, recombinant vector or engineered cell disclosed herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1Results of detecting the interaction between p62 nanobody and p62 protein by Bio-Layer Interferometry (BLI); in the figure, the horizontal axis represents the reaction time, and the vertical axis represents the displacement distance of the interference spectrum; the black curve is the actual detection result, and the red curve is the fitting result; the binding constants (Ka), dissociation constants (Kd), and equilibrium dissociation constants (KD) of three nanobodies binding to p62 are shown in the right table;

[0042] Figure 2 Shows laser confocal microscopy live cell imaging snapshots of co-transfecting U-2OS cells with constructs of p62 nanobody (Pn) fused with mCherry fluorescent tag and constructs of p62 fused with EGFP fluorescent tag, and co-transfecting U-2OS cells with constructs of mCherry fluorescent tag alone as a control and constructs of EGFP-p62; among them, mCherry-Pn and EGFP-p62 show the fluorescence excitation images of exogenous Pn and p62 respectively, Merge is the result of in-situ superposition of the above two images and the cell nucleus (blue), and A1E, D9A, and E12C show three p62 nanobodies respectively; the scale bar in each small figure is 10 μm;

[0043] Figure 3 Is Figure 2 The co-localization statistical results obtained by Pearson co-localization analysis of the images; in the figure, the horizontal axis represents the conditions of treatment with mCherry fluorescent tag as a control or three Pns, and the vertical axis represents the Pearson co-localization coefficient calculated for the corresponding treatment conditions; the shown statistical results are the mean ± standard error of the mean of three independent experiments, and the p-value is obtained by calculating with a two-tailed t-test;

[0044] Figure 4 Shows the number of p62 droplets measured in Example 2;

[0045] Figure 5 Shows laser confocal microscopy live cell imaging snapshots of U-2OS cells transiently transfected with mCherry-Pn; among them, mCherry-Pn and p62 show the fluorescence excitation images of exogenous Pn and endogenous p62 respectively, Merge is the result of in-situ superposition of the above two images and the cell nucleus (blue), and A1E, D9A, and E12C show three p62 nanobodies respectively; the scale bar in each small figure is 10 μm; Zoomin is the enlarged figure of the white frame area, showing the live cell imaging results of co-localization analysis of the fluorescence signals representing mCherry-Pn and p62 in the spots marked by white arrows;

[0046] Figure 6 Is Figure 5Statistical results of the gray values of the fluorescence signals measured at the positions marked by the white arrows; in the figure, the horizontal axis represents the distance along the direction of the arrow on the arrow mark, and the vertical axis represents the relative fluorescence intensity measured at the corresponding positions.

[0047] Figure 7 Showing the structure of the p62 protein and the construct structure of the CoPIC method.

[0048] Figure 8 Showing the laser confocal microscopy live cell imaging snapshots of U-2OS cells co-transfected transiently with the construct of the mCherry-Pn plasmid and the p62 truncated variants fused with EGFP-NUP98N; among them, A1E, D9A, and E12C represent three kinds of Pn respectively, shown in red; ΔPB1, 103 - 330, 331 - 388, 389 - 440, 368 - 407, and 73 - 132 represent six truncated variants of p62 fused with NUP98N respectively, shown in green; the image with the scale bar is the result of in-situ superposition of the above two images and the cell nucleus (blue), and the scale bar in each small figure is 10 μm.

[0049] Figure 9 Is for Figure 8 Statistical results of the enrichment degree of the fluorescence signals of mCherry-Pn in the NUP98N puncta under each treatment condition; in the figure, the horizontal axis represents different truncated variants of p62 fused with NUP98N, and the vertical axis represents the enrichment degree of the fluorescence signals of mCherry-Pn in the NUP98N droplets; the shown statistical results are the average value ± standard error of the mean of three independent experiments.

[0050] Figure 10 Showing the schematic diagrams of three nanobodies binding to different positions of the p62 protein respectively.

[0051] Figure 11 Showing the laser confocal microscopy live cell imaging snapshots of U-2OS cells stably expressing EGFP-TDP43 transfected with the specified construct; among them, mCherry, EGFP-TDP43, and p62 show the fluorescence excitation images of the exogenous specified construct, TDP43, and endogenous p62 respectively, and Merge is the result of in-situ superposition of the above three images and the cell nucleus (blue); the scale bar in each small figure is 10 μm; Zoomin is the enlarged image of the Figure 11 white box area in, showing the live cell imaging results of the co-localization analysis of the fluorescence signals representing the mCherry fusion construct, EGFP-TDP43, and p62 in the puncta at the positions marked by the white arrows.

[0052] Figure 12 Is for Figure 11Statistical results of the gray values of the fluorescence signals measured at the position marked by the white arrow; in the figure, the horizontal axis represents the distance along the direction of the arrow on the arrow mark, and the vertical axis represents the relative fluorescence intensity measured at the corresponding position.

[0053] Figure 13 Show laser confocal microscopy live cell imaging snapshots of U-2OS cells stably expressing EGFP-TDP43 transfected with a construct of mCherry-Pn fused with GFP nanobody (Gn); among them, mCherry, EGFP-TDP43, and p62 show the fluorescence excitation images of the exogenous mCherry-Pn-Gn construct, TDP43, and endogenous p62 respectively, Merge is the result of in-situ superposition of the above three images and the cell nucleus (blue), mCherry-A1E-Gn, mCherry-D9A-Gn, mCherry-E12C-Gn show three mCherry-Pn-Gn constructs respectively; the scale bar in each small figure is 10 μm; Zoomin is the figure obtained by magnifying the white frame area in Figure 13 to show the live cell imaging results of the co-localization analysis of the fluorescence signals representing mCherry-Pn-Gn, EGFP-TDP43, and p62 respectively in the puncta located at the position marked by the white arrow.

[0054] Figure 14 is Figure 13 Statistical results of the gray values of the fluorescence signals measured at the position marked by the white arrow, the horizontal axis in the figure represents the distance along the direction of the arrow on the arrow mark, and the vertical axis represents the relative fluorescence intensity measured at the corresponding position.

[0055] Figure 15 Show laser confocal microscopy live cell imaging snapshots of HEK-293T cells co-transfected with constructs of mCherry-D9A-Gn, EGFP-TDP43, and BFP-p62; among them, mCherry-D9A-Gn, EGFP-TDP43, and BFP-p62 show the fluorescence excitation images of the exogenous mCherry-D9A-Gn, EGFP-TDP43, and BFP-p62 respectively, Merge is the result of in-situ superposition of the above three images, and the scale bar is 10 μm.

[0056] Figure 16Shows the results of detecting the content of EGFP-TDP43 in cells by Western blotting 48 hours after transfection of HEK-293T cells stably expressing EGFP-TDP43 with the specified construct. Among them, a rabbit polyclonal antibody against GFP was used for labeling, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein was used as an internal reference; and the statistical results of the gray values of the Western blot bands. In the figure, the horizontal axis represents the treatment conditions of the specified construct, and the vertical axis represents the ratio of the gray value of the band of the specified construct to the gray value of the band treated with mCherry. All gray values were normalized by the gray value of the internal reference band. The shown statistical results are the mean ± standard error of the mean of three independent experiments, and the p-value was calculated by two-tailed t-test;

[0057] Figures 17A to 17H Show the live-cell imaging snapshots of laser confocal microscopy of U-2OS cells stably induced to express mCherry-fused p62 nanobody A1E and Gn (mCherry-A1E-Gn) transfected with different specified fusions of EGFP or EGFP control respectively; among them, A1E-Gn and p62 show the fluorescence excitation images of exogenous mCherry-A1E-Gn and endogenous p62 respectively, Merge is the result of in-situ superposition of the above two and the three images of the specified fusion of EGFP, -DOX indicates that the cells were treated with dimethyl sulfoxide (DMSO) for 24 hours after transfection, and +DOX indicates that the cells were treated with 1 μg / mL doxycycline (DOX) for 24 hours after transfection; the scale bar in each small figure is 10 μm, and the white dotted line shows the cell contour; among them, Figures 17A to 17H the specified fusions of EGFP are EGFP-TDP43, EGFP-G3BP1, TSPAN4-EGFP, EGFP-HTT-Q103, EGFP control, EGFP-hnRNPK, EGFP-PD-L1, EGFP-APP respectively;

[0058] Figure 18 is the co-localization statistical result obtained by Pearson co-localization analysis of the images of Figures 17A - 17H ; in the figure, the horizontal axis represents the specified treatment conditions, and the vertical axis represents the Pearson co-localization coefficient calculated for the corresponding treatment conditions; the shown statistical results are the mean ± standard error of the mean of three independent experiments, and the p-value was calculated by two-tailed t-test;

[0059] Figure 19AShows HEK-293T cells stably induced to express mCherry-A1E-Gn transfected with the specified construct, -DOX indicates that the cells were treated with DMSO for 48 hours after transfection, +DOX indicates that the cells were treated with 1 μg / mL DOX for 48 hours after transfection; the results of detecting the content of the specified EGFP fusion protein in the cells by Western blotting; labeled with anti-GFP rabbit polyclonal antibody or anti-mCherry rabbit polyclonal antibody, using GAPDH protein as an internal reference;

[0060] Figure 19B Shows the Figure 19A Statistical results of the gray values of the Western blot bands. The horizontal axis in the figure represents the experimental conditions of the specified cell line, and the vertical axis represents the percentage of the degradation degree of the specified construct. The shown statistical results are the averages of three independent experiments, and the degradation percentage is shown by the corresponding gradient colors;

[0061] Figure 20 Shows the mRNA transcription levels of the specified genes in U-2OS cells stably expressing EGFP-TDP43 and stably induced to express mCherry-A1E-Gn detected by fluorescence quantitative pcr, using RPL13A protein as an internal reference. The horizontal axis in the figure shows the specified genes, and the vertical axis shows the degree of change in the mRNA of the specified genes;

[0062] Figure 21A Shows laser confocal microscopy snapshots after treating U-2OS cells stably expressing EGFP-TDP43 and stably induced to express mCherry-A1E-Gn with 1 μg / mL DOX (DOX+) or an equal volume of DMSO (DOX-) for 24 hours; among them, EGFP-TDP43, mCherry-A1E-Gn, and p62 show the fluorescence excitation images of exogenous EGFP-TDP43 and mCherry-A1E-Gn and endogenous p62 respectively, and Merge is the result of in-situ superposition of the above three images with the cell nucleus (blue); the scale bar in each small figure is 10 μm, and Zoomin is the enlarged figure of the white box area on the left;

[0063] Figure 21B Shows the Figure 21A Colocalization statistical results (left) and p62 body counting results (right) obtained by Pearson colocalization analysis of the images; the horizontal axis in the figure represents the specified treatment conditions, and the vertical axis represents the Pearson colocalization coefficient (left) and the number of (p62) bodies (right) calculated for the corresponding treatment conditions; the shown statistical results are the averages of three independent experiments ± standard error of the mean, and the p value is obtained by calculating with a two-tailed t test;

[0064] Figure 22The results were obtained from immunoprecipitation and mass spectrometry analysis of U-2OS cells stably expressing EGFP-TDP43 and stably induced to express mCherry-A1E-Gn treated with 1 μg / mL DOX or an equal volume of DMSO for 48 hours. In the figure, the horizontal axis represents the fold change of the detected protein after DOX treatment, and the vertical axis represents the p-value of the fold change (FC) of the protein; red data points indicate high enrichment (log2FC > 1.3, p < 0.05), blue data points indicate low enrichment (log2FC < 1.3, p < 0.05), and gray data points indicate no difference (p > 0.05).

[0065] Figure 23 Show laser confocal microscopy snapshots after treating U-2OS cells stably expressing EGFP-TDP43 and stably induced to express mCherry-A1E-Gn with 1 μg / mL DOX for the specified duration; among them, EGFP-TDP43 and mCherry-A1E-Gn respectively show the fluorescence excitation images of exogenous EGFP-TDP43 and mCherry-A1E-Gn, and Merge is the result of in-situ superposition of the above two images with the cell nucleus (blue) and β-actin (purple); the scale bar in each small figure is 10 μm; the white dotted line shows the cell contour.

[0066] Figure 24 Is the result of Figure 23 Fluorescence intensity analysis of the image; the horizontal axis in the figure represents the specified DOX treatment time, and the vertical axis represents the average GFP fluorescence intensity calculated under the corresponding treatment conditions; the statistical results shown are the mean ± standard error of the mean of three independent experiments, and the p-value is obtained by calculating the two-tailed t-test; ns. indicates p > 0.05.

[0067] Figure 25 Show protein immunoblotting bands after treating U-2OS cells stably expressing EGFP-TDP43 and stably induced to express mCherry-A1E-Gn with 1 μg / mL DOX for the specified duration; anti-GFP rabbit polyclonal antibody was used to label EGFP-TDP43, anti-mCherry rabbit polyclonal antibody was used to label mCherry-A1E-Gn, and GAPDH protein was used as an internal reference.

