Biosensing probe based on pyrene-doped metal organic framework composite material and preparation method and reagent thereof

Abstract

The invention provides a biosensing probe based on a pyrene-doped metal organic framework composite material, and a preparation method and a reagent thereof. The pyrene-doped metal organic framework composite material PCA-UiO-66 is prepared by adopting a one-pot method, the target product can be prepared by directly introducing 1-pyrenecarboxylic acid in the synthesis process of the UiO-66, PCA in the prepared PCA-UiO-66 composite material has stability and flexibility in MOF, the PCA-UiO-66 composite material is suitable for application in the aspect of biosensing, and the application range is wide. The biosensing probe Apt (at) PCA-UiO-66 prepared on the basis has good flexibility, excellent selectivity and anti-interference capability, excellent reproducibility and stability, wide detection range and extremely low detection limit.

Description

Technical Field

[0001] The present invention belongs to the technical field of materials and biomedical detection, and in particular relates to a pyrene-doped metal-organic framework composite material and a preparation method thereof, a biosensing probe based on the pyrene-doped metal-organic framework and a preparation method thereof, and a reagent based on the biosensing probe. Background Art

[0002] Pyrene and its derivatives have received extensive attention as fluorescent probes due to their unique conversion from monomer to excimer state. However, their strong hydrophobicity and easy aggregation in aqueous environments severely limit their practical applications. To solve these problems, researchers have introduced pyrene into metal-organic frameworks (MOFs) to improve dispersibility and introduce functional diversity through the abundant active sites on the MOF surface. Traditional synthesis strategies mostly adopt the following two schemes: (1) using pyrene-containing ligands; (2) connecting pyrene to the ligand through organic synthesis. However, since pyrene-containing ligands are usually difficult to obtain and expensive, and the organic synthesis operation is complex and not environmentally friendly, these two schemes are accompanied by high costs, complex processes and environmental problems. In addition, for the pyrene-based MOFs synthesized by these methods, pyrene is firmly restricted inside or on the surface of the MOF. In the field of biosensing, detection can only be achieved by the binding of target molecules and chemical bonds to disrupt the π-π stacking between pyrene molecules. This detection method is not flexible enough for the selection of targets, and mostly adopts a signal "off" type detection mechanism, with problems such as low sensitivity, high background noise and limited linear range. For example, Cho et al. first connected pyrenecarboxylic acid to a ligand with an amino group through an amide bond, and then synthesized the metal-organic framework CP-166. This sensor achieved the transition of pyrenecarboxylic acid inside CP-166 from the excimer state to the monomer state based on the complexation of copper ions and the amide bond, and the fluorescence was turned off to detect copper ions. This mechanism is a microcosm of introducing pyrene into MOF. Pyrene is connected to the ligand through organic synthesis and then introduced into MOF to realize the synthesis of pyrene-based MOF. This synthesis method of pyrene MOF makes pyrene strongly anchored to the MOF structure by covalent bonds such as amide bonds, which also leads to the signal output mode of pyrene-based MOF depending on the recognition of amide bonds and the reduction of the excimer state peak. It is not only mostly signal off detection but also not flexible enough for the selection of targets.

[0003] Therefore, there is an urgent need to develop a simple, environmentally friendly and low-cost synthesis method for pyrene-functionalized MOF, and at the same time develop a flexible pyrene-based MOF sensing substrate material, which can achieve flexible target selection and is more suitable for applications in the field of biosensing. Summary of the Invention

[0004] In view of this, to solve the above technical problems, the present invention provides a pyrene-doped metal-organic framework composite material and a preparation method thereof. The pyrene-doped metal-organic framework composite material PCA-UiO-66 is prepared by a one-pot method. The target product can be prepared by directly introducing 1-pyrenecarboxylic acid during the synthesis of UiO-66. The process is simple, environmentally friendly, and has low production costs. In the prepared PCA-UiO-66 composite material, PCA has both stability and flexibility within the MOF and is suitable for applications in biosensing. At the same time, a biosensing probe Apt@PCA-UiO-66 based on this flexible PCA-UiO-66 sensing substrate material, a preparation method thereof, and a reagent based on this biosensing probe are provided. The biosensing probe Apt@PCA-UiO-66 has good flexibility, as well as excellent selectivity, anti-interference ability, excellent reproducibility and stability, a wide detection range, and an extremely low detection limit.

[0005] To achieve the above object, the technical solution of the present invention is realized as follows:

[0006] The first aspect of the present invention provides a preparation method of a pyrene-doped metal-organic framework composite material, which is characterized by including the following steps:

[0007] S1. Prepare DMF solutions of zirconium oxychloride, terephthalic acid, and 1-pyrenecarboxylic acid respectively;

[0008] S2. After mixing the three solutions prepared in S1 and ultrasonicating until dissolved, react at 100-120 °C;

[0009] S3. After the reaction is completed, wash the generated product multiple times and then dry it to obtain the pyrene-doped metal-organic framework composite material PCA-UiO-66.

