Yoghourt oil preparation method and yoghourt oil

By using the C. cerevisia GD1 starter in sour cream production, the problem of insufficient aroma and acid production capacity is solved, the production of high titrated acidity and rich flavor substances is achieved, and the quality and market acceptance of sour cream is improved.

CN120249122APending Publication Date: 2025-07-04JIANGSU FUYANG FOOD TECHNOLOGY CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510432486.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-08
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

The lack of strains that can produce both fragrance and acid in the existing sour cream production leads to the need for additional acid-producing fermentation agents, which limits its industrial application. The existing strains have weak acid production capacity and insufficient titration acidity after fermentation.

Method used

C. Chrysanthesia GD1 is used as a fermentation agent and is inoculated into butter and whole milk for fermentation. The fermentation conditions are fermented at 30℃-37℃ for 18-24 hours, and then cooked at 1℃-5℃ for 24 hours, achieving high titration acidity and rich flavor substances.

Benefits of technology

It achieves no need for additional acid-producing fermented sour cream, the titration acidity of fermented sour cream reaches 74.34°T, and the flavor substances such as 2,3-butanedione, aceto and lactones are abundant, which enhances the milky aroma of sour cream.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249122A_ABST
    Figure CN120249122A_ABST
Patent Text Reader

Abstract

The invention discloses yoghurt oil and a preparation method thereof, and relates to the technical field of yoghurt oil processing. The invention provides a lactobacillus casei GD1, the lactobacillus casei GD1 is preserved in Guangdong Microbial Culture Collection Center on December 30, 2024, and the preservation number is GDMCC No: 65692. The preparation method comprises the following steps: inoculating a seed solution of the lactobacillus casei GD1 into a raw material containing 70%-90% of single cream and 10%-30% of whole milk for fermentation, and storing at 4 DEG C after fermentation, so as to obtain the fermented yoghurt oil rich in milk flavor. The method has the advantages that an acid-producing leavening agent does not need to be additionally matched, the titration acidity value of the fermented yoghurt oil can reach 74.34 DEG T, and the fermented yoghurt oil can be independently used as a leavening agent.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a method for preparing sour cream and sour cream, belonging to the technical field of sour cream processing. Background Art

[0002] Sour cream is a fermented dairy product made by fermenting lactic acid-producing bacteria. It has a delicate and smooth taste, a rich milk fragrance and a slight sour taste. Sour cream is rich in nutritional value, containing protein, minerals, vitamins, etc., and also containing essential amino acids required by the human body. The production process of sour cream includes processes such as standardization of raw materials, homogenization, sterilization, inoculation fermentation, and refrigeration. Each step has an important impact on the quality of the final sour cream product.

[0003] The flavor of sour cream is the main factor affecting its market development. Some studies have shown that sour cream with a rich milk fragrance and buttery flavor and a slight sour taste is more popular among consumers. The milk fragrance in sour cream is mainly produced by ketone substances such as diacetyl, acetoin, 2,3-butanedione, and some lactone substances. In addition, short-chain fatty acids such as acetic acid, butyric acid, and caproic acid contribute to the sour taste in sour cream. The commonly used aroma-producing bacteria in sour cream are Leuconostoc and Streptococcus diacetylactis, etc. Chinese Patent CN109652326B discloses a Lactobacillus casei with high diacetyl production and is used for the fermentation of sour cream. The content of diacetyl reaches 759 μg / kg, significantly improving the milk fragrance of sour cream. However, the acid-producing ability of this strain is weak and it can only be used as an adjunct starter. Since the high fat content in sour cream will affect the survival and functional characteristics of bacteria, there are currently few strains used for improving the flavor of sour cream. And it is very difficult for a strain to have both aroma-producing and acid-producing abilities at the same time. For example, the aroma-producing strain disclosed in Patent CN109652326B has a weak acid-producing ability, and the titratable acidity after fermentation can only reach 41.1 °T. It needs to be used in combination with an acid-producing starter at the same time, which limits its industrial application. Therefore, it is necessary to enrich the application of strains that can both produce aroma and acid in sour cream. Summary of the Invention

[0004] Aiming at the deficiencies of the existing technology, one of the purposes of the present application is to provide a method for preparing sour cream and sour cream, which does not need to be additionally combined with an acid-producing starter, and the titratable acidity value of the fermented sour cream can reach 74.34 °T, and it can be used alone as a starter. In addition, the sour cream prepared by this method has a rich milk fragrance, and substances such as 2,3-butanedione (473 μg / kg), acetoin (1724 μg / kg), and lactones (436 μg / kg) are abundant.