[0068] Figure 26 Is Figure 25Statistical results of the gray values of the protein immunoblot bands; in the figure, the horizontal axis represents the specified treatment time, and the vertical axis represents the ratio of the gray value of the EGFP-TDP43 band at the specified time point to the gray value of the band at the starting point of treatment (0 hours). All gray values were normalized by the gray value of the internal reference band; the shown statistical results are the mean ± standard error of the mean of three independent experiments. The p-value was calculated by a two-tailed t-test and presented by non-linear fitting;

[0069] Figure 27 Protein immunoblot bands after treating U-2OS cells stably expressing EGFP-TDP43 and stably induced to express mCherry-A1E-Gn with DOX at a specified concentration for 48 hours are shown; an anti-GFP rabbit polyclonal antibody was used to label EGFP-TDP43, and GAPDH protein was used as the internal reference;

[0070] Figure 28 is Figure 27 Statistical results of the gray values of the protein immunoblot bands; in the figure, the horizontal axis represents the specified treatment time, and the vertical axis represents the ratio of the gray value of the EGFP-TDP43 band at the specified time point to the gray value of the band at the starting point of treatment (0 hours). All gray values were normalized by the gray value of the internal reference band; the shown statistical results are the mean ± standard error of the mean of three independent experiments. The p-value was calculated by a two-tailed t-test and presented by linear fitting;

[0071] Figure 29 Protein immunoblot bands of U-2OS cells stably expressing EGFP-TDP43 and stably induced to express mCherry-A1E-Gn treated with the inhibitor MG-132 or bafilomycin A1 (Baf A1) are shown; an anti-GFP rabbit polyclonal antibody was used to label EGFP-TDP43, and GAPDH protein was used as the internal reference;

[0072] Figure 30 is Figure 29 Statistical results of the gray values of the protein immunoblot bands; in the figure, the horizontal axis represents the specified treatment conditions, and the vertical axis represents the ratio of the gray value of the EGFP-TDP43 band under the specified treatment conditions to the gray value of the band without DOX treatment. All gray values were normalized by the gray value of the internal reference band; the shown statistical results are the mean ± standard error of the mean of three independent experiments. The p-value was calculated by a two-tailed t-test;

[0073] Figure 31Shows the Western blot results of U-2OS cells stably expressing EGFP-TDP43 and stably induced to express mCherry-A1E-Gn after treatment with 1 μg / mL DOX (DOX+) or an equal volume of DMSO (DOX-) for 24 hours; labeled with anti-p62 rabbit polyclonal antibody, and GAPDH protein was used as an internal reference;

[0074] Figure 32 Shows Figure 31 The statistical results of the gray values of the Western blot bands in ; the horizontal axis in the figure represents the specified treatment time, and the vertical axis represents the gray value of the p62 band under the specified treatment conditions. All gray values were normalized by the gray value of the internal reference band; the shown statistical results are the mean ± standard error of the mean of three independent experiments, and the p-value was calculated by two-tailed t-test;

[0075] Figure 33 Shows the mRNA transcription levels of the specified genes in U-2OS cells stably expressing EGFP-TDP43 and stably induced to express mCherry-A1E-Gn detected by fluorescence quantitative PCR, using RPL13A protein as an internal reference; the horizontal axis in the figure shows the specified genes, and the vertical axis shows the degree of change in the mRNA of the specified genes;

[0076] Figure 34 The left diagram of shows the schematic diagram of the PDF-Bin targeting STAT3; the right diagram shows that A549 cells stably express A1E-MS3-6 labeled with EGFP in a DOX-induced manner (A549 / A1E-MS3-6 TRE ).

[0077] Figure 35 Shows the laser confocal microscopy snapshots of A549 cells stably induced to express EGFP-A1E-MS3-6 after treatment with 1 μg / mL DOX (DOX+) or an equal volume of DMSO (DOX-) for 24 hours; among them, EGFP-A1E-MS3-6, STAT3, and p62 show the fluorescence excitation images of exogenous EGFP-A1E-MS3-6, endogenous STAT3, and p62 respectively, and Merge is the result of in-situ superposition of the above three images with the cell nucleus (blue); the scale bar in each small diagram is 10 μm;

[0078] Figure 36 Is the co-localization statistical result obtained by performing mCherry fluorescence intensity enrichment analysis on the images of Figure 35 ; the horizontal axis in the figure represents the specified treatment conditions, and the vertical axis represents the degree of enrichment of the mCherry fluorescence signal calculated under the corresponding treatment conditions; the shown statistical results are the mean ± standard error of the mean of three independent experiments, and the p-value was calculated by two-tailed t-test;

[0079] Figure 36 is Figure 35 The statistical result of the number of p62 puncta in the images; the horizontal axis in the figure represents the specified treatment conditions, and the vertical axis represents the average number of p62 puncta per cell calculated for the corresponding treatment conditions; the shown statistical result is the average ± standard error of the mean of three independent experiments, and the p-value is obtained by calculating a two-tailed t-test.

[0080] Figure 37 Shows the protein immunoblot bands after treating A549 cells stably induced to express EGFP-A1E-MS3-6 with 1 μg / mL DOX for the specified duration; rabbit polyclonal antibody against STAT3 was used to label STAT3, rabbit polyclonal antibody against GFP was used to label EGFP-A1E-MS3-6, and GAPDH protein was used as an internal reference.

[0081] Figure 38 is Figure 37 The statistical result of the gray values of the bands in the protein immunoblot in ; the horizontal axis in the figure represents the specified treatment time, and the vertical axis represents the ratio of the gray value of the STAT3 band at the specified time point to the gray value of the band at the treatment start point (0 hour), and all gray values were normalized by the gray value of the internal reference band; the shown statistical result is the average ± standard error of the mean of three independent experiments, the p-value was obtained by calculating a two-tailed t-test, and it is shown by non-linear fitting.

[0082] Figure 39 Shows the protein immunoblot bands after treating A549 cells stably induced to express EGFP-A1E-MS3-6 with the specified concentration of DOX for 48 hours; rabbit polyclonal antibody against STAT3 was used to label STAT3, and GAPDH protein was used as an internal reference.

[0083] Figure 40 Shows Figure 39 The statistical result of the gray values of the bands in the protein immunoblot in ; the horizontal axis in the figure represents the specified treatment time, and the vertical axis represents the ratio of the gray value of the STAT3 band at the specified time point to the gray value of the band at the treatment start point (0 hour), and all gray values were normalized by the gray value of the internal reference band; the shown statistical result is the average ± standard error of the mean of three independent experiments, the p-value was obtained by calculating a two-tailed t-test, and it is shown by linear fitting.

[0084] Figure 41 Shows the protein immunoblot bands after treating A549 cells stably induced to express EGFP-A1E-MS3-6 with the inhibitor MG-132 or Baf A1; rabbit polyclonal antibody against STAT3 was used to label STAT3, and GAPDH protein was used as an internal reference.

[0085] Figure 42 is Figure 41 The statistical results of the gray values of the protein immunoblotting bands; the horizontal axis in the figure represents the specified treatment conditions, and the vertical axis represents the ratio of the gray value of the STAT3 band under the specified treatment conditions to the gray value of the band without DOX treatment; all gray values are normalized by the gray value of the internal reference band; the shown statistical results are the mean ± standard error of the mean of three independent experiments, and the p-value is obtained by calculating the two-tailed t-test;

[0086] Figure 43 Shows the protein immunoblotting bands after treating A549 cells stably induced to express EGFP-A1E-MS3-6 with cycloheximide (CHX) for a specified time; anti-p62 rabbit polyclonal antibody was used to label p62, and GAPDH protein was used as the internal reference;

[0087] Figure 44 is Figure 43 The statistical results of the gray values of the protein immunoblotting bands; the horizontal axis in the figure represents the specified treatment time, and the vertical axis represents the gray value of the p62 band under the specified treatment conditions; all gray values are normalized by the gray value of the internal reference band;

[0088] Figure 45 Shows the microscopic imaging snapshots of the scratch migration experiment on A549 cells stably induced to express EGFP-A1E-MS3-6; the scale bar in each small figure is 100 μm; the white dotted line shows the edge of the scratch area;

[0089] Figure 46 Shows the microscopic imaging snapshots of the colony formation experiment on A549 cells stably induced to express EGFP-A1E-MS3-6; the purple spots in the figure show the cell colony areas;

[0090] Figure 47 Shows for Figure 45 the degree of scratch healing (left) in Figure 46 and the statistical results of the number of colony formations (right) in

[0091] Figure 48 Panel A shows the effect of using oligomerization elements with different oligomerization degrees to enhance the degradation of endogenous TDP43 protein by the PDF-Bin molecule (PmSE10-Tm12D with PmSE10 and Tm12D of monobody as the binding arms); the white dotted line represents the cells expressing the mCherry fusion protein, green represents the endogenous TDP43 protein, red represents the PmSE10-Tm12D fusion protein, and purple represents the endogenous p62 protein;Figure 48 Panel B shows the Figure 48 results of fluorescence statistical analysis of A. The X-axis represents the average fluorescence intensity of the mCherry channel, which represents the expression level of the mCherry fusion protein; the Y-axis represents the percentage of the fluorescence intensity of TDP43 in transfected cells compared to that in untransfected cells in the same field of view, which represents the relative content of endogenous TDP43 protein; it is shown by non-linear fitting;

[0092] Figure 49 Panel A shows the effect of using oligomerization elements with different oligomerization degrees to enhance the degradation of endogenous TDP43 protein by another PDF-Bin molecule (PnA5-Tm12D with the nanobody PnA5 and the monobody Tm12D as the binding arms); Figure 49 Panel B shows the Figure 49 results of fluorescence statistical analysis of A; the display and analysis methods are the same as Figure 48 ;

[0093] Figure 50 Panel A shows the effect of using different types of phase separation elements to enhance the degradation of endogenous TDP43 protein by the PnA5-Tm12D molecule; Figure 50 Panel B shows the Figure 50 results of fluorescence statistical analysis of A; the display and analysis methods are the same as Figure 48 。 Detailed implementation manners

[0094] The present invention will be further described in detail below in combination with the specific implementation manners. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0095] In the experimental methods in the following embodiments, unless otherwise specified, they are all conventional methods, carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, instruments, etc. used in the following embodiments, unless otherwise specified, can all be obtained from commercial channels. In the following embodiments, unless otherwise specified, the quantitative tests are all the averages of three repeated experiments. In the following embodiments, unless otherwise specified, each nucleotide sequence in the sequence listing is written in the order from the 5' end to the 3' end from left to right, and each amino acid sequence is written in the order from the amino terminus to the carboxyl terminus from left to right.

[0096] Definition

[0097] As used in the specification of the present invention, the following words and phrases are generally considered to have the meanings clarified below, unless otherwise specified in the context in which these words or phrases are used.

[0098] As used herein, the singular forms "a", "an", and "the" refer to both the singular and the plural, unless the context clearly dictates otherwise. As used herein, the terms "comprising", "including", "having" mean that the compositions and methods include the recited components or steps, but do not exclude other components or steps.

[0099] As used herein, the term "about" refers to the common error range of the corresponding value that is readily known to those skilled in the art. For example, within ±10% or less, ±5% or less, ±2% or less, ±1% or less, or ±0.1% or less of the described value. Values or parameters described in the manner of "about" herein include the value or parameter itself.

[0100] As used herein, the term "liquid-liquid phase separation" (LLPS, also simply referred to as "phase separation" or "phase transition" herein) refers to the following transformation process that occurs between multivalent macromolecules: under suitable solution conditions, multivalent macromolecules aggregate through interactions to form larger complexes, and these complexes separate from the ordinary solution phase due to reaching the corresponding solubility, forming an independent liquid phase enriched with the complexes. Biomacromolecules can aggregate and undergo phase separation due to intermolecular or intramolecular interactions. Modules or motifs that can cause the above-mentioned intermolecular or intramolecular interactions include, but are not limited to, (1) structurally similar modules or motifs arranged linearly in proteins or polypeptides with similar functions; (2) structural modules or motifs that promote oligomerization of proteins or polypeptides; (3) polyvalent binding sites generated based on post-translational modifications; (4) intrinsically disordered regions or low-complexity domains in proteins or polypeptides (see, for example, Wang et al., Cell 174(3):688-699, 2018; Nott, Timothy J et al., Molecular Cell 57(5):936-947, 2015).

[0101] The term "phase transition droplet" refers to highly distinguishable small droplets with diameters up to several micrometers or even larger that exist within the liquid phase formed by phase separation. In this article, "phase transition droplet" is sometimes also simply referred to as "droplet".

[0102] As used herein, the terms "oligomerization", "condensation", or "aggregation", when describing biomacromolecules such as proteins, mean that several biomacromolecules, such as several receptor molecules, polymerize into a complex through non-covalent bonds, and the functional state may change.

[0103] The term "intact antibody" is used to refer to an antibody having a structure substantially similar to that of a natural antibody. In this article, "intact antibody" can be used interchangeably with "full-length antibody" and "whole antibody".

[0104] The term "antigen-binding fragment" or its equivalent refers to a molecule other than a full antibody that contains a portion of a full antibody that binds the antigen to which the full antibody binds. Examples of antigen-binding fragments include, but are not limited to: bis-Fab, Fv, Fab, Fab, Fab'-SH, F(ab')2, etc.

[0105] As used herein, the term "nanobody" refers to an antibody or antigen-binding fragment in a form that is much smaller in size than a conventional four-chain antibody. Most known nanobodies are derived from the variable region of the antibody heavy chain (V H ), typically consisting of about 120 amino acids, having a molecular weight of about 12 - 15 kD, and a size of about 4 x 2.5 nM. Such antibodies were first reported in 1989 under the concept of "single-domain antibodies". Ward, E. et al. found that two murine V H domains screened from a cDNA expression library prepared from the spleens of mice immunized with lysozyme and keyhole limpet hemocyanin showed a certain affinity for lysozyme (see Ward, E. et al., Nature 341, 544–546 (1989)). Subsequently, a large number of natural IgG containing only heavy chains (HCAb) were found in the sera of camelids, accounting for 45% to 75% of the total serum immunoglobulins depending on the species. HCAb are naturally lacking the light chain in conventional four-chain antibodies and consist of two heavy chains each containing a heavy chain variable region (V HH ), a hinge region, and two CH2 and CH3 domains, and are called "heavy chain only antibodies" or "heavy chain antibodies". Similar natural heavy chain antibodies are also found in cartilaginous fish (V NAR ) (Feng et al., Antib Ther, 2, 1 - 11, 2019) and some human heavy chain diseases (Prelli and Frangione, J Immunol, 148, 949 - 952, 1992). Recombinant nanobodies based on the V HH domains of camelids are currently the mainstream direction for the development of nanobodies. Compared with human V H domains, the following several structural features make the naturally evolved camelid V HH domains have better solubility and stability: According to Kabat numbering, V37 in the human V H germline is usually F37 or Y37 in the V HH domain, making the hydrophobic packing of the domain more compact and stable (Riechmann and Muyldermans, J Immunol Methods, 231, 25 - 38, 1999; Shinozaki et al., J Biosci Bioeng, 125, 654 - 661, 2018); human V HThe light chain contact residues G44, L45, and W47 in the germline correspond to E44 (or Q44), R45 (or C45), and G47 (or Ser, Leu, Phe) in V HH (Holt et al., Trends Biotechnol, 21, 484 - 490, 2003), such that the accessible surface area is more hydrophilic and less aggregating; in some V HH domains, W103 can be replaced by R103; V HH generally has a longer CDR3 than that of human / rodent V H , and its CDR3 generally contains Cys, which can form additional disulfide bonds other than the classical C22 - C92 disulfide bond with the Cys at the end of CDR1 (camel) or the beginning of CDR2 (llama) (Wesolowsk et al., Med Microbiol Immunol, 198, 157 - 174, 2009), making the V HH domain more stable (Tm value range is 60 - 78 °C), and enabling reversible unfolding / refolding (Holt et al., Trends Biotechnol, 21, 484 - 490, 2003).