[0010] In some preferred embodiments of the preparation method of the pyrene-doped metal-organic framework composite material of the present invention, in S1, the mass ratio of zirconium oxychloride, terephthalic acid, and 1-pyrenecarboxylic acid is 1-4:5:0.1-1; in the DMF solution of zirconium oxychloride, the mass ratio of zirconium oxychloride to DMF is 1-4:90-100; in the DMF solution of terephthalic acid, the mass ratio of terephthalic acid to DMF is 5:90-100; in the DMF solution of 1-pyrenecarboxylic acid, the mass ratio of 1-pyrrolic acid to DMF is 0.1-1:90-100.

[0011] In some preferred embodiments of the preparation method of the pyrene-doped metal-organic framework composite material of the present invention, in S2, the reaction time is 20-30 h.

[0012] In some preferred embodiments of the preparation method of the pyrene-doped metal-organic framework composite of the present invention, in step S3, the generated product is washed three times with DMF and ethanol respectively.

[0013] The one-pot preparation method is adopted. During the synthesis of UiO-66, 1-pyrenecarboxylic acid (PCA) is directly introduced. PCA does not affect the synthesis of UiO-66. At the same time, PCA is confined inside UiO-66. However, different from the existing technology that restricts it through strong bonds, PCA is restricted inside the MOF through π-π bonds and steric hindrance. But due to its own hydrophobicity, it will not easily leave UiO-66 in an aqueous solution. Compared with other pyrene-based MOFs, the synthesis method of the present invention does not have complex organic synthesis to connect the ligand and the pyrene group, nor does it have pyrene-containing ligands that are difficult to obtain. The synthesis process is simple, the reaction conditions are mild, the raw materials are easily available, and the production cost is low.

[0014] The second aspect of the present invention provides a pyrene-doped metal-organic framework composite PCA-UiO-66 prepared by the preparation method of the pyrene-doped metal-organic framework composite.

[0015] In some preferred embodiments of the pyrene-doped metal-organic framework composite of the present invention, 1-pyrenecarboxylic acid PCA in the pyrene-doped metal-organic framework composite is restricted inside the metal-organic framework UiO-66 through π-π bonds and steric hindrance.

[0016] In the prepared pyrene-doped metal-organic framework composite PCA-UiO-66, there is no covalent bond to restrict the diffusion of PCA. Instead, it is mainly restricted by π-π bonds and steric hindrance. PCA is not overly rigidly fixed in the PCA-UiO-66 framework. However, due to the strong hydrophobicity of pyrenecarboxylic acid, it will not easily leave UiO-66 in an aqueous solution, realizing the flexible and stable confinement of PCA in the PCA-UiO-66 framework. Using this feature, the background signal of the whole system can be reduced to a very low level, making PCA-UiO-66 very suitable for applications in biosensing.

[0017] The third aspect of the present invention provides a biosensing probe based on a pyrene-doped metal-organic framework, which includes a pyrene-doped metal-organic framework composite PCA-UiO-66 and a FAM-labeled aptamer loaded on the pyrene-doped metal-organic framework composite PCA-UiO-66.

[0018] In some preferred embodiments of the biosensing probe based on pyrene-doped metal-organic framework of the present invention, the aptamer is a short oligonucleotide sequence obtained by screening: 5’-ATACCAGCTTATTCAATTGGACACGGCAAAGGGGTATAGCCTACCGGACCGTGAACATGGAATGGTGTGCTGCGTGGAGATAGTAAGTGCAATCT-3’ (SEO ID NO:1).

[0019] Due to its phosphate backbone, the aptamer has a negative potential and π bonds in aqueous solution. Compared with UiO-66, the more neutral potential of PCA-UiO-66 is more conducive to the adsorption of the aptamer. At the same time, when the aptamer is adsorbed on the MOF, the "flexible" PCA inside the MOF forms a new π–π stacking with the aptamer. However, since the aptamer is also adsorbed on the surface of the MOF, PCA will not be released prematurely. When the target protein is present, the target protein strips the aptamer from the surface of the MOF, and the aptamer releases pyrenecarboxylic acid into the solution together. The fluorescence of the pyrenecarboxylic acid monomer is restored, and the concentration of the protein can be quantified by quantifying the fluorescence of the pyrenecarboxylic acid monomer.

[0020] The aptamer selected in the present invention is a short oligonucleotide sequence obtained by in vitro screening, which can bind its ligand sVCAM-1 (soluble vascular cell adhesion molecule-1) with high affinity and high specificity, so that the prepared biosensing probe can detect the biomarker sVCAM-1.