[0005] The present invention provides a strain of Lacticaseibacillus casei GD1, which was deposited at the Guangdong Provincial Culture Collection of Microorganisms on December 30, 2024, with the deposit number GDMCC No: 65692.

[0006] The present invention provides a microbial preparation containing the Lacticaseibacillus casei GD1.

[0007] In one embodiment, in the microbial preparation, the cell count of Lacticaseibacillus casei GD1 is not less than 1×10 7 CFU / mL or 1×10 7 CFU / g.

[0008] The present invention provides a product containing the Lacticaseibacillus casei GD1 or the microbial preparation.

[0009] In one embodiment, the product includes food, medicine, or health products.

[0010] In one embodiment, the food includes fermented food; the fermented food includes sour cream.

[0011] The present invention provides a method for preparing sour cream with a milk flavor, by adding the Lacticaseibacillus casei GD1 or the microbial preparation to a substrate containing cream for fermentation.

[0012] In one embodiment, in the substrate, the inoculation amount of Lacticaseibacillus casei GD1 is not less than 1×10 7 CFU / mL or 1×10 7 CFU / g.

[0013] In one embodiment, the substrate contains 70 - 90% light cream and 10 - 30% milk.

[0014] In one embodiment, ferment at 30°C - 37°C for 18 - 24 h; then ripen at 1°C - 5°C for at least 24 h.

[0015] The present invention provides a method for increasing flavor substances in fermented dairy products, by adding the Lacticaseibacillus casei GD1 or the microbial preparation to dairy products for fermentation; the flavor substances include 2,3 - butanedione, acetoin, and / or lactone.

[0016] The present invention provides the application of the Lacticaseibacillus casei GD1 or the microbial preparation in the preparation of fermented food.

[0017] Beneficial effects:

[0018] The present invention provides a strain of Lactobacillus paracasei GD1, which has the following characteristics:

[0019] (1) Lactobacillus paracasei GD1 has strong acid-producing ability, and the titratable acidity value of fermented sour cream can reach 74.34°T, and it can be used alone as a starter.

[0020] (2) Substances such as 2,3-butanedione (473 μg / kg), acetoin (1.724 μg / kg), and lactones (436 μg / kg) are rich in the sour cream fermented by Lactobacillus paracasei GD1, and the product has an obvious milk fragrance attribute.

[0021] Biological material preservation

[0022] A strain of Lactobacillus casei GD1, taxonomically named Lactobacillus casei, was deposited at the Guangdong Provincial Culture Collection Center of Microorganisms on December 30, 2024, with the deposit number GDMCC No: 65692, and the deposit address is the 5th floor of Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Guangdong, China. Description of the drawings

[0023] Figure 1 is the pH change during the fermentation process;

[0024] Figure 2 is the detection result of volatile flavor substances in sour cream;

[0025] Figure 3 is the sensory evaluation result of sour cream. Detailed implementation manners

[0026] The MRS agar medium used for the MRS agar plates involved in the following examples is a selective medium for lactic acid bacteria, purchased from Beijing Land Bridge Company.

[0027] Example 1 Screening and identification of the strain

[0028] Take a fresh milk curd sample, dissolve it with sterile water and perform gradient dilution. Take 100 μL of the sample of different gradient dilutions and spread it on an MRS agar plate, and culture it in a constant temperature incubator at 37°C for 24 - 48 h. Use a sterile toothpick to pick out round, medium-sized, raised, slightly white, moist, neatly edged single colonies with a diameter of 3 mm ± 1 mm; then streak and purify on the corresponding agar plate to obtain pure single colonies, that is, purified strains. The purified strains are stored in the corresponding selective medium, adding 30% glycerol as a protective agent and storing at -20°C. Two strains were isolated, namely GD1 and SN110.