[0106] The term "single - chain antibody", also known as "single - chain Fv", "single - chain variable fragment", "sFv", or "scFv", is an antibody fragment that contains the V H and V L antibody domains linked in a single polypeptide chain. Preferably, the scFv polypeptide further contains a polypeptide linker between the V H and V L domains, enabling the scFv to form the required antigen - binding structure. For a review of scFv, see Pluckthun in "The Pharmacology of Monoclonal Antibodies", Volume 113, edited by Rosenberg and Moore, Springer Verlag, New York, pp. 269 - 315 (1994); Malmborg et al., J. Immunol. Methods 183:7 - 13, 1995.

[0107] The term "single - domain antibody" refers to an antibody fragment that contains all or part of the heavy - chain variable domain or all or part of the light - chain variable domain of an antibody. In some aspects, the single - domain antibody is a human single - domain antibody (see, for example, U.S. Patent No. 6,248,516 B1). Examples of single - domain antibodies include, but are not limited to, V HH .

[0108] The term "complementary determining region" or "CDR" refers to the region in the variable region of an antibody that is primarily responsible for binding to the epitope of an antigen. The positioning and alignment of CDRs can be carried out by means of the three-dimensional space formed by the antibody framework region, and using any of a variety of well-known numbering schemes, the amino acid sequence boundaries of a given CDR can be readily determined, such as Kabat et al. (see Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services, 1991; the "Kabat" numbering scheme), Chothia et al. (see Chothia and Lesk, J Mol Biol 196:901-917, 1987; Chothia et al., Nature 342:877, 1989; and Al-Lazikani et al., JMB 273, 927-948, 1997; the "Chothia" numbering scheme), Kunik et al. (see Kunik et al., PLoS Comput Biol 8:el002388, 2012; and Kunik et al., Nucleic Acids Res 40(Web Server issue):W521-524, 2012; "Paratome CDRs") and the ImMunoGeneTics (IMGT) database (see Lefranc, Nucleic Acids Res 29:207-9, 2001; the "IMGT" numbering scheme). The Kabat, Paratome, and IMGT databases are all publicly available Internet databases.

[0109] The term "small molecule" refers to any molecule having a molecular weight of about 2000 daltons or less, such as about 1000 daltons or less. In some aspects, small molecules can be organic molecules. In other aspects, small molecules can be inorganic molecules.

[0110] As used herein, the "p62 protein" is one of the components of inclusion bodies found in protein aggregation diseases of the brain and liver, and has been identified to have a molecular weight of 62 kDa and binds to the src homology 2 (SH2) domain of tyrosine kinase Lckp56 in a phosphotyrosine-independent manner (Park et al., Proc Natl Acad Sci USA, 92:12338 (1995)). The term "p62" or "p62 protein" broadly refers to any native p62 molecule from any vertebrate source, including mammals such as primates (e.g., humans), non-human primates (e.g., cynomolgus monkeys), and rodents (e.g., mice and rats). The term encompasses full-length p62 and isolated regions or domains of p62. The term also encompasses naturally occurring variants of p62, such as splice variants or allelic variants. An exemplary DNA sequence of human p62 can be referred to the sequence shown in SEQ ID NO:8, and the amino acid sequence can be referred to the sequence shown in SEQ ID NO:7. The present invention also contemplates smaller sequence variations, especially conservative amino acid substitution variants that do not affect the function and / or activity of p62. It has been reported that p62 shows ubiquitin-binding activity in vivo (Vadlamudi et al., J. Biol. Chem., 271:20235 (1996)). And it is neither homologous to ubiquitin C-terminal hydrolase nor to the S5a subunit of the 26S proteasome complex (the only known protein that binds non-covalently to ubiquitin), indicating that p62 belongs to a new class of ubiquitin-binding proteins. Protein aggregates containing p62 were found to be degradable by autophagy. It is thought that this function of p62 may have a protective effect on huntingtin-induced cell death ( et al., J cell Biol., 171:603 (2005)).

[0111] The term "intrinsically disordered protein" (also simply referred to as "disordered protein" in the text) refers to a class of proteins / polypeptide fragments that do not have a stable and ordered secondary and / or tertiary structure under physiological conditions, are not folded globally or locally in their native state, but can still perform biological functions normally. The term "intrinsically disordered region" (also simply referred to as "disordered region" in the text) refers to a region that does not fold into a fixed three-dimensional structure under physiological conditions but exists in a heterogeneous conformational ensemble. Intrinsically disordered proteins are widely present in organisms. Due to the high flexibility of disordered proteins and disordered regions and the lack of stable secondary / tertiary structures, they can interact with more than one single target and usually play important roles in cell signal transduction and protein interaction networks. Naturally occurring intrinsically disordered proteins are known in the art through literature or databases. For example, the DisProt database compiles intrinsically disordered proteins selected from the literature (Hatos, A. et al., DisProt: Intrinsic protein disorder annotation in 2020, Nucleic Acids Research (2020) 48(D1) 269-276). It is known that many polypeptides and proteins related to various diseases (including cancer, cardiovascular diseases, and neurodegenerative diseases) have disordered structures, including but not limited to important regulatory factors such as p53 and c-Myc. Disordered structures usually have preferences in amino acid composition, such as containing abundant polar amino acids such as G, P, E, S, Q, K, D, T, R, and aromatic amino acids such as Y, F.

[0112] The term "oligomerization element" refers to an amino acid sequence that forms a structure capable of interacting with oligomerization elements (identical or different) in other polypeptides, such that these polypeptides form oligomers through non-covalent interactions. Common oligomerization elements are oligomerization domains from proteins that naturally form oligomers (homo-oligomers or hetero-oligomers), such as β-sheet associations, α-helix associations, hydrophobic surface patch associations, etc. within different monomers. A common motif for protein oligomerization is the coiled-coil domain. The coiled α-helical structural motif can itself form helices, and 2, 3, 4, or 5 α-helices can wind around each other to form a left-handed superhelix called a "coiled coil". The simplicity of the coiled-coil domain makes it a conventional choice for designing fusion proteins with a defined oligomeric state. Hundreds of coiled-coil domain sequences are known in the art, see for example Arai, R. (2021). Design of helical linkers for fusion proteins and protein-based nanostructures. Methods Enzymol 647, 209-230; Bozic, S., Doles, T., Gradisar, H., and Jerala, R. (2013). New designed protein assemblies. Curr Opin Chem Biol 17, 940-945; Dawson, W. M., Martin, F. J. O., Rhys, G. G., Shelley, K. L., Brady, R. L., and Woolfson, D. N. (2021). Coiled coils 9-to-5: rational de novo design of α-helical barrels with tunable oligomeric states. Chemical Science 12, 6923-6928; Fletcher, J. M., Boyle, A. L., Bruning, M., Bartlett, G. J., Vincent, T. L., Zaccai, N. R., Armstrong, C. T., Bromley, E. H. C., Booth, P. J., Brady, R. L., et al. (2012). A Basis Set of de Novo Coiled-Coil Peptide Oligomers for Rational Protein Design and Synthetic Biology.ACS Synthetic Biology 1, 240 - 250; Fletcher, J. M., Harniman, R. L., Barnes, F. R. H., Boyle, A. L., Collins, A., Mantell, J., Sharp, T. H., Antognozzi, M., Booth, P. J., Linden, N., et al. (2013). Self - Assembling Cages from Coiled - Coil Peptide Modules. Science 340, 595 - 599; Hsia, Y., Bale, J. B., Gonen, S., Shi, D., Sheffler, W., Fong, K. K., Nattermann, U., Xu, C., Huang, P. S., Ravichandran, R., et al. (2016). Design of a hyperstable 60 - subunit protein dodecahedron. [corrected]. Nature 535, 136 - 139, etc. Any suitable sequence that can oligomerize with other coiled - coil domains and does not disrupt the antigen - binding function of the nanobody can be used as the oligomerization element of the present invention. As a non - limiting example of an oligomerization domain, an α - helix having a seven - residue repeat of abcdefg can be cited. It forms a non - polar strip of hydrophobic residue interactions on one side of each helix, and there can also be electrostatic interactions between the side chains on both sides of the helix. The non - polar strip is defined by the hydrophobic side chains on residues a and d. Leu, Ile, or Ala is most commonly found at position a, and Leu or Ala is usually found at position d. Electrostatic interactions mainly occur on residues e and g. Residues e and g are usually Glu or Gln, and Arg and Lys are also mainly at position g. Charged residues usually appear at positions b, c, and f due to interaction with the solvent. Another type of oligomerization domain is the left - handed triple helix called the collagen helix, which includes a basic tripeptide repeat sequence of 1Gly - 2Xaa - 3Xaa, where 2Xaa is usually Pro and 3Xaa is usually 4 - hydroxyproline.

[0113] The term "phase separation element" refers to an element that contains multiple structural modules or motifs related to phase separation. Biomacromolecules can aggregate and undergo phase separation due to intermolecular or intramolecular interactions. The modules or motifs that can cause the above-mentioned intermolecular or intramolecular interactions include, but are not limited to, (1) structurally similar modules or motifs arranged linearly in a protein or polypeptide; (2) structural modules or motifs that promote oligomerization of a protein or polypeptide; (3) polyvalent binding sites generated based on post-translational modifications; (4) intrinsically disordered regions or low-complexity domains in a protein or polypeptide. See, for example, Wang et al., Cell 174(3):688-699, 2018; Nott, Timothy J et al., Molecular Cell 57(5):936-947, 2015. In some cases, the phase separation element of the present invention is composed of more than one SUMO3 motif and more than one SIM motif in series. In other cases, the phase separation element of the present invention is composed of more than one PRMH motif and more than one SH3 motif in series.

[0114] The terms "increase" or "activate" as used herein mean the ability to cause an overall increase, for example, an overall increase of 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, or 75%, 85%, 90%, 95% or more. In certain aspects, an increase or activation can refer to the downstream activity of ligand-cell surface molecule interactions.

[0115] The terms "decrease" or "inhibit" as used herein mean the ability to cause an overall decrease, for example, an overall decrease of 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, or 75%, 85%, 90%, 95% or more. In certain aspects, a decrease or inhibition can refer to the downstream activity of ligand-cell surface molecule interactions.

[0116] The preferred embodiments for implementing the present invention are described below. It should be noted that the embodiments described below are examples showing representative embodiments of the present invention, but the present invention is not limited by these embodiments.

[0117] Two or more of the embodiments described below can be combined, and such combinations are also included in the present invention.

[0118] Example

[0119] The present invention is further described in detail below in conjunction with specific embodiments. The examples given are only for clarifying the present invention, rather than limiting the scope of the present invention. The examples provided below can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0120] Unless otherwise specified, the experimental methods in the following examples are all conventional methods, which are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples can be obtained from commercial sources unless otherwise specified. The relevant nucleic acid strands, genes, and enzymes can also be obtained through conventional molecular biology experimental techniques based on the information in public databases.

[0121] Unless otherwise specified, the nucleotide sequences involved in this article are written from left to right in the order of the 5' to 3' ends, and the amino acid sequences are written from left to right in the order of the amino terminus to the carboxyl terminus. If the sequences recorded in the specification are inconsistent with those in the sequence listing, the sequences recorded in the specification shall prevail.

[0122] Experimental Materials, Reagents, Instruments and Experimental Methods

[0123] Plasmid Construction:

[0124] The plasmids used in this article can all be constructed from commercially available original plasmids by conventional gene cloning and recombination methods in this field (see, for example, "Molecular Cloning: A Laboratory Manual (3rd Edition)" (Science Press), "Microbiology Experiments (4th Edition)" (Higher Education Press)). The coding gene sequences involved can be obtained from public database information through conventional molecular biology experimental techniques and are commissioned to Xianghong Biotech Company for synthesis. The recombinant kit used is seamless cloning kit (Beyotime, D7010M), the competent cells are Stbl3 (Kangti Life, KTSM110L), and the screening medium is LB agar plate with ampicillin resistance.

[0125] (1) pcDNA3.1-mCherry-4xGGS-Xho I-Apa I

[0126] Using pcDNA3.1 (Invitrogen, V79020) as the initial backbone plasmid, a eukaryotic cell expression vector was constructed and screened and amplified in Escherichia coli using its ampicillin resistance. The coding sequence of the fluorescent marker mCherry (SEQ ID NO:1), the flexible linker sequence 4xGGS (SEQ ID NO:2), and the Xho I and Apa I endonuclease sites for inserting the target gene were inserted between the restriction enzyme sites BamH I and Xho I. The mCherry fluorescent tag (red) can be used to trace the antibody or PDF-BIN fused with it.