[0021] The fourth aspect of the present invention provides a preparation method of a biosensing probe based on pyrene-doped metal-organic framework, comprising the following steps:

[0022] D1. Disperse the pyrene-doped metal-organic framework composite material PCA-UiO-66 in deionized water;

[0023] D2. Add the FAM-labeled aptamer to the PCA-UiO-66 solution prepared in D1. After incubation, centrifuge and wash multiple times, and resuspend in ultrapure water to obtain the biosensing probe Apt@PCA-UiO-66 based on pyrene-doped metal-organic framework.

[0024] In some preferred embodiments of the preparation method of the biosensing probe based on pyrene-doped metal-organic framework of the present invention, in D1, the concentration of PCA-UiO-66 dispersed in deionized water is 500-1000 μg / mL.

[0025] In some preferred embodiments of the preparation method of the pyrene-doped metal-organic framework-based biosensing probe of the present invention, in the D2, the concentration of the FAM-labeled aptamer is 200-500 nM; the incubation time is 50-90 min.

[0026] In some preferred embodiments of the preparation method of the pyrene-doped metal-organic framework-based biosensing probe of the present invention, the sequence of the FAM-labeled aptamer is: 5’-ATACCAGCTTATTCAATTGGACACGGCAAAGGGGTATAGCCTACCGGACCGTGAACATGGAATGGTGTGCTGCGTGGAGATAGTAAGTGCAATCT-3’ (SEO ID NO:1).

[0027] The aptamer selected in the present invention is a short oligonucleotide sequence obtained by in vitro screening, which can bind its ligand sVCAM-1 (soluble vascular cell adhesion molecule-1) with high affinity and high specificity, so that the prepared biosensing probe can detect the biomarker sVCAM-1.

[0028] The fifth aspect of the present invention provides a reagent comprising the pyrene-doped metal-organic framework-based biosensing probe described in any one of the above.

[0029] The sixth aspect of the present invention provides an application of the pyrene-doped metal-organic framework-based biosensing probe in the preparation of a product for quantifying sVCAM-1.

[0030] Compared with the prior art, the pyrene-doped metal-organic framework composite material, its preparation method, and the pyrene-doped metal-organic framework-based biosensing probe of the present invention have the following advantages:

[0031] (1) The preparation method of the pyrene-doped metal-organic framework of the present invention uses a one-pot method to prepare the pyrene-doped metal-organic framework composite material PCA-UiO-66. By directly introducing 1-pyrenecarboxylic acid during the synthesis of UiO-66, the target product can be prepared without using complex organic synthesis to connect the ligand and the pyrene group, nor obtaining a pyrene-containing ligand with great difficulty. The raw materials used in the synthesis are simple and easy to obtain, the process is simple and environmentally friendly, and the production cost is low.

[0032] (2) Different from pyrene doped in other metal-organic frameworks (MOFs) in the prior art, which is restricted by strong bonds (such as covalent bonds), in the pyrene doped metal-organic framework composite PCA-UiO-66 prepared in the present invention, PCA is mainly bound by weaker bonds in PCA-UiO-66, providing more flexibility in the selection of targets. At the same time, although there is no covalent bond to restrict the diffusion of pyrene formic acid, due to the strong hydrophobicity of pyrene formic acid, it will not easily leave UiO-66 in aqueous solution and can be stably restricted within the PCA-UiO-66 framework without damaging the MOF structure. Thus, PCA has both stability and flexibility within the MOF. In an aqueous environment, PCA maintains an excimer state within the framework, ensuring consistent signal output and extremely low background noise. These characteristics make PCA-UiO-66 very suitable for applications in biosensing;

[0033] (3) In the present invention, PCA-UiO-66 with both stability and flexibility is combined with an aptamer as a signal amplification device and recognition element to prepare a biosensing probe based on pyrene doped metal-organic framework. Since PCA-UiO-66 has a more neutral potential compared to UiO-66, it is more likely to adsorb an aptamer with a negative potential and π–π bonds in aqueous solution. At the same time, when the aptamer adsorbs on the MOF, the "flexible" pyrene formic acid inside the MOF forms new π–π stacking with the aptamer. However, because the aptamer is also adsorbed on the surface of the MOF, pyrene formic acid will not be prematurely released. When there is a target protein, the target protein strips the aptamer from the surface of the MOF, and the aptamer releases pyrene formic acid into the solution together. The fluorescence of pyrene formic acid monomers is restored, and the concentration of the protein can be quantified by quantifying the fluorescence of pyrene formic acid monomers;

[0034] (4) In the biosensing probe based on pyrene doped metal-organic framework of the present invention, the ability to detect proteins is imparted to the pyrene-functionalized MOF by introducing an aptamer, thus providing greater flexibility in the selection of biomarkers;