[0029] Strain identification:

[0030] (1) Colony characteristics

[0031] The strain was streaked and isolated on MRS plates and anaerobically cultured at 37 °C for 48 h. The strain grew well. Its colonies were round, convex, with neat edges, milky white in color, opaque, and the surface was moist and smooth.

[0032] (2) Genetic identification

[0033] The GD1 and SN110 strains obtained by the above primary screening were further identified for their species information by molecular biology methods, including PCR amplification of genomic DNA and 16S rRNA sequence detection.

[0034] A purified GD1 single colony was picked and inoculated into 10 mL of MRS liquid medium. After culturing at 37 °C for 12 h, the bacterial solution was centrifuged (4000 r / min, 15 min) to collect the bacterial cell precipitate. The genomic DNA extraction kit (Sangon Biotech (Shanghai) Co., Ltd.) was used to extract the genomic DNA of the obtained bacterial cells. Two synthetic universal primers were used for PCR amplification (16s 27F: GAGAGTTTGATCCTGGCTCAG; 16s 1492R: CGGCTACCTTGTTACGACTT). The PCR products were recovered using a column-type PCR product purification kit (Sangon Biotech (Shanghai) Co., Ltd.) and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing after purification.

[0035]

[0036] Through the National Center for Biotechnology Information (NCBI) database, the obtained nucleotide sequence was subjected to GenBank sequence homology alignment using Blast. GD1 had the highest homology with Lactobacillus casei strain 049, which was 99%. Therefore, the GD1 strain can be identified as Lacticaseibacillus casei. Lacticaseibacillus casei GD1 was deposited in the Guangdong Provincial Culture Collection of Microorganisms on December 30, 2024, with the deposit number GDMCC No: 65692.

[0037] Example 2 A method for preparing sour cream

[0038] Strain activation: Inoculate Lacticaseibacillus casei GD1 into MRS medium, and culture at 37 °C for 12 hours, with 2 generations of activation.

[0039] Preparation of sour cream:

[0040] Preparation of raw materials: Take 70%-90% light cream (Blue Miller light cream, with a fat content of 38%) and 10%-30% whole milk, and mix them evenly at 50 °C. In this example, it is 80% light cream and 20% whole milk.

[0041] Homogenization and sterilization: Homogenize the above-mentioned evenly mixed liquid 2 times under a pressure of 15 Mpa, and then sterilize it at 95 °C for 5 min.

[0042] Inoculation and fermentation: Cool the sterilized light cream to room temperature, inoculate 1×10 7 CFU / mL of Lacticaseibacillus casei GD1, and ferment at 30 °C for 20 h. The fermented product is stored in a 4 °C refrigerator, and various indicators are detected after 24 h.

[0043] Comparative Example 1 A method for preparing sour cream

[0044] Preparation of sour cream containing a commercial starter, which specifically includes the following steps: The specific implementation method refers to Example 1, the difference is that Lacticaseibacillus casei GD1 is replaced with a commercial starter (Lacticaseibacillus casei, Xi'an Mixianer Biotechnology Co., Ltd., named SY).

[0045] Comparative Example 2 A method for preparing sour cream

[0046] Preparation of sour cream containing Lactobacillus casei SN110, which specifically includes the following steps: For the specific implementation method, refer to the steps in Example 1, with the difference that Lactobacillus casei GD1 is replaced by Lactobacillus casei SN110.

[0047] Determination of product properties in Example 3

[0048] (1) Determination of pH

[0049] Measure using a pH meter (Mettler-Toledo pH meter).

[0050] (2) Determination of titratable acidity

[0051] Determine the titratable acidity of the sample according to GB 5009.239-2016, "National Food Safety Standard - Determination of Food Acidity".

[0052] (3) Determination of water holding capacity

[0053] After the sour cream is ripened, take about 20 g into a 50 mL centrifuge tube. The mass of the sample is m, and the mass of the centrifuge tube is m2. Centrifuge at 4000 r / min at 4 °C for 20 min. After discarding the supernatant, invert the centrifuge tube for about 5 min, and weigh the total mass of the centrifuge tube and the sample as m1.