[0127] (2) pcDNA3.1-EGFP-4xGGS-Xho I-Xba I

[0128] The construction method is basically the same as that in (1), but the inserted fluorescent marker is the coding sequence of EGFP (SEQ ID NO: 15), and the restriction enzyme sites are Xho I and Xba I sites. EGFP fluorescent tag (green) can be used to trace p62 and its variants.

[0129] (3)pcDNA3.1-EGFP-NUP98N-Xho I-Xba I

[0130] The construction method is basically the same as that in (2), except that the linker sequence 4xGGS is replaced with the coding sequence of the NUP98 protein N-terminal disordered domain (NUP98N) (SEQ ID NO: 4).

[0131] (4) pLVX-EGFP-TDP43

[0132] pLVX (Takara, 632164) is used as the initial backbone plasmid to construct a lentiviral expression vector, which can be used to package lentivirus, construct a stable cell line, and transiently transfect to detect the expression status of the target protein. The ampicillin resistance of this plasmid is used for prokaryotic cells, and its puromycin resistance is used for eukaryotic cells. The target gene can be inserted after the vector is linearized by PCR. The primers used for the PCR linearization vector are as follows:

[0133] pLVX-F:ACCGGTTAACTCGAGCATGC(SEQ ID NO:5)

[0134] pLVX-R:GCGGCCGCAAGCTTGGGTCT (SEQ ID NO:6)

[0135] (5)pLVX-TETONE-EcoR I-Age I

[0136] pLVX-TETONE (Takara, 631847) was used as the initial backbone plasmid to construct a lentiviral expression vector, which can be used to package lentivirus, construct a stable cell line, and control the expression of the target gene through the tet-on system of the plasmid. The ampicillin resistance of the plasmid was used for prokaryotic cells, and its puromycin resistance was used for eukaryotic cells. The target gene was inserted into the vector site linearized by the endonucleases EcoR I and Age I.

[0137] Cell Line:

[0138] HEK-293T: ATCC, CRL-3216;

[0139] U-2OS: ATCC, HTB-96;

[0140] A549: ATCC, CCL-185.

[0141] Cell Culture:

[0142] The cell lines HEK-293T, U-2OS, and A549 used in the examples were all cultured in high-glucose DMEM medium (HyClone, SH30243.01) containing 10% fetal bovine serum FBS (Gibco, 10099-141) and 1% penicillin-streptomycin solution (Gibco, 15140122). The culture conditions were a 37°C constant temperature and humidity incubator with 5% CO2. When the cell density reached 85%, trypsin was used for digestion and subculture. According to the screening requirements, puromycin or other corresponding antibiotics could also be added to the medium to a final concentration of 1 μg / mL.

[0143] Cell Transfection:

[0144] According to the experimental requirements, the cells were inoculated into culture plates or dishes with different pore sizes and materials for culture. When the cell density reached 50-80%, according to the manufacturer's instructions, the Lipo8000 transfection kit (Beyotime, C0533) was used for transfection.

[0145] Lentivirus Infection:

[0146] All stable cell lines in this article were constructed using lentiviruses. The lentiviral packaging plasmids used were pMD2.G (Addgene, 12259) and psPAX2 (Addgene, 12260). The cell line to be transfected was cultured to an appropriate density (such as about 50% confluence). Before transfection, the medium was replaced with pre-warmed medium without antibiotics. Then, according to the manufacturer's instructions, the transfection reagent PEI (Polysciences, 23966-100), the two packaging plasmids psPAX2 and pMD2.G, the lentiviral plasmid containing the target gene, and Opti-MEM medium were mixed and incubated at room temperature for 10 minutes to prepare the transfection mixture. Then the mixture was evenly dropped into the culture dish and cultured in the cell incubator for 8-12 hours. Fresh medium was replaced. After that, every 24 hours, the culture medium supernatant was collected and filtered through a 0.22 μm needle filter, and the recombinant virus was added to the cells to be infected (about 50% confluence). The HEK-293T cells packaging the virus were continued to be cultured with fresh medium; the virus supernatant could be continuously collected 2-3 times. Appropriate methods (such as flow cytometry or antibiotic screening) could be selected to enrich the stable transfected cells. The stable cell lines used in this article were all monoclonal cell lines selected by sorting single cells from the stable transfected cell population by flow cytometry and then according to the fluorescence intensity or induced expression effect after expansion culture.

[0147] Immunofluorescence Staining:

[0148] Cells were seeded into 4-well glass-bottom culture dishes (In Vitro Scientific, #D35C4-20-1-N) and cultured for 12 - 18 hours. Cells were transfected with the designated vector or subjected to the designated treatment. After discarding the medium, the cells were gently rinsed with PBS buffer. The cells were fixed with 200 μL of 4% paraformaldehyde solution (Beyotime, P0099) at room temperature for 15 minutes. Subsequently, the liquid was aspirated, and the cells were gently rinsed 3 times with PBS buffer. The cells were permeabilized with the permeabilization solution (Beyotime, P0097) at room temperature for 15 minutes, then the liquid was aspirated, and the cells were gently rinsed 3 times with PBS buffer. The cells were blocked with the immunofluorescence staining blocking solution / primary antibody dilution solution (Sangon Biotech, E674004) at room temperature for 1 hour, and then the liquid was aspirated. The cells were incubated with the designated primary antibody at room temperature for 1 hour, then the liquid was aspirated, and the cells were gently rinsed 3 times with PBS buffer. The cells were incubated with the designated secondary antibody conjugated with a fluorophore at room temperature in the dark for 1 hour, then the liquid was aspirated, and the cells were gently rinsed 3 times with PBS buffer. Hoechst 33342 staining solution was diluted 1:2,000 with PBS and added to the cells, and incubated in the dark for 5 - 10 minutes. The liquid was aspirated, and the cells were gently rinsed 3 times with PBS buffer, and finally the cells were stored in PBS buffer.

[0149] Bio-Layer Interferometry (BLI):

[0150] The antibody to be assayed was biotinylated and immobilized on an SA biosensor. Human p62 protein (SEQ ID NO: 7) was diluted in the detection buffer (1×PBS, pH 7.4, 0.05% Tween-20) to obtain p62 protein solutions of 5 nM, 15 nM, 40 nM, and 60 nM, which were reacted with the immobilized antibody respectively. The Octet K2 protein analysis system (Sartorius, Octet K2) and streptavidin (SA) biosensor were used to detect the reaction process, the reaction data was normalized using Octet Data Analysis Studio 12.2, and the images were plotted using GraphPad Prism 8.

[0151] Cell-based Protein-Protein Interaction System CoPIC:

[0152] See, for example, the CoPIC method described in Xu, W. et al., Compartmentalization-aided interaction screening reveals extensive high-order complexes within the SARS-CoV-2 proteome. Cell Reports 36, 2021. Purified plasmids were co-transfected into U-2OS cells. After culturing for 24 hours, the nuclei of living cells were stained with Hochest 33342 (Thermo Scientific, 62249), and then observed and photographed with a Nikon laser confocal microscope. The average fluorescence signal intensity of the mCherry signal inside and outside the EGFP droplets was measured using Nikon NIS image analysis software, and the enrichment degree of the mCherry signal in the EGFP droplets was calculated according to the method shown below:

[0153] Enrichment degree of mCherry = (I(T) 液滴内 / I(T) 液滴外 ) - (I(C) 液滴内 / I(C) 液滴外 )

[0154] Western Blotting:

[0155] The cell samples were lysed on ice for 10 minutes with a low-salt lysis buffer (50 mM Tris-HCl, 2% Triton X-100, 2 mM EDTA, pH 7.4) to obtain total cell proteins. Then, 5× loading buffer (0.6 M Tris-HCl, pH 6.8, 2% SDS, 25% glycerol, 14.4 mM DTT, 0.1% bromophenol blue) was added, and the mixture was heated in a metal bath at 98°C for 10 minutes. An appropriate amount of the protein sample solution was loaded onto a precast gradient gel and run at 110 V for about 70 minutes. Under the conditions of a constant current of 150 mA for 60 minutes, the electrophoretic bands were transferred onto a PVDF membrane pre-activated with anhydrous methanol. After the transfer was completed, the membrane was blocked in a TBST solution containing 5% non-fat milk at room temperature for about 1 hour. After rinsing the membrane 3 times with the TBST solution, the membrane was placed in the primary antibody solution and incubated overnight at 4°C. Then, the PVDF membrane was rinsed 3 times with the TBST solution, and then the membrane was placed in a horseradish peroxidase (HRP)-conjugated secondary antibody solution and incubated on a shaker at room temperature for 1 hour. All the antibody solutions were diluted in the TBST solution containing 5% non-fat milk according to the specified ratio. After rinsing the PVDF membrane 3 times with the TBST solution, the membrane was placed in an imager, and the developing solution was evenly added dropwise for color development and imaging.

[0156] Reverse Transcription Quantitative PCR (RT-qPCR):

[0157] Extract RNA using the Polymerized Beauty RNA Rapid Extraction Kit (MF159) according to the manufacturer's instructions. After measuring the RNA concentration with Nanodrop, store it at -80 °C. Using the total RNA as a template, perform reverse transcription using the Polymerized Beauty Superplus qPCR RT kit with gDNA remover kit (MF166-plus) according to the kit instructions. Specifically, in a 10 μL reaction system, it contains 1 μg RNA, 1 μL 10x gDNA remover mix, and the remaining DEPC water. Incubate at 42 °C for 2 minutes and then cool on ice. Then, add 4 μL 5x M5 RT Super plus and 6 μL DEPC water to the reaction solution, incubate at 37 °C for 15 minutes, inactivate at 85 °C for 5 seconds, and then cool on ice to obtain the reverse-transcribed cDNA. Dilute the obtained cDNA solution to 120 μL and use it as a template to perform RT-qPCR reaction using the Polymerized Beauty HiPer SYBR Premix EsTaq (MF787). Specifically, in a 10 μL reaction system, it contains 5 μL 2x M5 HiPer SYBR Premix EsTaq (with Tli RNaseH), 1 μL template cDNA, 0.5 μL each of the forward and reverse primers, and 3 μL DEPC water. Use the primer pairs shown in Table 1 and perform RT-PCR reaction using the Roche 480 Instrument II.

[0158] Table 1:

[0159]

[0160] Immunoprecipitation Coupled with Mass Spectrometry (IP-MS):

[0161] First, perform immunoprecipitation. Lyse the cells with a low-salt lysis buffer containing a protease inhibitor cocktail at 4 °C for 30 minutes, and then centrifuge at 10,000 g for 5 minutes. Mix the supernatant with rabbit anti-p62 polyclonal antibody and protein A / G magnetic beads (bimake, #B23201) and incubate overnight at 4 °C. Wash the magnetic beads thoroughly 5 times with the low-salt lysis buffer, add 2×SDS loading buffer to elute the immunoprecipitate, and perform SDS-PAGE analysis.

[0162] Then perform mass spectrometry. Cut out the target protein band from SDS-PAGE, incubate it with 25 mM chloroacetamide in the dark at 55 °C for 45 minutes for alkylation, and then digest it with trypsin at 37 °C for 14 hours. Extract the peptides three times with 50% acetonitrile and 0.1% formic acid, and then dissolve the vacuum-dried peptides in 20 μL of 0.1% (v / v) formic acid. For mass spectrometry analysis, load the peptides onto a trapping column, separate them with a Thermo-Dionex Ultimate 3000 HPLC system (Thermo Fisher Scientific, Waltham, MA, USA), and detect them with an Obitrap Fusion LUMOS Tribrid mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA). The identification of the proteome was performed by the Proteome Discoverer 2.3 software using label-free quantification. The identification results were analyzed and processed using GraphPad Prism 8 and the images were plotted.

[0163] Example 1

[0164] This example describes the preparation and screening of nanobodies that specifically recognize and bind to p62.

[0165] Perform in vitro phage display using a recombinant nanobody library derived from alpaca (from the laboratory of Zengpeng Li, Third Institute of Oceanography, Ministry of Natural Resources, constructed according to the method described by Moutel, S. et al., NaLi-H1: A universal synthetic library of humanized nanobodies providing highly functional antibodies and intrabodies. Elife 5, 2016). Use the human p62 protein (product number Ag13131) purchased from Proteintech as the antigen for three rounds of panning. The antigen concentrations used to coat the immunotubes (purchased from Wiesbaden, Germany) in each round were 50 μM, 25 μM, and 25 μM in sequence.

[0166] Specifically, add 1 mL of the phage library (1×10 13(pfu / mL), incubated with rotation at room temperature for 1 hour. Then, it was washed 5 times with 0.1% PBST (PBS containing 0.1% Tween-20) to remove phages that did not bind to the antigen. Then, 100 mM hydrochloric acid was added and incubated at room temperature for 7 minutes to elute the bound phages. After neutralization with 1 M Tris buffer (pH 7.4), the eluted phages were infected into exponentially growing Escherichia coli TG1 cells and re-amplified. The amplified phages were purified and used for the next round of panning.

[0167] The phage library after three rounds of panning was infected into Escherichia coli again. 96 monoclonal colonies were randomly selected for phage ELISA detection. Screening was carried out by measuring the absorbance value at 450 nm. Among them, monoclonal clones with an absorbance value more than 5 times that of the milk control group were identified as positive clones. A total of 66 VHH single-domain antibodies that specifically bind to human p62 were obtained. Among them, three were identified as being able to bind to the p62 protein, and their antibody sequences are shown in SEQ ID NO: 9, 11, and 13 respectively. The CDR sequences are shown in Table 2 below.

[0168] Table 2: Anti-p62 single-domain antibodies

[0169]

[0170]

[0171] The affinity of the antibody for human p62 protein was measured using BLI, and the results are shown in Figure 1 . The results showed that the affinities of the three anti-P62 single-domain antibodies (collectively referred to as Pn below) for p62 all reached the nanomolar to picomolar level, and all had strong binding abilities.

[0172] Example 2

[0173] This example describes that the p62 nanobody can specifically bind to the recombinant p62 protein fused with a fluorescent label and the endogenous p62 protein in cells.