[0035] (5) The biosensing probe based on pyrene doped metal-organic framework prepared in the present invention for detecting sVCAM-1 has excellent selectivity and anti-interference ability, good reproducibility and stability. At the same time, it also has a wide detection range (2 ng / mL to 50 μg / mL) and an extremely low detection limit (0.62 ng / mL). In addition, the detection operation using the biosensing probe is simpler, with fewer sample pretreatment steps and lower requirements for the professionalism of operators. Description of the Drawings

[0036] Figure 1 For the comprehensive characterization of PCA-UiO-66: Among them, Figure 1 A is the TEM image of PCA-UiO-66; Figure 1 B is the TEM image of UiO-66;Figure 1 C is the SEM image of PCA-UiO-66; Figure 1 D is the SEM image of UiO-66; Figure 1 E is the XPS spectra of PCA-UiO-66 and UiO-66; Figure 1 F is the C1s spectrum of PCA-UiO-66; Figure 1 G is the O1s spectrum of PCA-UiO-66; Figure 1 H is the Zr 3d spectrum of PCA-UiO-66; Figure 1 I is the XRD patterns of PCA-UiO-66 and UiO-66 as well as the standard XRD pattern; Figure 1 J is the FTIR spectra of PCA-UiO-66 and UiO-66; Figure 1 K is the Zeta potential values of PCA-UiO-66 and UiO-66; Figure 1 L is the thermogravimetric analysis and derivative thermogravimetric analysis curves of PCA-UiO-66 and UiO-66;

[0037] Figure 2 For the optical property detection of PCA-UiO-66: Among them, Figure 2 A is the excitation spectrum and emission spectrum of PCA-UiO-66; Figure 2 B is the emission spectra of PCA-UiO-66, PCA and UiO-66; Figure 2 C is the digital images of UiO-66 and PCA-UiO-66 before and after centrifugation under 360 nm ultraviolet light; Figure 2 D is the confocal laser scanning microscope (CLSM) image of PCA-UiO-66; Figure 2 E is the optical microscope (OM) image of PCA-UiO-66; Figure 2 F is the confocal laser scanning microscope (CLSM) image of UiO-66; Figure 2 G is the optical microscope (OM) image of UiO-66;

[0038] Figure 3 For the feasibility verification and performance analysis of Apt@PCA-UiO-66: Figure 3 A is the fluorescence measurement after Apt@PCA-UiO-66 is added to the blank detection sample and the detection sample of 1000 ng / mL sVCAM-1; Figure 3 B is the XRD patterns of PCA-UiO-66 before and after detecting the detection sample of 1000 ng / mL sVCAM-1; Figure 3 C is the fluorescence measurement of the PCA suspension with 200 μM aptamer added and the PCA suspension without aptamer added; Figure 3D-E is the fluorescence spectrum of Apt@PCA-UiO-66 for detecting sVCAM-1 at a concentration of 2 ng / mL to 50 μg / mL; Figure 3 F is the standard curve; Figure 3 G is the specificity of Apt@PCA-UiO-66 for sVCAM-1; Figure 3 H is the reproducibility of Apt@PCA-UiO-66 for sVCAM-1; Figure 3 I is the long-term stability of Apt@PCA-UiO-66.

[0039] Figure 4 For the preparation of Apt@PCA-UiO-66 and the optimization of protein incubation parameters: Figure 4 A is the optimization of aptamer concentration; Figure 4 B is the optimization of the incubation time of aptamer with PCA-UiO-66; Figure 4 C is the optimization of the incubation time of sVCAM-1 protein with Apt@PCA-UiO-66. Detailed implementation mode

[0040] Unless otherwise defined, the technical terms used in the following examples have the same meaning as commonly understood by those skilled in the art to which the present invention belongs. The test reagents used in the following examples are all conventional biochemical reagents unless otherwise specified; the experimental methods are all conventional methods unless otherwise specified.

[0041] The present invention will be described in detail below with reference to the examples and the accompanying drawings.

[0042] I. Preparation and performance testing of pyrene-doped metal-organic framework composite material PCA-UiO-66

[0043] Example 1

[0044] Preparation of pyrene-doped metal-organic framework composite material PCA-UiO-66:

[0045] S1. Dissolve 210 mg of zirconium oxychloride in 30 mL of DMF to obtain a DMF solution of zirconium oxychloride; dissolve 500 mg of terephthalic acid in 10 mL of DMF to obtain a DMF solution of terephthalic acid; dissolve 100 mg of 1-pyrenecarboxylic acid in 10 mL of DMF to obtain a DMF solution of 1-pyrenecarboxylic acid;

[0046] S2. After mixing the three solutions prepared in S1, ultrasonicate for 1 h, then transfer to a 100 mL polytetrafluoroethylene container and react at 120 °C for 24 h;

[0047] S3. After the reaction is completed, wash the resulting product three times with DMF and ethanol respectively, and dry to obtain the pyrene-doped metal-organic framework composite material PCA-UiO-66.