[0054] The formula for calculating the water holding capacity is: Water holding capacity (%) = (m1 - m2) / m × 100, where m1 is the total mass of the centrifuged sample and the centrifuge tube (g); m2 is the mass of the centrifuge tube (g); m is the mass of the sample (g).

[0055] (4) Determination of texture

[0056] Use the Shanghai Baosheng TA.XTC-18 texture analyzer for testing. The probe is a TA / 0.5 gel probe. Conduct texture determination to obtain 6 physical properties, including sample height, hardness, viscosity, adhesiveness, cohesiveness, and resilience, etc. Each sample is measured 3 times. The measurement parameters are as follows: pre-test speed is 3.00 mm / s; test speed is 0.5 mm / s; post-test speed is 0.50 mm / s, and the trigger force is 3 gf.

[0057] (5) Determination of volatile flavor substances

[0058] The volatile flavor compounds in sour cream were extracted by headspace solid-phase microextraction (HS-SPME). Weighed 6 g of the sample into a 20 mL extraction bottle, added 2-octanol (220 mg / mL) as the internal standard, and the addition amount was adjusted according to the concentration of volatile flavor compounds. It was equilibrated in a constant temperature water bath at 65 °C for 5 min, and then extracted with a DVB / CAR / PDMS triple extraction head at 65 °C for 45 min. The chromatographic column used was HP-INNOWAX (60 m × 0.26 mm × 0.25 μm); the inlet temperature was 250 °C; the temperature programming: the initial temperature was 40 °C, held for 3 min, increased to 150 °C at a rate of 4 °C / min, then increased to 200 °C at a rate of 5 °C / min, held for 2 min, and then increased to 230 °C at a rate of 10 °C / min, held for 10 min; the flow rate was 1 mL / min. Carrier gas: helium (purity 99.99%); flow rate 1 mL / min; the injection mode was splitless injection. Mass spectrometry conditions: electron impact energy (70 eV); ion source temperature: 230 °C; quadrupole temperature: 150 °C; emission condition: 35 μA; scanning speed: 1.9 scans / s; mass scanning range: 30 - 450 amu. The qualitative analysis of volatile flavor compounds was carried out by retrieving the NIST17 mass spectrometry library, and the compounds were determined according to information such as the matching degree and ion fragments. Then, the retention index (RI) was calculated using C7 - C30 n-alkanes and compared with the reported values in the literature. The two were combined for the qualitative analysis of volatile compounds in sour cream samples. The internal standard method was used for quantitative analysis, and the content of each component was calculated through the peak area ratio.

[0059] (6) Sensory evaluation

[0060] The sensory evaluation indexes include three aspects: appearance, odor, and taste. The appearance attributes include color and texture; the odor attributes include sourness, milk fragrance, fruit fragrance, sweet fragrance, fishy smell; the taste attributes include sourness, sweetness, astringency, bitterness, and buttery feeling. The sensory scoring standard: 0 means none, 1 - 3 means weak, 4 - 6 means medium, 7 - 9 means strong, and the result is the average value. The sensory evaluation panel consists of ten researchers.

[0061] It can be seen from Figure 1 that after 20 h of fermentation by Lactobacillus casei GD1, the pH decreased to 4.68; after 20 h of fermentation by the commercial starter, the pH decreased to 4.39; after 20 h of fermentation by Lactobacillus casei SN110, the pH decreased to 5.10.

[0062] As shown in Table 1, after fermentation by Lactobacillus casei, the titratable acidity value of sour cream reached 74.34 °T; after fermentation by Lactobacillus casei, the titratable acidity value of sour cream reached 68.62 °T; the titratable acidity value of sour cream after fermentation by the commercial starter reached 74.5 °T, all meeting the acidity requirements of sour cream by the US Department of Agriculture.

[0063] Table 1 Titratable acidity values of sour cream

[0064]

[0065] As shown in Table 2, the water-holding capacity of sour cream fermented by Lactobacillus casei GD1 is relatively good, being 74.38%, similar to that of the commercial starter culture, while the water-holding capacity of Lactobacillus casei SN110 is relatively low, only reaching 66.44%.