[0174] The coding nucleotide sequences (SEQ ID NO: 10, 12, 14) of the three single-domain antibodies A1E, D9A, and E12C were respectively inserted between the restriction enzyme cleavage sites Xho I and Apa I of the pcDNA3.1-mCherry-4xGGS-Xho I-Apa I vector to obtain the recombinant vectors pcDNA3.1-mCherry-4xGGS-A1E, pcDNA3.1-mCherry-4xGGS-D9A, and pcDNA3.1-mCherry-4xGGS-E12C, all of which were capable of expressing the fusion protein of mCherry fluorescent label (red) and nanobody (collectively referred to as mCherry-Pn hereinafter).

[0175] The coding nucleotide sequence of human p62 (SEQ ID NO: 8) was inserted between the cleavage sites Xho I and Xba I of the pcDNA3.1-EGFP-4xGGS-Xho I-Xba I vector to obtain the recombinant vector pcDNA3.1-EGFP-4xGGS-p62, and this plasmid was capable of expressing the fusion protein EGFP-P62 of EGFP fluorescent label (green) and p62.

[0176] The three mCherry-Pn expression plasmids and the pcDNA3.1-EGFP-4xGGS-p62 plasmid were co-transfected into U-2OS cells respectively to observe the co-localization of mCherry-Pn and EGFP-p62 in the cells. The co-transfection of pcDNA3.1-mCherry-4xGGS-Xho I-Apa I and EGFP-p62 was used as a control. After culturing for 24 hours, the nuclei of living cells were stained with Hochest 33342 (Thermo Scientific, 62249), and then observed and photographed with a Nikon laser confocal microscope. The Pearson co-localization coefficient of EGFP and mCherry signals was calculated using the Nikon NIS image analysis software to determine the binding ability of the above-mentioned nanobodies to the p62 protein in the cells, and the results are shown in Figure 2 、 Figure 3 。

[0177] Three kinds of mCherry-Pn expression plasmids were co-transfected with the pcDNA3.1-EGFP-4xGGS-p62 plasmid into SQSTM1 gene knockout HEK-293T cells (from the Cui Jun laboratory of Sun Yat-sen University, constructed according to the method described by Xie W. et al., OTUD7B deubiquitinates SQSTM1 / p62 and promotes IRF3 degradation to regulate antiviral immunity. Autophagy, 2022). After culturing for 24 hours, the nuclei of living cells were stained with Hochest33342 (Thermo Scientific, 62249), and then observed and photographed with a Nikon laser confocal microscope. The Nikon NIS image analysis software was used to measure the number of p62 droplets in each cell. The results are shown in Figure 4 in.

[0178] Figure 2 and Figure 3 showed that all three nanobodies could produce obvious co-localization with EGFP-p62 in cells, while the mCherry fluorescent protein used as a control lacked co-localization with EGFP-p62, indicating that the nanobodies of the present invention could all bind to the p62 protein in cells. It should be noted that Figure 4 showed that compared with the control expressing the mCherry fluorescent protein, none of the three nanobodies increased the number of EGFP droplets in cells. The self-aggregation of p62 protein after activation was the key to promoting droplet formation, thus indicating that none of the three nanobodies disclosed in this article could activate the p62 protein after binding to it.

[0179] Three kinds of mCherry-Pn expression plasmids based on A1E, D9A or E12C were also separately transfected into U-2OS cells to observe whether they could specifically bind to and recognize endogenous p62 protein in cells. After culturing the transfected cells for 20 hours, they were starved with Earle's balanced salt solution (EBSS, Procell, PB180337), and at the same time, 200 nM bafilomycin (Baf A1, MCE, HY-100558) was added to block autophagy, thereby stimulating the production of p62 bodies. After 4.5 hours, the cells were fixed with 4% paraformaldehyde and immunofluorescently stained successively with a p62 rabbit polyclonal antibody (MBL, PM045, 1:400), an Alexa Fluor 647 goat anti-rabbit IgG fluorescent secondary antibody (Thermo Scientific, A-11035), and Hochest 33342. The co-localization of the fluorescence signals was observed in the same way as described above. The results are shown in Figure 5 and Figure 6As can be seen from the figure, A1E, D9A, and E12C can also recognize and specifically bind to the endogenous p62 protein in cells, and form obvious co-localization with the endogenous p62 protein.

[0180] Example 3

[0181] This example describes several exemplary target binding sites recognized by p62 nanobodies and their enrichment in the phase-separated droplets of p62 bodies in cells.

[0182] p62 is a multi-domain modular scaffold protein. The PB1 domain at its N-terminus (amino acids 3-102 of SEQ ID NO:7) is involved in mediating p62 oligomerization, and the UBA domain at the C-terminus (amino acids 389-434 of SEQ ID NO:7) is responsible for binding ubiquitin protein. Both are crucial for inducing the occurrence of liquid-liquid phase separation and autophagic degradation of p62 (Sun, D. et al., Polyubiquitin chain-induced p62 phase separation drives autophagic cargo segregation. Cell Res 28, 405-415, 2018). In addition, amino acids 336-341 of the p62 protein serve as the LC3 interaction region (LIR) motif, which is responsible for guiding the targeted binding of the p62 protein to the LC3 protein, and the latter is known to be anchored on the autophagosome membrane (Birgisdottir, A.B. et al., The LIR motif - crucial for selective autophagy. J Cell Sci 126, 3237-3247, 2013).

[0183] Using the coding nucleotide sequence of human p62 as the template sequence, a series of p62 truncated mutants were obtained by PCR method to determine the target binding sites of the nanobodies disclosed herein on the p62 protein. The amplified truncated variant coding sequences were respectively inserted between the restriction enzyme sites Xho I and Xba I of the pcDNA3.1-EGFP-NUP98N-Xho I-Xba I vector to obtain recombinant vectors pcDNA3.1-EGFP-NUP98N-ΔPB1, pcDNA3.1-EGFP-NUP98N-103-330, pcDNA3.1-EGFP-NUP98N-331-388, pcDNA3.1-EGFP-NUP98N-389-440, pcDNA3.1-EGFP-NUP98N-368-407 and pcDNA3.1-EGFP-NUP98N-73-132. Among them, ΔPB1 is the amino acids at positions 103-440 of SEQ ID NO:7, 103-330 is the amino acids at positions 103-330 of SEQ ID NO:7, 331-388 is the amino acids at positions 331-388 of SEQ ID NO:7, 389-440 is the amino acids at positions 389-440 of SEQ ID NO:7, 368-407 is the amino acids at positions 368-407 of SEQ ID NO:7, and 73-132 is the amino acids at positions 73-132 of SEQ ID NO:7 (see Figure 7 ).

[0184] The plasmids with correct sequencing identification were amplified and purified, and co-transfected into U-2OS cells with any one of the Cherry-Pn recombinant plasmids prepared in Example 2. The fluorescence of the co-expressed fusion proteins was observed and measured using a Nikon laser confocal microscope and NIS image analysis software, and the enrichment degree of mCherry signal in the EGFP droplets was calculated:

[0185] mCherry enrichment degree = (I(T) 液滴内 / I(T) 液滴外 ) - (I(C) 液滴内 / I(C) 液滴外 )

[0186] Wherein, I(T) 液滴内 and I(T) 液滴外 respectively represent the average gray value of the mCherry fluorescence signal inside (I(T) 液滴内 ) or outside (I(T) 液滴外 ) the droplets formed by each p62 truncated mutant; I(C) 液滴内 and I(C) 液滴外Represent the average gray value of mCherry fluorescence signals inside (I(C) 液滴内 ) or outside (I(C) 液滴外 ) the droplets formed by the pcDNA3.1-EGFP-NUP98N-Xho I-Xba I vector. The results are shown in Figures 8 to 9 . It can be seen that the three nanobodies bind to different positions of the p62 protein respectively. A1E binds to the UBA domain of p62, D9A binds to amino acids 73-132 of p62, and E12C binds to amino acids 368-407 of p62 ( Figure 10 ).

[0187] Example 4

[0188] This example describes the preparation of an exemplary PDF-Bin based on p62 nanobodies, and the use of this PDF-Bin to recruit an exemplary target protein (POI) to p62 bodies for targeted degradation.

[0189] First, a cell line capable of stably expressing EGFP-POI was constructed. TDP43 is a ubiquitously expressed DNA / RNA-binding protein that is closely associated with amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) (Keating, S.S. et al., TDP-43 pathology: From noxious assembly to therapeutic removal. Prog Neurobiol 211, 102229, 2022). Pathological aggregates of TDP43 in the cytoplasm are closely related to damage to neurons and brain regions, and also drive the disruption of neuromuscular junctions in disease model mice and ALS patients (Neumann, M. et al., Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science 314, 130-133, 2006; Altman, T. et al., Axonal TDP-43 condensates drive neuromuscular junction disruption through inhibition of local synthesis of nuclear encoded mitochondrial proteins. Nat Commun 12, 6914, 2021). In addition, TDP43 has a typical disordered region at the N-terminus, which can oligomerize under physiological conditions to promote its liquid-liquid phase separation (Carter GC et al., N-terminal Domain of TDP43 Enhances Liquid-Liquid Phase Separation of Globular Proteins. J Mol Biol. 2021 May 14;433(10):166948.).

[0190] The recombinant lentiviral vector pLVX-EGFP-TP43 containing the EGFP-TDP43 encoding nucleotide sequence (SEQ ID NO:18) was co-transfected with the packaging plasmids pMD2.G (Addgene, 12259) and psPAX2 (Addgene, 12260) into HEK-293T cells to obtain a viable lentiviral culture medium. The lentiviral culture medium was used to infect HEK-293T cells and U-2OS cells respectively, and finally two stable cell lines were obtained by resistance screening and flow sorting: HEK-293T / EGFP-TDP43 cells and U-2OS / EGFP-TDP43 cells.

[0191] GFP nanobodies (hereinafter referred to as Gn) that have been reported to specifically bind to GFP fluorescent protein, the amino acid sequence and the encoding nucleotide sequence are shown in SEQ ID NO:19 and 20 respectively, see for example Kubala, M.H. et al., Structural and thermodynamic analysis of the GFP:GFP-nanobody complex. Protein Sci 19, 2389-2401, 2010. Using this nanobody Gn as the second binding specificity, the bispecific fusion proteins of the present invention were constructed by conventional molecular cloning techniques: A1E fused with Gn (A1E-Gn), D9A fused with Gn (D9A-Gn), and E12C fused with Gn (E12C-Gn), the amino acid sequences are shown in SEQ ID NO:21-23 respectively, and the encoding nucleotide sequences are shown in SEQ ID NO:24-26 respectively. The nucleotide sequence encoding Gn and the encoding nucleotide sequences of the above three Pn-Gn were inserted between the Xho I and Apa I restriction sites of the pcDNA3.1-mCherry-4xGGS-Xho I-Apa I vector to obtain the recombinant vectors pcDNA3.1-mCherry-4xGGS-Gn, pcDNA3.1-mCherry-4xGGS-A1E-Gn, pcDNA3.1-mCherry-4xGGS-D9A-Gn and pcDNA3.1-mCherry-4xGGS-E12C-Gn for expressing the fusion proteins mCherry-Gn, mCherry-A1E-Gn, mCherry-D9A-Gn and mCherry-E12C-Gn respectively. The formed bispecific fusion proteins have both the binding activity based on Gn that specifically targets the EGFP fusion target protein (EGFP-POI) and the binding activity based on Pn that specifically targets the p62 protein, and are collectively referred to as PDF-Bin in this article.

[0192] Then, the recombinant vectors pcDNA3.1-mCherry-4xGGS-Gn, pcDNA3.1-mCherry-4xGGS-A1E-Gn, pcDNA3.1-mCherry-4xGGS-D9A-Gn, pcDNA3.1-mCherry-4xGGS-E12C-Gn, as well as the blank vector pcDNA3.1-mCherry-4xGGS-Xho I-Apa I, and the recombinant vectors pcDNA3.1-mCherry-4xGGS-A1E, pcDNA3.1-mCherry-4xGGS-D9A, or pcDNA3.1-mCherry-4xGGS-E12C encoding Pn nanobody prepared in Example 2 were separately transfected into the U-2OS / EGFP-TDP43 stable cell line. The cells were fixed 24 hours later. Then, the cells were immunofluorescently stained with rabbit anti-p62 polyclonal antibody (MBL, PM045, 1:400), Alexa Fluor 647 goat anti-rabbit IgG fluorescent secondary antibody (Thermo Scientific, A-11035), and Hochest 33342. Observation and photography were performed using a Nikon laser confocal microscope, and the co-localization of EGFP, mCherry, and Alexa Fluor 647 fluorescence signals was analyzed using Nikon NIS image analysis software. The results are shown in Figures 11 to 14 . The results of fluorescence co-localization showed that no co-localization of the nanobody, EGFP-TDP43, and p62 was observed when the Pn or Gn nanobody was transfected alone ( Figure 11 , 12 ), while obvious co-localization was observed when the PDF-Bin based on A1E and E12C was transfected alone, indicating that they could effectively recruit EGFP-POI into p62 bodies ( Figure 13 , 14 ). No obvious ternary complex formation was observed when the PDF-Bin based on D9A was transfected alone. However, by further co-transfecting the recombinant vector pcDNA3.1-EGFP-4xGGS-p62 into the cells to overexpress the p62 protein, the ternary complex formed by the nanobody, EGFP-TDP43, and p62 could also be detected. The results are shown in Figure 15 .

[0193] Without wishing to be bound by theory, we believe that the above results indicate that although the fusion protein disclosed herein does not contain a ligand capable of directly activating the p62 protein as one of the binding specificities, it can recruit TDP43 and p62 proteins to form a spatially proximal ternary complex, utilize and further amplify the liquid-liquid phase separation property of the TDP43 protein with intrinsically disordered regions, and ultimately promote the oligomerization activation of the p62 protein bound thereto and form p62 bodies that can be observed and detected.