[0048] Performance test:

[0049] 1. Comprehensive characterization of the pyrene-doped metal-organic framework composite PCA-UiO-66 prepared in Example 1:

[0050] Figure 1 A-B are the TEM images of PCA-UiO-66 and the parent material UiO-66. It can be seen that both show a uniformly distributed morphology, and the average particle size is about 200 nanometers.

[0051] Figure 1 C-D are the SEM images of PCA-UiO-66 and the parent material UiO-66. It can be seen that PCA-UiO-66 shows good particle morphology and clear surface structure, indicating successful synthesis and high crystal quality.

[0052] Figure 1 E is the XPS spectrum of PCA-UiO-66 and the parent material UiO-66, showing the binding energy peaks related to Zr 3d, C 1s, and O 1s in the two nanomaterials.

[0053] Figure 1 F is the C1s spectrum of PCA-UiO-66, which can be decomposed into two peaks located at 284.8 eV and 288.98 eV, attributed to C–C / C=C and O=C–OH bonds respectively.

[0054] Figure 1 G is the O1s spectrum of PCA-UiO-66, showing three peaks located at 530.69 eV, 532.08 eV, and 533.75 eV, corresponding to C=O, Zr–O, and C–O bonds respectively.

[0055] Figure 1 H is the Zr 3d spectrum of PCA-UiO-66. It can be seen that the binding energy peaks at 183.03 eV and 185.48 eV are related to the Zr 3d5 / 1 and Zr 3d2 / 2 states, reflecting the presence of Zr(IV).

[0056] Figure 1 I is the X-ray diffraction pattern. It can be seen that the XRD patterns of PCA-UiO-66 and the parent material UiO-66 are consistent with the standard XRD model; all the 2θ peaks, especially at 7.4°, 8.5°, and 25.4°, match the diffraction peaks of the UiO-66 parent material, confirming that the crystal structure of UiO-66 is successfully retained in the PCA-UiO-66 composite material.

[0057] Figure 1Figure J shows the FTIR spectra of PCA-UiO-66 and UiO-66. It can be seen that the FTIR spectra of MOFs show sharp peaks in the range of 1400–1710 cm-1. These peaks are attributed to the stretching vibrations of C=C and C=O bonds, which come from the presence of benzene rings and carboxyl groups in both samples. The band at 1710 cm-1 is related to the free carboxyl groups present on the MOF surface; the absorption peaks at 1585 cm-1 and 1390 cm-1 correspond to the asymmetric and symmetric stretching vibrations of the coordinated carboxylate groups, respectively.

[0058] In summary, from Figure 1 A-J, it can be proved that the direct introduction of PCA during the synthesis does not interfere with the normal formation of the UiO-66 framework.

[0059] Figure 1 As shown in Figure K, the Zeta potential measurement in aqueous solution shows that the potential of PCA-UiO-66 is closer to neutral compared to UiO-66, demonstrating the successful encapsulation of PCA. The change in the potential of PCA-UiO-66 being closer to neutral is attributed to the introduction of 1-pyrenecarboxylic acid (PCA). PCA has strong hydrophobicity and π-π stacking ability, thus reducing the exposure of negative charges. In addition, when PCA is incorporated into UiO-66, its carboxyl groups coordinate with the metal nodes, replacing some of the original terephthalic acid ligands in UiO-66. This replacement also reduces the density of surface negative charges, making the zeta potential close to neutral. And this more neutral potential is more likely to adsorb aptamers with negative potential and π-bonds in aqueous solution.

[0060] Figure 1L shows the thermogravimetric analysis (TGA) and derivative thermogravimetric analysis (DTG) curves of PCA-UiO-66 and the parent material UiO-66. To examine the thermal stability of PCA-UiO-66 and UiO-66, thermogravimetric analysis from room temperature to 800 °C was carried out. The TGA curves (solid lines) and derivative thermogravimetric curves (DTG, dashed lines) of the two samples showed three-step mass losses. The first significant mass loss (about 5%) occurred at around 70 °C, attributed to the removal of organic solvent molecules in the pores of the MOF. The second mass loss occurred at about 200 °C, attributed to the dehydration reaction of the Zr clusters, resulting in the conversion of Zr6O4(OH)4 to Zr6O6. At this time, the chemical composition of UiO-66 was considered to be Zr6O6(BDC)6. The third large mass loss occurred at 580 °C and was related to the decomposition of terephthalic acid into CO, CO2, and ZrO2 for both UiO-66 and PCA-UiO-66. It is worth noting that an additional small peak appeared in the DTG curve of PCA-UiO-66 at 320 °C, attributed to the decomposition of PCA. Calculations showed that PCA accounted for approximately 5% of the total weight of PCA-UiO-66. At 876 °C, the residual masses of PCA-UiO-66 and UiO-66 were 41.2% and 45.45%, respectively, corresponding to total mass losses of 58.8% and 54.55%.