[0066] Table 2 Water-holding capacity of sour cream

[0067]

[0068] The texture of sour cream fermented by different strains was measured. Hardness is equivalent to the force used to bite and crush the sample with teeth. Within a certain range, the higher the hardness, the better the fermentation of sour cream and the higher the product quality. Adhesiveness represents the resistance received by the probe during the recovery process, equivalent to the adhesiveness in the oral cavity. The higher the adhesiveness, the better the product quality. Cohesiveness refers to the degree of cohesion of the internal structure of the product. The greater the cohesiveness, the more stable the internal structure.

[0069] The texture measurement results are shown in Table 3. The hardness of sour cream fermented by Lactobacillus casei GD1 is similar to that of the commercial starter culture, and its adhesiveness is significantly higher than that of the commercial starter culture and Lactobacillus casei SN110. In addition, its elasticity, cohesiveness, chewiness, and gumminess are all relatively high, indicating that the sour cream fermented by Lactobacillus casei has better quality.

[0070] Table 3 Texture measurement results of sour cream

[0071]

[0072]

[0073] Note: Different letters in the same column indicate significant differences (p < 0.05).

[0074] The detection results of flavor substances in sour cream fermented by different strains are as Figure 2 shown. A total of 16 volatile flavor substances were detected, including 7 ketones, 7 acids, and 2 lactones. After fermentation, the content of flavor substances can be significantly increased. Compared with the commercial starter culture, Lactobacillus casei GD1 can produce relatively more 2,3-butanedione (473 μg / kg), acetoin (1724 μg / kg), and lactones (436 μg / kg), giving the sour cream sample an obvious milk flavor.

[0075] The sensory evaluation results are as Figure 3As shown, the overall sensory properties of Lactobacillus casei GD1 are similar to those of commercial starters. It has a strong sour taste, milk aroma, and sweet fragrance, and is favored by sensory evaluators. The milk aroma of Lactobacillus casei GD1 is slightly higher than that of commercial starters. This strain can metabolize to produce 2,3-butanedione and lactone substances, significantly enhancing the milk aroma attribute of the sample.

[0076] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A strain of Lacticaseibacillus casei GD1, which was deposited at the Guangdong Provincial Microbial Culture Collection Center on December 30, 2024, with the deposit number GDMCC No: 65692.

2. A microbial preparation containing the Lacticaseibacillus casei GD1 described in claim 1.

3. The microbial preparation according to claim 2, wherein In the microbial preparation, the cell count of Lactobacillus casei GD1 is not less than 1×10 7 CFU / mL.

4. A product containing the Lacticaseibacillus casei GD1 described in claim 1 or the microbial preparation described in claim 2.

5. The product according to claim 4, wherein, The product includes food, medicine, or health products; the food includes fermented food; the fermented food includes sour cream.

6. A method for preparing milk-flavored sour cream, characterized in that, Adding the Lacticaseibacillus casei GD1 described in claim 1 or the microbial preparation described in claim 2 to a substrate containing cream for fermentation.

7. The method according to claim 6, characterized in that In the substrate, the inoculation amount of Lactobacillus casei GD1 is not less than 1×10 7 CFU / mL or 1×10 7 CFU / g; the substrate contains 70-90% light cream and 10-30% milk.

8. The method according to claim 7, wherein Fermenting at 30°C - 37°C for 18 - 24 h; then ripening at 1°C - 5°C for at least 24 h.

9. A method for improving flavor substances in fermented dairy products, characterized in that, Adding the Lacticaseibacillus casei GD1 described in claim 1 or the microbial preparation described in claim 2 to dairy products for fermentation; the flavor substances include 2,3 - butanedione, acetoin, and / or lactone.

10. Use of the Lacticaseibacillus casei GD1 described in claim 1 or the microbial preparation described in claim 2 in the preparation of fermented food.

Citation Information

Patent Citations

  • A strain of Lactobacillus paracasei and its application

    CN109652326B