[0194] Using the same vectors as above (empty vector, recombinant vector expressing only one nanobody, and recombinant vector expressing the bispecific binding molecule PDF-Bin of the present invention) were separately transfected into the HEK-293T / EGFP-TDP43 stable cell line. After culturing for 48 hours, total cellular proteins were extracted, and the intracellular content of EGFP-TDP43 was detected by Western blot. For the Western blot, the membrane was first incubated with rabbit anti-p62 polyclonal antibody and goat anti-rabbit conjugated HRP secondary antibody. After visualizing and imaging the results, the membrane was then incubated, visualized, and imaged a second time with rabbit anti-GAPDH polyclonal antibody and goat anti-rabbit conjugated HRP secondary antibody. The results are shown in Figure 16 (left). The gray values of the Western blot bands were quantitatively analyzed using ImageJ FIJI. After normalization according to the gray value of the GAPDH band, the results were analyzed using GraphPad Prism 8 and are shown in Figure 16 (right).

[0195] The results of the Western blot showed that the degradation degree of EGFP-TDP43 was significantly increased in cells transfected with PDF-Bin based on A1E, D9A, or E12C. Combining the above experimental results of fluorescence co-localization, it can be considered that different from the AUTOTEC molecule that must rely on a p62 activation ligand as one of the two targeting heads, the PDF-Bin disclosed herein can promote the formation of p62 bodies by forming a ternary complex, and further promote the degradation of the target protein via p62 bodies.

[0196] Example 5

[0197] This example describes the use of an exemplary PDF-Bin to control the directed degradation of multiple different types of target proteins.

[0198] By conventional molecular cloning methods, the EGFP-TDP43 coding sequence in the pLVX-EGFP-TDP43 vector of Example 2 was replaced with the coding sequences of target proteins G3BP1, hnRNPK, or HTT-Q103 fused with EGFP at the N-terminus, or the coding sequences of target proteins TSPAN4, PD-L1, or APP fused with EGFP at the C-terminus, to construct a series of recombinant vectors as shown in Table 3 below.

[0199] Table 3:

[0200]

[0201] The coding fragment of mCherry-4xGGS-A1E-Gn in Example 4 was amplified by PCR and then homologously recombined between the EcoR I and Age I restriction sites of the pLVX-TETONE-EcoR I-Age I vector to obtain the recombinant vector pLVX-TETONE-mCherry-4xGGS-A1E-Gn, which can produce lentivirus with the assistance of packaging plasmids and express the mCherry-A1E-Gn fusion protein under the induction of DOX.

[0202] Using the pLVX-TETONE-mCherry-4xGGS-A1E-Gn recombinant vector, lentivirus culture medium was prepared and used to infect HEK-293T cells and U-2OS cells respectively according to the same method as in Example 4. Finally, the following two stably transfected cell lines were obtained by resistance screening and flow sorting: HEK-293T / A1E-Gn TRE cells and U-2OS / A1E-Gn TRE cells, both of which can express the mCherry-A1E-Gn fusion protein under the induction of DOX.

[0203] The recombinant vectors pLVX-EGFP, pLVX-EGFP-G3BP1, pLVX-EGFP-hnRNPK, pLVX-EGFP-HTT-Q103, pLVX-TSPAN4-EGFP, pLVX-PD-L1-EGFP and pLVX-APP-EGFP were respectively transfected into U-2OS / A1E-Gn TRE cells. After 6 hours, the medium was replaced with fresh medium containing 1 μg / mL DOX or the same volume of DMSO, and the cells were cultured for another 24 hours. Subsequently, the cells were immunofluorescently stained with rabbit anti-p62 polyclonal antibody and Alexa Fluor 647 goat anti-rabbit IgG fluorescent secondary antibody. Observation and photography were performed using a Nikon laser confocal microscope, and the Pearson colocalization coefficient of EGFP and Alexa Fluor 647 fluorescence signals was analyzed using Nikon NIS image analysis software. The results are shown in Figures 17A~17H and Figure 18 below.

[0204] Confocal imaging results showed that all target proteins were independently distributed when transfected alone, lacking co-localization with p62 bodies. After inducing the expression of mCherry-A1E-Gn(PDF-Bin) by DOX, all EGFP-POIs except EGFP protein were enriched into p62 bodies, forming a co-localized ternary complex with PDF-Bin. Without wishing to be bound by theory, we believe that this may be because the EGFP protein has a highly ordered structure and good solubility, and has a low or even lack of tendency to undergo liquid-liquid phase separation under physiological conditions. Therefore, in normal cells with low autophagy levels, no visible p62 bodies promoted by PDF-Bin were detected. On the other hand, intrinsically disordered proteins, proteins with intrinsically disordered regions, or membrane proteins all have a tendency to phase separate or membrane anchor under physiological conditions. Therefore, for various different target proteins, the PDF-Bin disclosed in this article can effectively promote the formation of p62 bodies by utilizing the above characteristics of the target proteins, generating obvious co-localized spots.

[0205] The above eight recombinant vectors, pLVX-EGFP, pLVX-EGFP-G3BP1, pLVX-EGFP-hnRNPK, pLVX-EGFP-HTT-Q103, pLVX-TSPAN4-EGFP, pLVX-PD-L1-EGFP, and pLVX-APP-EGFP, were respectively transfected into HEK-293T / A1E-Gn TRE cells or wild-type HEK-293T cells as a control. After 6 hours, the medium was replaced with fresh medium containing 1 μg / mL DOX or the same volume of DMSO, and the cells were cultured for another 48 hours. Subsequently, total cell proteins were extracted, and EGFP rabbit polyclonal antibody or mCherry rabbit polyclonal antibody was used as the primary antibody for the first incubation. Protein immunoblotting detection was performed by the same method as in Example 4, and the results are shown in Figure 19A . For the electrophoretic bands in the figure, the gray values were quantitatively analyzed using ImageJ FIJI, and the degradation degree of EGFP-POI was calculated as follows:

[0206]

[0207] All gray values were normalized by the gray value of the GAPDH band, analyzed and processed using GraphPad Prism 8, and the results are shown in Figure 19B .

[0208] The results of the above Western blot were consistent with those of fluorescence colocalization, indicating that the PDF-Bin disclosed herein, while promoting the formation of the target protein-fusion protein-p62 ternary complex, also showed a significant increase in the directed degradation efficiency to varying degrees in the case of target proteins with intrinsically disordered regions. Without wishing to be bound by theory, we believe that the effect of the directed degradation mediated by the multi-specific fusion protein PDF-Bin disclosed herein is likely related to the degree of disorder of the target protein and its tendency for liquid-liquid phase separation / self-aggregation. For proteins with a high degree of intrinsic disorder, they are prone to trigger liquid-liquid phase separation and self-aggregation, and it is easy to achieve an obvious directed degradation effect when using the multi-specific fusion protein disclosed herein. Therefore, they become good drug targets for the multi-specific fusion protein disclosed herein, which is difficult to achieve when using activation ligands that require an ordered structure as binding sites and small molecule compounds as the targeting heads.

[0209] Example 6

[0210] This example describes the kinetic study of the directed degradation of the target protein mediated by the exemplary PDF-Bin.

[0211] The pLVX-EGFP-TDP43 plasmid was transfected into the U-2OS / A1E-Gn TRE cells prepared in Example 5 to finally obtain the stably transfected monoclonal cell line U-2OS / EGFP-TDP43; A1E-Gn TRE .

[0212] After inoculating the stably transfected cell line into a 12-well culture plate and culturing for 12-18 hours, it was replaced with fresh medium containing 1 μg / mL DOX or the corresponding volume of DMSO and cultured for another 24 hours. Then, a part of the cells was used to extract total cellular proteins, and Western blot detection was performed by the same method as in Example 4 (using rabbit anti-EGFP polyclonal antibody or rabbit anti-p62 polyclonal antibody or rabbit anti-mCherry polyclonal antibody as the primary antibody, and goat anti-rabbit conjugated HRP secondary antibody); another part of the cells was used to extract total RNA in the cells by a rapid RNA extraction kit (MF159) for qPCR detection. Each gene was independently repeated 2 times, and each treatment method was independently repeated 3 times. Using RPL13A as the normalization internal reference, the normalized fold change of each target gene was calculated. The results are shown in Figure 20 . The results showed that this cell line could stably and continuously express the EGFP-TDP43 fusion protein, and the expression level of the mCherry-A1E-Gn fusion protein could be significantly increased under DOX induction (data not shown). Moreover, no statistically significant effect of A1E-Gn on the expression of EGFP-TDP43 and other proteins at the transcriptional (mRNA) level was observed.

[0213] After inoculating the stable cell line into a 12-well culture plate and culturing for 12 - 18 hours, the medium was replaced with fresh medium containing 1 μg / mL DOX or the corresponding volume of DMSO, and the cells were further cultured for 24 hours. Using the same fluorescence confocal observation and analysis method as in Example 3, the Pearson colocalization coefficient of EGFP and Alexa Fluor 647 fluorescence signals was determined, and the number of p62 bodies was counted simultaneously. The results are shown in Figure 21A and Figure 21B . In addition, after culturing the stable cells with the medium replaced as described above for another 48 hours, immunoprecipitation combined with mass spectrometry (IP-MS) was performed, and the results are shown in Figure 22 .

[0214] The results of fluorescence confocal imaging and IP-MS showed that after inducing the expression of A1E-Gn with DOX, the formation of a ternary complex of EGFP-TDP43, mCherry-A1E-Gn, and p62 was promoted, indicating that A1E-Gn could recruit EGFP-TDP43 to p62 bodies ( Figure 21A ). Meanwhile, the number of p62 bodies increased significantly by about 6-fold ( Figure 21B ), meaning that increasing the interaction between TDP43 and p62 could promote the liquid-liquid phase separation of p62, thus facilitating the subsequent degradation process. Moreover, after adding DOX, it was observed that A1E-Gn only recruited TDP43 to p62 bodies ( Figure 22 ), and had no recruitment effect on proteins other than TDP43, indicating that the PDF-Bin disclosed herein has significant specificity as a protein-targeted degradation tool.

[0215] Subsequently, through a series of detections with time gradients and DOX concentration gradients, the kinetic process of A1E-Gn-mediated directional degradation of EGFP-TDP43 was characterized ( Figures 23 to 28 ). After inoculating the above-mentioned stable cells into a 12-well culture plate and culturing for 12 - 18 hours, the medium was replaced with fresh medium containing 1 μg / mL DOX, and the cells were further cultured for 12, 24, 36, 48, 60, or 72 hours, or the medium was replaced with fresh medium containing a specified concentration (0, 0.025, 0.05, 0.1, 0.25, 0.5, 0.75, 1, 2.5, 5, 7.5, 10 μg / mL) of DOX and cultured for 48 hours. The changes in the fluorescence signals excited by the cells under laser confocal microscopy snapshots were observed, and the results are shown in Figure 23 , 24 ; total cell proteins were extracted for Western blot detection, and the results are shown in Figure 25 , 26 . The results showed that the fluorescence signal of EGFP-TDP43 decreased significantly 12 hours after adding DOX ( Figure 23, 24 ), the target protein reaches the maximum degree of degradation after 36 to 48 hours ( Figure 25 and Figure 26 ). In addition, the results of the concentration gradient experiment show that the degradation of the target protein mediated by A1E-Gn is also concentration-dependent, and the degradation effect is enhanced with the increase of the DOX concentration ( Figure 27 、 Figure 28 ).

[0216] Example 7

[0217] This example describes the pathway study of the targeted degradation of the exemplary PDF-Bin-mediated target protein.

[0218] The stably transfected monoclonal cell line U-2OS / EGFP-TDP43; A1E-Gn prepared in Example 6 TRE was inoculated into a 12-well culture plate and cultured for 12 to 18 hours, and then replaced with fresh medium containing 1 μg / mL DOX or the corresponding volume of DMSO and continued to be cultured. After 12 hours, 1 μM proteasome inhibitor MG-132 or 200 nM lysosomal acidification inhibitor bafilomycin A1 (Baf A1) was added to the designated experimental groups and continued to be cultured for 36 hours. Subsequently, the total cell protein was extracted and detected by Western blot. The results are shown in Figure 29 .

[0219] The above results show that there is no statistically significant change in the content of EGFP-POI before and after Baf A1 treatment, while after MG-132 treatment, the content of EGFP-POI increases significantly, indicating that the proteasome inhibitor can significantly inhibit the occurrence of A1E-Gn-mediated targeted degradation. If a proteasome inhibitor and an autophagy inhibitor are added simultaneously, the degradation of the target protein can be almost completely inhibited ( Figure 30 ). This indicates that the degradation mediated by A1E-Gn mainly depends on the proteasome pathway.

[0220] In addition, Figures 31 to 33 it also shows that the protein level of p62 increases significantly under DOX treatment, but its mRNA content has no statistically significant change. It indicates that A1E-Gn can also reduce the degradation of p62 protein itself, causing the cell to accumulate more p62 protein. This phenomenon is consistent with the degradation of A1E-Gn mainly depending on the proteasome pathway. Because p62 protein may be more involved in the proteasome degradation pathway through its interaction with PDF-Bin, avoiding its fate of being degraded in the autophagolysosome.

[0221] Example 8

[0222] This example describes the preparation of another exemplary PDF-Bin molecule and the study of its properties related to the targeted degradation of target proteins.