[0061] In summary, from Figure 1 A-L, it can be shown that the structural and chemical integrity of UiO-66 in the prepared PCA-UiO-66 was retained, confirming the successful integration of PCA and without damaging the framework or performance of the material.

[0062] 2. Optical performance detection was carried out on the pyrene-doped metal-organic framework composite PCA-UiO-66 prepared in Example 1:

[0063] Figure 2 As can be seen from A-B, when PCA-UiO-66 was dispersed in ultrapure water and measured under excitation at 360 nm, the center of its excitation spectrum was about 500 nm ( Figure 2 A); compared with the excitation and emission spectra of PCA in water ( Figure 2B), the excitation band shifts from 400 nm to 500 nm; this new excitation band is attributed to the π-π stacking interaction within the molecule, resulting from the overlap of pyrene units. The monomer PCA excitation completely disappears, indicating that PCA is completely in the excimer state in PCA-UiO-66. This phenomenon can be explained by the "close packing effect", that is, the spatial confinement of the MOF structure forces the pyrene units to approach each other, forming an excimer state. Different from the confinement of pyrene in other MOFs in the prior art by strong bonds (such as covalent bonds), the confinement of PCA in PCA-UiO-66 is mainly through weaker bonding, making PCA-UiO-66 have a certain flexibility. Due to the limited solubility of PCA in water, its free form usually remains within the MOF, which is confirmed by washing and centrifuging PCA-UiO-66 for multiple rounds, and fluorescence analysis shows that there is almost no fluorescence in the supernatant, thus verifying that the prepared PCA-UiO-66 has a certain stability. The combination of "flexibility" and "stability" of PCA within the MOF makes it an inspiring material for sensor design.

[0064] Figure 2 As can be seen from C, PCA-UiO-66 exhibits bright green fluorescence under 360 nm ultraviolet light, while UiO-66 does not; Figure 2 Figures D-E show the confocal and bright-field images of PCA-UiO-66; Figure 2 Figures F-G show the corresponding images of UiO-66. Compared with UiO-66, the fluorescence within the structure of PCA-UiO-66 is strong and concentrated, and there is almost no fluorescence in the background, which further verifies that all PCA molecules are effectively encapsulated within the MOF.

[0065] II. Preparation and Performance Testing of the Biosensing Probe Apt@PCA-UiO-66 Based on Pyrene-Doped Metal-Organic Frameworks

[0066] Example 2

[0067] Preparation of the biosensing probe Apt@PCA-UiO-66 based on pyrene-doped metal-organic frameworks:

[0068] D1. Disperse the PCA-UiO-66 prepared in Example 1 in deionized water;

[0069] D2. Add the FAM-labeled aptamer to the PCA-UiO-66 solution prepared in D1. Among them, the concentration of PCA-UiO-66 is 500 μg / mL, and the sequence of the aptamer is: 5’-ATACCAGCTTATTCAATTGGACACGGCAAAGGGGTATAGCCTACCGGACCGTGAACATGGAATGGTGTGCTGCGTGGAGATAGTAAGTGCAATCT-3’. The concentration of the aptamer Apt is 200 nM. After incubation for 50 min, centrifuge at 10,000 rpm for 10 minutes, wash three times, and resuspend in ultrapure water to obtain the pyrene-doped metal-organic framework-based biosensing probe Apt@PCA-UiO-66 for detecting soluble vascular cell adhesion molecule-1 (sVCAM-1).

[0070] Performance test:

[0071] Perform feasibility verification and performance analysis on the pyrene-doped metal-organic framework-based biosensing probe Apt@PCA-UiO-66 prepared in Example 2:

[0072] Figure 3 A shows the fluorescence measurement after the Apt@PCA-UiO-66 prepared in Example 2 is added to the blank detection sample and the detection sample containing 1000 ng / mL sVCAM-1. It can be seen that in the absence of sVCAM-1, the pyrene in Apt@PCA-UiO-66 is only in the excimer state; in the presence of sVCAM-1, the number of peaks corresponding to the monomer and excimer states in the fluorescence spectrum increases, and the increase in the fluorescence intensity of the monomer PCA indicates that more PCA has changed from the excimer state to the monomer state. In addition, the enhancement of the excimer-state fluorescence is consistent with the fluorescence characteristics of PCA in solution, and self-assembles into the excimer state at high concentrations.

[0073] Figure 3 B shows the XRD patterns of PCA-UiO-66 prepared in Example 1 before and after detecting the detection sample containing 1000 ng / mL sVCAM-1. It can be seen that there is no significant change in the XRD pattern, indicating that PCA-UiO-66 remains intact during the detection process and no structural degradation occurs. The release of PCA inside the MOF is not caused by the cleavage of the MOF itself structure. In addition, the Zeta potential analysis shows that the potential drops significantly after detection, indicating that some PCA has left the MOF, exposing more negatively charged sites.