[0223] Signal transducer and activator of transcription 3 (STAT3), as a convergence node of many cancer-related signaling pathways, is ubiquitously expressed in various cell types and is activated by interleukins, interferons, growth factors, and kinases such as SRC and MET. Constitutive activation of STAT3 occurs in various cancers such as non-small cell lung cancer (NSCLC), melanoma, lymphoma, and leukemia, as well as in non-cancerous cells in the tumor microenvironment, and plays a key role in regulating cancer cell proliferation, differentiation, and angiogenesis. Although STAT3 is a promising cancer treatment target, it is generally recognized as having poor druggability. To date, only a few STAT3-targeted antisense oligonucleotides (ASOs) or PROTACs have been developed that can effectively reduce the mRNA or protein levels of STAT3 and show certain anti-tumor activities. It has been reported that the C-terminal transactivation domain (TAD) of STAT3 is highly disordered, and these more than 50 amino acid residues form an intrinsically disordered region (see Jacopo Sgrignani et al., Structural Biology of STAT3 and Its Implications for Anticancer Therapies Development. Int. J. Mol. Sci. 2018, 19(6), 1591). In this example, another exemplary PDF-Bin was prepared using the endogenous STAT3 protein in tumor cells as the target to explore the degradation effect of the PDF-Bin molecule disclosed herein on endogenous targets and its anti-tumor potential.

[0224] This example uses the previously reported STAT3 antibody analogue (monobody) MS3-6 (La Sala, G. et al., Selective inhibition of STAT3 signaling using monobodies targeting the coiled-coil and N-terminal domains. Nat Commun 11, 4115, 2020), which can specifically recognize and bind to the core fragment of STAT3. The nucleotide fragment encoding the fusion protein of EGFP fluorescent protein label, p62 nanobody A1E, and MS3-6 (SEQ ID NO: 39) and the nucleotide fragment encoding the fusion protein of EGFP, A1E, and mCherry fluorescent protein nanobody Cn (SEQ ID NO: 16) were inserted between the restriction enzyme sites EcoR I and Age I of the pLVX-TETONE-EcoR I-Age I vector to obtain the recombinant vectors pLVX-TETONE-EGFP-A1E-MS3-6 and pLVX-TETONE-EGFP-A1E-Cn, respectively. They can generate lentiviruses with the assistance of packaging plasmids and express the EGFP-A1E-MS3-6 and EGFP-A1E-Cn fusion proteins respectively under the induction of DOX.

[0225] The above recombinant vectors were co-transfected with the packaging plasmid into HEK-293T cells to obtain viable lentivirus culture medium. The A549 cells were infected with the lentivirus culture medium, and finally the A549 / EGFP-A1E-MS3-6 TRE and A549 / EGFP-A1E-Cn TRE cell lines were obtained through resistance screening and flow sorting.

[0226] Immunofluorescence Confocal Localization

[0227] The A549 / EGFP-A1E-MS3-6 TRE cells were seeded into a 4-well glass-bottom culture dish and cultured for 12-18 hours, and then replaced with fresh medium containing 1 μg / mL DOX or the corresponding volume of DMSO and cultured for another 24 hours. The cells were immunofluorescently stained with rabbit anti-STAT3 polyclonal antibody and Alexa Fluor 546 goat anti-rabbit IgG fluorescent secondary antibody, as well as mouse anti-p62 monoclonal antibody and Alexa Fluor 647 goat anti-mouse IgG fluorescent secondary antibody. Observation and photography were performed using a Nikon laser confocal microscope. The Nikon NIS image analysis software was used to analyze the enrichment degree of STAT3 fluorescent signal in p62 bodies and the number of p62 bodies, and the results were analyzed and processed using GraphPad Prism 8 and are shown inFigures 34 to 36 。

[0228] Among them, the calculation method of the enrichment degree of STAT3 fluorescence signal is as follows:

[0229]

[0230] I(in) represents the average fluorescence intensity of STAT3 in p62 bodies, and I(out) represents the average fluorescence intensity of STAT3 outside p62 bodies (inside the cell).

[0231] The results showed that after inducing the expression of A1E-MS3-6 by DOX, STAT3 was significantly recruited into p62 bodies ( Figures 34 to 36 ), and the number of p62 bodies was significantly increased ( Figure 36 ), proving that A1E-MS3-6 can interact with p62 and STAT3 proteins to form a ternary complex, and the liquid-liquid phase separation property of STAT3 promotes the formation of p62 condensates.

[0232] Time Gradient Degradation and Concentration Gradient Degradation

[0233] Subsequently, A549 / EGFP-A1E-MS3-6 TRE After the stable transfected cells were seeded in a 12-well culture plate and cultured for 12 - 18 hours, they were replaced with fresh medium containing 1 μg / mL DOX and continued to be cultured for 6, 12, 18, 24, 30, 36, 42, or 48 hours, or replaced with fresh medium containing a specified concentration (0, 0.05, 0.1, 0.25, 0.5, 1 μg / mL) of DOX and continued to be cultured for 48 hours. Then, the total cell protein was extracted for Western blot detection, and the results are shown in Figures 37 to 40 . The results showed that the level of endogenous STAT3 protein began to decrease 6 hours after adding DOX ( Figure 37 、 Figure 38 ). Moreover, the degradation of the target protein mediated by this exemplary PDF-Bin also showed a DOX dose-dependence ( Figure 39 、 Figure 40 ).

[0234] Degradation Inhibitor Detection of Degradation Pathway

[0235] We also studied the pathway of A1E-MS3-6-mediated targeted degradation of STAT3 by the same method as in Example 7. A549 / EGFP-A1E-MS3-6 TREAfter the stable transfected cells were seeded into a 12-well culture plate and cultured for 12 - 18 hours, the medium was replaced with fresh medium containing 1 μg / mL DOX or the corresponding volume of DMSO, and the cells were cultured for another 12 hours. Then, in the designated experimental groups, 1 μM proteasome inhibitor MG-132 or 200 nM lysosomal acidification inhibitor bafilomycin A1 (Baf A1) was added, and the cells were cultured for another 36 hours. Subsequently, total cell proteins were extracted for Western blot analysis. The results are shown in Figure 41 , Figure 42 . As can be seen from the figures, different from the situation when degrading EGFP-TDP43, treatment with the proteasome inhibitor had no statistically significant effect on the content of endogenous STAT3. On the contrary, Baf A1, as an autophagy inhibitor, could significantly inhibit the degradation of STAT3. This indicates that the degradation mediated by A1E-MS3-6 mainly depends on the autophagy-lysosome pathway. We think this is probably because unactivated STAT3 is located in the cytoplasm, and p62 in the cytoplasm mainly functions as a selective autophagy receptor to play a role in degradation, resulting in this difference.

[0236] Half-life of p62 Protein

[0237] The A549 / EGFP-A1E-MS3-6 TRE stable transfected cells were seeded into a 12-well culture plate and cultured for 12 - 18 hours. Then, the medium was replaced with fresh medium containing 1 μg / mL DOX or the corresponding volume of DMSO and cultured for another 12 hours. Subsequently, 100 μg / mL protein synthesis inhibitor cycloheximide (CHX) was added and the cells were treated for 4, 8, or 12 hours. 0 hour represents no CHX treatment. Subsequently, total cell proteins were extracted for Western blot analysis. The Western blot results were visualized using the same method as in Example 4, and the gray value of the p62 band was quantitatively analyzed. All gray values were normalized by the gray value of the GAPDH band. The results are shown in Figure 43 , Figure 44 .

[0238] Treatment with CHX excluded the interference of p62 protein synthesis on the Western blot results, showing that PDF-Bin induced by DOX significantly shortened the half-life of p62 protein in cells, meaning that A1E-MS3-6 can significantly increase the clearance rate of p62 itself. This phenomenon is consistent with the degradation of A1E-MS3-6 mainly depending on the lysosomal pathway, because more p62 proteins participate in the degradation of STAT3 through the lysosomal pathway, while shortening the half-life of p62 itself.

[0239] Example 9

[0240] This example describes the inhibitory effect on tumor cells after treating tumor cells with the exemplary PDF-Bin of the present invention.

[0241] Specifically, non-small cell lung cancer cell line A549 was treated with EGFP-A1E-MS3-6 described above, and the fusion protein of A1E and anti-mCherry nanobody (A1E-Cn) was used as a control (Fridy, P.C. et al., A robust pipeline for rapid production of versatile nanobody repertoires. Nat Methods 11, 1253-1260, 2014). The migration speed of tumor cells was evaluated by scratch assay, and the proliferation ability of tumor cells was evaluated by colony formation assay.

[0242] Wound Healing Assay

[0243] The A549 / EGFP-A1E-MS3-6 TRE stable transfected cells were seeded into 6-well plates. After culturing for 12-18 hours, the medium was replaced with fresh medium containing the specified concentration of DOX or the corresponding volume of DMSO. The cells were cultured for 48 hours until they reached 90-100% confluence. Then, a scratch was made in the well plate using a 200 μL pipette tip. The medium was replaced with DMEM medium containing 2% fetal bovine serum, 50 μg / ml penicillin / streptomycin, and the corresponding concentration of DOX or DMSO. Immediately afterwards, the scratch was photographed using a 4x objective of a Nikon inverted microscope and counted as 0 hour. After the photographing was completed, the cells were continued to be cultured and photographed again after 24 hours, counted as 24 hours. The results are shown in Figure 45 . The scratch area was measured using ImageJ FIJI, and the wound healing rate was calculated using the following formula to normalize the wound healing efficiency:

[0244]

[0245] where S (t＝0h) and S (t＝24h) represent the wound areas at 0 hour and 24 hours respectively. GraphPad Prism 8 was used to draw the images and statistically analyze the significance. The results are shown in Figure 47 (left).

[0246] Colony Formation Assay

[0247] The A549 / EGFP-A1E-MS3-6 TREStably transfected cells were seeded into 12-well plates at 400 cells / well. After culturing for 12 - 18 hours, the medium was replaced with fresh medium containing the specified concentration of DOX or the corresponding volume of DMSO. The medium containing DOX was changed every 48 hours to prevent DOX from losing its effectiveness. After 9 days of DOX treatment, the cells were fixed with 4% paraformaldehyde at room temperature for 15 minutes, and then stained with crystal violet staining solution for 10 - 20 minutes until cell clones were visible to the naked eye and showed a deep purple color. The cells were rinsed three times with ultrapure water, and then pictures were taken with a SONY IMX800 camera. The results are shown in Figure 46 . The number of clones was calculated using Image J, and the images were plotted and the significance was statistically analyzed using GraphPad Prism 8. The results are shown in Figure 47 (right).

[0248] As can be seen from the above results, compared with the tumor cells treated with the control molecule, the migration ability and proliferation ability of the tumor cells treated with A1E-MS3-6 were significantly reduced ( Figure 47 ), indicating that the PDF-Bin disclosed herein has the potential to become a tumor inhibitor or even a therapeutic agent.

[0249] Example 10

[0250] This example describes that the induced degradation ability of the PDF-Bin molecule of the present application can be enhanced by an oligomerization element or a phase separation element.

[0251] By the same method as in Example 4, the following PDF-Bin molecules were prepared respectively:

[0252] A PDF-Bin molecule was formed by fusing the monobody molecule PmSE10 (SEQ ID NO: 67) specifically targeting human p62 protein and the monobody molecule Tm12D (SEQ ID NO: 77) specifically targeting human TDP43 protein through the flexible linker shown in SEQ ID NO: 50, hereinafter simply referred to as PmSE10-Tm12D;

[0253] A PDF-Bin molecule was formed by fusing the nanobody PnA5 (SEQ ID NO: 72) specifically targeting human p62 protein and Tm12D through the flexible linker shown in SEQ ID NO: 50, hereinafter simply referred to as PnA5-Tm12D.

[0254] The following oligomerization elements or phase separation elements were respectively fused to the C-terminus of the above PmSE10-Tm12D or PnA5-Tm12D, and were connected by a flexible linker in the middle to obtain an enhanced PDF-Bin molecule:

[0255] Tetramerization domain: SEQ ID NO:60;

[0256] Tetradecamerization domain: SEQ ID NO:61;

[0257] Hexamerization domain: SEQ ID NO:62;

[0258] NUP98_IDR: SEQ ID NO:63;

[0259] FUS_IDR: SEQ ID NO:64;

[0260] SFPQ_IDR: SEQ ID NO:65;

[0261] P2S2: SEQ ID NO:66.

[0262] The nucleotide sequences encoding the above-mentioned PDF-Bin molecules and enhanced PDF-Bin molecules were respectively inserted between the Xho I and Apa I restriction sites of the pcDNA3.1-mCherry-4xGGS-Xho I-Apa I vector for expressing the above-mentioned PDF-Bin molecules respectively. Then, the above-mentioned recombinant vectors and the blank vector pcDNA3.1-mCherry-4xGGS-Xho I-Apa I were separately transfected into U-2OS cells, and the cells were fixed 48 hours later. Then, the cells were immunofluorescently stained with rabbit anti-TDP43 polyclonal antibody (Proteintech, 10782-2-AP, 1:400), mouse anti-p62 polyclonal antibody (MBL, M162-3, 1:400), AlexaFluor 488 goat anti-rabbit IgG fluorescent secondary antibody (A-11034, 1:200), Alexa Fluor 647 goat anti-mouse IgG fluorescent secondary antibody (Thermo Scientific, A-21236, 1:200) and Hochest 33342. Observation and photography were performed using a Nikon laser confocal microscope. The average fluorescence intensities of Alexa Fluor488 and mCherry fluorescence signals were analyzed using Nikon NIS image analysis software. Images were plotted and non-linear fitting was performed using GraphPad Prism 8. The results are shown in Figures 48 to 50 .

[0263] As can be seen from the figure, after the PDF-Bin molecule of the present application is connected in series with the oligomerization or phase separation element, the condensation and activation of p62 bodies can be further enhanced, and the enhancement amplitude shows a certain dependence on the oligomerization degree or phase separation intensity. Through such enhanced PDF-Bin molecules, the targeted degradation activity of the target protein can be improved. At the same time, it should be understood that the regulation of the target protein-related pathway will also be enhanced, such as the killing activity against related tumors.

[0264] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including those that depart from the scope disclosed in this application and are made by using conventional techniques known in the art. Some basic features can be applied according to the scope of the appended claims below.