[0074] To verify that during the interaction process between PCA-UiO-66 and the aptamer, the π-π stacking between the aptamer and PCA within the MOF not only enables the aptamer to carry PCA out of PCA-UiO-66 after recognition but also enhances the solubility of PCA and promotes its release from PCA-UiO-66. Fluorescence measurements were performed on a PCA suspension with 200 μM aptamer added and a PCA suspension without aptamer added. As Figure 3 shown in C, the suspension with 200 μM aptamer added exhibited higher fluorescence intensity, demonstrating that the aptamer enhanced the solubility and dispersibility of PCA.

[0075] In summary, from Figure 3 A-C, it can be proven that the Apt@PCA-UiO-66 prepared in Example 2 can be used as a fluorescent biosensing probe for detecting sVCAM-1.

[0076] As Figure 3 shown in D-E, a fluorescence experiment was used to evaluate the ability of the Apt@PCA-UiO-66 prepared in Example 2 to detect sVCAM-1 at different concentrations (2 ng / mL to 50 μg / mL). It can be seen that as the concentration of sVCAM-1 increased, the fluorescence peak of monomeric PCA increased significantly, and the peak corresponding to the excimer state of PCA increased slightly, which is consistent with the dispersion characteristics of PCA in solution. As Figure 3 shown in F, the fluorescence intensity at 390 nm had a strong linear relationship with the concentration of sVCAM-1. The fitted linear equation was Y = 2.824*X + 212, and R 2 = 0.9995. Based on the slope of the linear fit, the limit of detection (LOD) was 0.62 ng / mL (3σ / k), and the limit of quantification (LOQ) was 2.05 ng / mL (10σ / k). The concentration of sVCAM-1 in human serum is usually between 100 ng / mL and 5000 ng / mL, so it can meet the non-destructive detection of human serum samples.

[0077] Specific detection: In practical applications, other proteins in serum, such as soluble intercellular adhesion molecule-1 (sICAM-1), interleukin-6 (IL-6), C-reactive protein (CRP), human serum albumin (HSA), and tumor necrosis factor-α (TNF-α), as well as metal ions such as Cu 2+ and Zn 2+ , may interfere with the detection results. Therefore, the selectivity and anti-interference ability of the Apt@PCA-UiO-66 biosensing probe prepared in Example 2 for detecting soluble vascular cell adhesion molecule-1 (sVCAM-1) were systematically evaluated. As Figure 3As shown in G, when the concentration of sVCAM-1 was 1000 ng / mL, its fluorescence intensity was significantly higher than that of other non-target proteins at the same concentration. In addition, in the mixed group (sVCAM-1 / sICAM-1 / IL-6 / CRP / TNF-α), the fluorescence signal was almost the same as that in the single sVCAM-1 group. These results indicate that the developed biosensing probe has excellent selectivity for sVCAM-1 in a complex detection environment, can effectively resist the interference of other proteins, and is suitable for the detection of sVCAM-1 in complex systems.

[0078] Reproducibility detection: Five parallel experiments were carried out on the Apt@PCA-UiO-66 biosensing probe prepared in Example 2 to detect 1000 ng / mL sVCAM-1. The results are as Figure 3 shown in H. The relative standard deviation (RSD) of the fluorescence response was 3.78%, indicating good reproducibility.

[0079] Stability detection: The long-term stability of the Apt@PCA-UiO-66 biosensing probe was evaluated by measuring the change in the fluorescence response of the Apt@PCA-UiO-66 biosensing probe prepared in Example 2 to 1000 ng / mL sVCAM-1 over time. The Apt@PCA-UiO-66 biosensing probe was stored at 4 °C and tested on the 1st, 7th, 14th, 21st, and 28th days. Figure 3 The results shown in I indicate that the fluorescence response only slightly decreased after 14 days, maintaining 84.64% and 75.31% of the initial signal intensity, respectively. These results indicate that the biosensing probe has good stability during the long-term detection of sVCAM-1.

[0080] III. Optimization of the preparation parameters of the biosensing probe Apt@PCA-UiO-66 based on pyrene-doped metal-organic frameworks

[0081] On the basis of Example 2, different from Example 2, samples with aptamer concentrations of 300 nM, 400 nM, 500 nM, 600 nM, 700 nM, and 800 nM were prepared respectively;

[0082] On the basis of Example 2, different from Example 2, samples with incubation times adjusted to 60 min, 75 min, 90 min, 105 min, and 120 min were prepared respectively.

[0083] The samples prepared in Example 2 and above were transferred to a 96-well plate, and the fluorescence intensity was measured using a microplate reader at an excitation wavelength of 494 nm. The measurement results are as Figure 4As shown in A, when the fluorescence intensity starts to increase linearly, it represents that the surface of MOF is completely occupied by the aptamer. Therefore, the aptamer concentration of 200 nM is the optimal concentration, and the selected aptamer concentration range of 200 - 500 nM is the applicable range. After incubating for 50 min, the FAM-labeled aptamer with a concentration of 200 nM completely occupies the binding sites of MOF. The optimized incubation time of 50 min is the optimal time, and the selected incubation time range of 50 - 90 min is the applicable range.

[0084] IV. Optimization of the Optimal Incubation Time for the Biosensing Probe Apt@PCA-UiO-66 to Detect 1000 ng / mL sVCAM-1

[0085] Add 1000 ng / mL of sVCAM-1 protein to the Apt@PCA-UiO-66 prepared in Example 2, use 360 nm excitation light to detect the fluorescence emission, and determine the time point when the fluorescence intensity no longer increases as the optimal detection time. The results are as Figure 4 shown in C. The optimal detection time is 40 min of incubation.

[0086] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A preparation method of a pyrene-doped metal-organic framework composite material, characterized in that, It includes the following steps: S1. Prepare DMF solutions of zirconium oxychloride, terephthalic acid, and 1-pyrenecarboxylic acid respectively; S2. Mix the three solutions prepared in S1 and ultrasonicate them. After dissolution, react at 100 - 120 °C; S3. After the reaction ends, wash the generated product multiple times and then dry it to obtain the pyrene-doped metal-organic framework composite material PCA-UiO-66.

2. The preparation method of the pyrene-doped metal-organic framework composite material according to claim 1, wherein: In S1, the mass ratio of zirconium oxychloride, terephthalic acid, and 1-pyrenecarboxylic acid is 1 - 4:5:0.1 - 1; in the DMF solution of zirconium oxychloride, the mass ratio of zirconium oxychloride to DMF is 1 - 4:90 - 100; in the DMF solution of terephthalic acid, the mass ratio of terephthalic acid to DMF is 5:90 - 100; in the DMF solution of 1-pyrenecarboxylic acid, the mass ratio of 1-pyrenecarboxylic acid to DMF is 0.1 - 1:90 - 100; In S2, the reaction time is 20 - 30 h; In S3, wash the generated product three times with DMF and ethanol respectively.

3. A pyrene-doped metal-organic framework composite material, characterized in that: It is the pyrene-doped metal-organic framework composite material PCA-UiO-66 prepared by using the preparation method described in claim 1 or 2.

4. The pyrene-doped metal-organic framework composite material according to claim 3, characterized in that: In the pyrene-doped metal-organic framework composite material, 1-pyrenecarboxylic acid PCA is restricted within the metal-organic framework UiO-66 through π-π bonds and steric hindrance.

5. A biosensing probe based on pyrene-doped metal-organic framework, characterized in that: It includes the pyrene-doped metal-organic framework composite material PCA-UiO-66 described in claim 5 and the FAM-labeled aptamer loaded on the pyrene-doped metal-organic framework composite material PCA-UiO-66.

6. The biosensing probe of the pyrene-doped metal-organic framework according to claim 5, characterized in that: The aptamer is a short oligonucleotide sequence obtained by screening: 5’-ATACCAGCTTATTCAATTGGACACGGCAAAGGGGTATAGCCTACCGG ACCGTGAACATGGAATGGTGTGCTGCGTGGAGATAGTAAGTGCAATC T-3’.

7. A preparation method of a biosensing probe based on pyrene-doped metal-organic framework, characterized in that, It includes the following steps: D1. Disperse the PCA-UiO-66 described in claim 3 in deionized water; D2. Add the FAM-labeled aptamer to the PCA-UiO-66 solution prepared in D1. After incubation, centrifuge, wash multiple times, and resuspend in ultrapure water to obtain the pyrene-doped metal-organic framework-based biosensing probe Apt@PCA-UiO-66.

8. The preparation method of the pyrene-doped metal-organic framework-based biosensing probe according to claim 7, wherein: In D1, the concentration of PCA-UiO-66 dispersed in deionized water is 500 - 1000 μg / mL; In D2, the sequence of the FAM-labeled aptamer is: 5’-ATACCAGCTTATTCAATTGGACACGGCAAAGGGGTATAGCCTACCGG ACCGTGAACATGGAATGGTGTGCTGCGTGGAGATAGTAAGTGCAATC T-3’; the concentration of the FAM-labeled aptamer is 200-500 nM; the incubation time is 50-90 min.

9. A reagent, characterized in that: Including the pyrene-doped metal-organic framework-based biosensing probe as described in claim 5 or 6, or the pyrene-doped metal-organic framework-based biosensing probe prepared by the preparation method as described in any one of claims 7 to 9.

10. Use of a biosensing probe prepared based on the biosensing probe described in claim 6 and the preparation method described in claim 8, characterized in that: Application in the preparation of a product for detecting sVCAM-1.

Images