Claims

1. A multispecific fusion protein comprising at least one first affinity peptide that specifically binds to the autophagy receptor p62 protein and at least one second affinity peptide that specifically binds to a target, wherein the first affinity peptide and the second affinity peptide are optionally covalently linked by a linker sequence.

2. The fusion protein according to claim 1, which is capable of forming a ternary complex comprising the fusion protein, the p62 protein, and the target when the p62 protein and the target coexist; Optionally, compared with the situation where the fusion protein is absent, the fusion protein increases the liquid-liquid phase separation of the p62 protein, Optionally, the increase in the liquid-liquid phase separation is selected from any one of the following or any combination thereof: an increase in the number of liquid-liquid phase separation droplets containing the p62 protein, an increase in the area of the liquid-liquid phase separation droplets containing the p62 protein, an increase in the degree of oligomerization of the p62 protein in the liquid-liquid phase separation droplets containing the p62 protein, and a decrease in the mobility of the p62 protein in the liquid-liquid phase separation droplets containing the p62 protein. Optionally, the target is an intrinsically disordered protein, a protein with intrinsically disordered regions, or an aggregate protein, membrane complex, and / or organelle containing the intrinsically disordered protein or the protein with intrinsically disordered regions as monomers or components; Optionally, the intrinsically disordered region in the protein with intrinsically disordered regions contains about 30 or more consecutive amino acid residues; Optionally, the target is selected from cytoplasmic proteins, nuclear proteins, membrane proteins, or organelles; Optionally, the target is any one selected from the group consisting of TDP43, hnRNPK, G3BP1, HTT-Q103, TSPAN4, PD-L1, APP, and STAT3; Optionally, the first affinity peptide and the second affinity peptide are each independently selected from nanobodies or synthetic binding proteins; Optionally, the nanobody is selected from single-domain antibodies, single-chain antibodies (scFv), minibodies, half-antibodies, or antigen-binding fragments of antibodies; preferably, the single-domain antibody is selected from V H H domain antibodies, heavy chain variable domain (VH) antibodies, V NAR domain antibodies, V L domain antibodies; Optionally, the synthetic binding protein is selected from monobodies, affibodies, anticalins, or DARPins; Optionally, the first affinity peptide comprises CDR1, CDR2, and CDR3 selected from any one of SEQ ID NO:9, 11, 13, 67, or 72; Optionally, the CDR1, CDR2, and CDR3 comprised in the first affinity peptide have the amino acid sequences shown in SEQ ID NO:51 to 53; the amino acid sequences shown in SEQ ID NO:54 to 56; the amino acid sequences shown in SEQ ID NO:57 to 59; the amino acid sequences shown in SEQ ID NO:68 to 70; or the amino acid sequences shown in SEQ ID NO:73 to 75, respectively; Optionally, the first affinity peptide comprises the amino acid sequence shown in SEQ ID NO:9, 11, 13, 67, or 72; Optionally, the second affinity peptide comprises CDR1, CDR2, and CDR3 selected from SEQ ID NO:19 or 77; Optionally, the second affinity peptide comprises CDR1, CDR2, and CDR3 having the amino acid sequences shown in SEQ ID NOs: 78 to 80, respectively; or the amino acid sequences shown in SEQ ID NOs: 81 to 83. Optionally, the second affinity peptide comprises the amino acid sequence shown in SEQ ID NO: 19 or 77. Optionally, the linker sequence or linker is a rigid or flexible linker, preferably a flexible linker, more preferably a linker comprising the sequence shown in SEQ ID NO:

50. Optionally, the fusion protein further comprises an oligomerization element, which is directly covalently linked to the first affinity peptide and / or the second affinity peptide or covalently linked through a linker sequence / linker. Optionally, each fusion protein comprises one or more of the oligomerization elements, preferably one. Optionally, the oligomerization element is a dimer or higher oligomeric oligomerization domain, preferably a tetramer or higher oligomeric oligomerization domain, more preferably an octamer or higher oligomeric oligomerization domain, most preferably a dodecamer or higher oligomeric oligomerization domain. Optionally, the oligomerization element comprises the amino acid sequence shown in any one of SEQ ID NOs: 60 to 62, or comprises an amino acid sequence having at least 90% identity with any one of SEQ ID NOs: 60 to 62, or comprises an amino acid sequence having one or several deletions, substitutions, or additions compared to any one of SEQ ID NOs: 60 to 62. Optionally, the fusion protein further comprises a phase separation element, which is directly covalently linked to the first affinity peptide and / or the second affinity peptide or covalently linked through a linker sequence / linker. Optionally, each fusion protein comprises one or more of the phase separation elements. Optionally, the phase separation element comprises the amino acid sequence shown in any one of SEQ ID NOs: 63 to 66, or comprises an amino acid sequence having at least 90% identity with any one of SEQ ID NOs: 63 to 66, or comprises an amino acid sequence having one or several deletions, substitutions, or additions compared to any one of SEQ ID NOs: 63 to 66. Optionally, the fusion protein further comprises an element beneficial for delivery, preferably an element beneficial for delivering it to a target site, and the element is optionally selected from a cell-penetrating peptide, a nuclear localization signal, an organelle localization signal, an endoplasmic reticulum retention signal, a peroxisome targeting signal, a mitochondrial transit peptide. Optionally, the fusion protein comprises one first affinity peptide and one second affinity peptide, or one first affinity peptide and two or more identical or different second affinity peptides, or two or more identical or different first affinity peptides and one second affinity peptide, or two or more identical or different first affinity peptides and two or more identical or different second affinity peptides.

3. A nucleic acid comprising a nucleotide sequence encoding the fusion protein according to claim 1 or 2. Optionally, the coding nucleotide sequence is operably linked to a promoter.

4. A recombinant vector, which comprises the nucleic acid according to claim 3, optionally, the vector is a recombinant viral vector.

5. An engineered cell, which expresses the fusion protein according to claim 1 or 2, the nucleic acid according to claim 3, or the recombinant vector according to claim 4.

6. A method for producing a fusion protein, which comprises expressing the nucleic acid according to claim 3 or the recombinant vector according to claim 4 in a suitable host cell, or culturing the engineered cell according to claim 5, and purifying the expressed fusion protein.

7. A composition, which comprises the fusion protein according to claim 1 or 2, the nucleic acid according to claim 3, or the recombinant vector according to claim 4, or the engineered cell according to claim 5.

8. A method for degrading a target in a cell, which comprises causing a cell to express the fusion protein according to claim 1 or 2, the nucleic acid according to claim 3, or the recombinant vector according to claim 4, and reducing the amount of the target by an amount less than that in the absence of the fusion protein, the nucleic acid or the recombinant vector, preferably reducing by at least about 30 to 90%.

9. A method for preventing and / or treating a disease, which comprises administering to a subject the fusion protein according to claim 1 or 2, the nucleic acid according to claim 3, the recombinant vector according to claim 4, the engineered cell according to claim 5, or the composition according to claim 7, optionally, the disease is selected from diseases associated with protein misfolding, misaggregation or misproduction, preferably, the disease is selected from neurodegenerative diseases, cardiovascular diseases, neuromuscular diseases, tumors, metabolic diseases or autoimmune diseases, optionally, the neurodegenerative disease is selected from Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis, hereditary ataxia, Vici syndrome or BPAN syndrome, optionally, the cardiovascular disease is selected from coronary artery disease, atherosclerosis or pulmonary arterial hypertension, optionally, the neuromuscular disease is selected from hereditary cardiomyopathy, distal myopathy, muscular dystrophy, congenital myopathy, spinal muscular atrophy (SMAs), motor neuron disease, Duchenne muscular dystrophy, Becker muscular dystrophy, limb-girdle muscular dystrophy, myotonic dystrophy, myotubular myopathy, central core myopathy, nemaline myopathy, selenoprotein N-related myopathy, Pompe disease, glycogen storage disease III or amyotrophic lateral sclerosis, Optionally, the tumor is selected from lung cancer, colorectal cancer, head and neck cancer (e.g., head and neck squamous cell carcinoma), glioma (e.g., glioblastoma), neuroblastoma, melanoma, breast cancer, bladder cancer, kidney cancer, ovarian cancer, pancreatic cancer, cervical cancer, esophageal cancer, sarcoma, esophageal cancer (e.g., esophageal squamous cell carcinoma), thyroid cancer (e.g., papillary thyroid carcinoma), or prostate cancer, B-cell lymphoma, chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia, diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, myelodysplastic syndrome (MDS), non-Hodgkin lymphoma (NHL), acute lymphocytic leukemia (ALL), acute monocytic leukemia, multiple myeloma, acute myelogenous leukemia (AML), mixed lineage leukemia, NUT midline carcinoma, Burkitt lymphoma, or mycosis fungoides (MF), or metastatic forms thereof. Optionally, the metabolic disease is selected from hyperlipidemia, atherosclerosis, non-alcoholic fatty liver, or diabetes. Optionally, the autoimmune disease is selected from systemic lupus erythematosus, atopic dermatitis, myasthenia gravis, type I diabetes, sarcoidosis, asthma, graft-versus-host disease, autoimmune arthritis, rheumatoid arthritis, Sjogren's syndrome, psoriasis, multiple sclerosis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, uveitis, or polychondritis.

10. A method for screening a multispecific fusion protein, comprising the steps of: (a) Obtaining one or more first affinity peptides capable of specifically binding to the autophagy receptor p62 protein, and one or more second affinity peptides capable of specifically binding to a target, and covalently linking at least one of the first affinity peptides with at least one of the second affinity peptides, optionally via a linker sequence or a linker, to obtain a candidate fusion protein library; (b) Selecting from the library a candidate fusion protein that significantly increases the co-localization of the p62 protein with the target as compared to a control in which the candidate fusion protein is absent; (c) Selecting from the candidate fusion proteins selected in step (b) a fusion protein that increases the liquid-liquid phase separation of the p62 protein as compared to a control in which the candidate fusion protein is absent; Optionally, the increase in the liquid-liquid phase separation in step (c) is selected from any one of the following or any combination thereof: an increase in the number of liquid-liquid phase separation droplets containing the p62 protein, an increase in the area of the liquid-liquid phase separation droplets containing the p62 protein, an increase in the degree of oligomerization of the p62 protein in the liquid-liquid phase separation droplets containing the p62 protein, or a decrease in the mobility of the p62 protein in the liquid-liquid phase separation droplets containing the p62 protein; Optionally, the target is an intrinsically disordered protein, a protein having an intrinsically disordered region, or a protein containing an intrinsically disordered protein or the protein having an intrinsically disordered region, or an aggregate protein, membrane complex, and / or organelle containing an intrinsically disordered protein or the protein having an intrinsically disordered region as a monomer or a component. Optionally, the target is selected from cytoplasmic proteins, nuclear proteins, membrane proteins or organelles; Optionally, the target is any one selected from the group consisting of TDP43, hnRNPK, G3BP1, HTT-Q103, TSPAN4, PD-L1, APP, STAT3; Optionally, the method further includes step (d) of measuring the level of the target and selecting a fusion protein in which the amount of the target is reduced compared to a control without the candidate fusion protein; preferably, the amount of the target is reduced by at least about 30-90%; Optionally, the first affinity peptide and the second affinity peptide are each independently selected from nanobodies or synthetic binding proteins; Optionally, the nanobody is selected from single-domain antibodies, single-chain antibodies (scFv), minibodies, half-antibodies, or antigen-binding fragments of antibodies; preferably, the single-domain antibody is selected from V H H domain antibodies, heavy chain variable domain (VH) antibodies, V NAR domain antibodies, V L domain antibodies; Optionally, the synthetic binding protein is selected from monobody, affibody, anticalin or DARPin; Optionally, the first affinity peptide comprises CDR1, CDR2 and CDR3 selected from any one of SEQ ID NO: 9, 11, 13, 67 or 72; Optionally, the CDR1, CDR2 and CDR3 comprised by the first affinity peptide respectively have: the amino acid sequences shown in SEQ ID NO: 51 to 53; the amino acid sequences shown in SEQ ID NO: 54 to 56; the amino acid sequences shown in SEQ ID NO: 57 to 59; the amino acid sequences shown in SEQ ID NO: 68 to 70; or the amino acid sequences shown in SEQ ID NO: 73 to 75; Optionally, the first affinity peptide comprises the amino acid sequence shown in SEQ ID NO: 9, 11, 13, 67 or 72; Optionally, the second affinity peptide comprises CDR1, CDR2 and CDR3 of SEQ ID NO: 19 or 77; Optionally, the CDR1, CDR2 and CDR3 comprised by the second affinity peptide respectively have: the amino acid sequences shown in SEQ ID NO: 78 to 80; or the amino acid sequences shown in SEQ ID NO: 81 to 83; Optionally, the first affinity peptide comprises the amino acid sequence shown in SEQ ID NO: 19 or 77; Optionally, the linker connecting the first affinity peptide and the second affinity peptide in step (b) comprises the sequence shown in SEQ ID NO:

50.

11. A fusion protein obtained by the method according to claim 10.

12. A nanobody comprising CDR1, CDR2 and CDR3 of any one of SEQ ID NO: 9, 11, 13, 67, 72, 19 or 77, Preferably, the CDR1, CDR2 and CDR3 it comprises respectively have: The amino acid sequences shown in SEQ ID NO: 51 to 53; The amino acid sequences shown in SEQ ID NO: 54 to 56; The amino acid sequences shown in SEQ ID NO: 57 to 59; The amino acid sequences shown in SEQ ID NO: 68 to 70; The amino acid sequences shown in SEQ ID NO: 73 to 75; The amino acid sequences shown in SEQ ID NO: 78 to 80; or The amino acid sequences shown in SEQ ID NO: 81 to 83.

13. A nucleic acid encoding the affinity peptide according to claim 12, wherein, The coding nucleotide sequence preferably has the nucleotide sequence as described in any one of SEQ ID NO: 10, 12, 14, 71 or 76.

Images