Bacillus licheniformis and application thereof
By using biological fungal agents made of Bacillus licheniformis, the drug resistance and environmental pollution problems of chemical pesticides in the prior art have been solved, and the dual effects of broad-spectrum disease prevention and control and crop growth promotion have been achieved, especially in the prevention and control of pumpkin anthrax and crop yield increase.
Patent Information
- Application Number
- CN202510740389.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-05
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2045-06-05
AI Technical Summary
Existing chemical pesticides have drug resistance and environmental pollution problems in the process of preventing and controlling plant diseases, and existing biological control methods lack broad-spectrum and proliferation effects of biological strains.
Bacillus licheniformis CGMCC No. 29258 is used to make biological fungal agents, which are used to prevent and treat a variety of plant diseases and promote crop growth. The dosage forms include wettable powders, water dispersed granules, etc., with a concentration of 100,000 cfu/mL-50 million cfu/mL.
It significantly prevents and treats a variety of plant diseases, especially pumpkin anthrax prevention and control effect reaches more than 95%, while promoting crop growth, improving yield and quality, and being environmentally friendly and pollution-free.
Smart Images

Figure CN120249148A_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of bio-agricultural technology, and particularly relates to a Bacillus licheniformis and its uses. Background Art
[0002] Since the 20th century, the growth of the world's population has placed a major demand on the stable production and quality of agricultural products. With the widespread use of chemical fertilizers and pesticides, although the world's food production has increased significantly, diseases caused by plant pathogens are still one of the "prime culprits" threatening yield stability. Taking potato (Solanum tuberosum L.) as an example, Fusarium wilt (FW) and Fusarium dry rot (FDR) induced by Fusarium are widespread in potato planting areas. FW can cause a 30-50% yield loss and a decline in tuber quality; while FDR is a common post-harvest fungal disease during potato storage, which can cause a reduction in production of up to 50-60%. FW and FDR are among the most serious problems in modern agriculture and the food industry.
[0003] At present, chemical pesticides are mostly used to avoid diseases. However, the overuse of chemical pesticides has caused pathogenic fungi to develop a certain degree of drug resistance, and the resulting food safety and environmental pollution problems have become increasingly prominent. Therefore, seeking new, efficient, and pollution-free disease control measures has become an urgent need for global food security. Biological control represented by microorganisms such as Bacillus, Streptomyces, and Trichoderma has shown initial results, and the biological control strategy of "using bacteria to control bacteria" has received increasing attention and recognition from the industrial and academic circles.
[0004] As common crop endophytes, Bacillus microorganisms have a broad-spectrum inhibitory effect on a variety of plant pathogens, such as Rhizoctonia solani, Glomerella cingulata, Sclerotium rolfsii, Botrytiscinerea, etc. Their bactericidal effect is higher than or close to that of chemically synthesized fungicides. They can eliminate brown leaf spots, effectively inhibit rice blast, inhibit Aspergillus flavus fungi, and reduce the content of aflatoxin in leguminous plants.
[0005] Research shows that different biocontrol strains have their unique antibacterial spectra. Most strains can only target individual or a few types of plant diseases, and broad-spectrum strains rarely appear. The developed products need to be compounded with multiple strains. To improve the disease prevention effect of microbial agents and simplify the product development process, continuously searching for new strains with broad-spectrum control effects on a variety of plant diseases and promoting plant growth will be the focus of continuous research in this field. Summary of the Invention
[0006] The purpose of the present application is to provide a Bacillus licheniformis and its application. The Bacillus licheniformis has dual functions, being able to have a broad-spectrum antibacterial effect, prevent and control plant diseases, and also promote the growth of crops and improve the quality of crops.
[0007] Specifically, the present application relates to the following aspects:
[0008] 1. A Bacillus licheniformis ( Bacillus licheniformis ), which is deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms, with the deposit number of CGMCC No. 29258.
[0009] 2. A biological bactericide, which contains the Bacillus licheniformis described in item 1.
[0010] 3. The biological bactericide according to item 2, wherein the biological bactericide further contains agriculturally acceptable excipients.
[0011] 4. The biological bactericide according to item 2 or 3, wherein the dosage form of the biological bactericide is wettable powder, water dispersible granule, granule, liquid agent, powder, emulsion in water, suspension, suspoemulsion, microemulsion, capsule, tablet or biofilm agent.
[0012] 5. The biological bactericide according to item 2 or 3, wherein the concentration of the Bacillus licheniformis in the biological bactericide is 100,000 cfu / mL - 50,000,000 cfu / mL.
[0013] 6. The use of the Bacillus licheniformis described in item 1 or the biological bactericide described in any one of items 2 - 5 in the prevention and control of plant diseases.
[0014] 7. The use according to item 6, wherein the plant diseases are selected from one or more of the following: Colletotrichum orbiculare of pumpkin, Colletotrichum capsici of pepper, Colletotrichum phomoides of tomato, Colletotrichum orbiculare of watermelon, Colletotrichum gloeosporioides of mango, Rhizoctonia solani of eggplant, Rhizoctonia solani of pepper, Rhizoctonia solani of cucumber, Rhizoctonia solani of strawberry, Rhizoctonia cerealis of wheat, Rhizoctonia zeae of corn, Botrytis cinerea of tomato, Botrytis cinerea of cucumber, Botrytis cinerea of strawberry, Botrytis cinerea of grape, Alternaria solani of tomato, Alternaria solani of potato, Tilletia caries of wheat, Tilletia horrida of highland barley, Tilletia zeae of corn, Verticillium dahliae of potato, Verticillium dahliae of watermelon, Verticillium dahliae of strawberry, Verticillium dahliae of cotton, Fusarium oxysporum f. sp. cubense of banana, Fusarium oxysporum f. sp. capsici of pepper, Fusarium oxysporum f. sp. niveum of watermelon, Sclerotinia sclerotiorum of rape, Sclerotinia sclerotiorum of sunflower, Rhizoctonia solani of tomato, Rhizoctonia solani of cucumber, Rhizoctonia solani of soybean, Rhizoctonia solani of potato, Pythium aphanidermatum of tomato, Pythium aphanidermatum of cucumber, Pythium aphanidermatum of watermelon, Pseudoperonospora cubensis of watermelon, Bremia lactucae of Chinese cabbage, Ralstonia solanacearum of tomato, Ralstonia solanacearum of potato, Ralstonia solanacearum of pepper, Pseudomonas solanacearum of ginger, Erwinia amylovora of pear, Erwinia amylovora of apple, Erwinia carotovora subsp. carotovora of celery, Erwinia carotovora subsp. carotovora of Chinese cabbage, Erwinia carotovora subsp. carotovora of tomato, Erwinia carotovora subsp. carotovora of cucumber, Erwinia carotovora subsp. carotovora of welsh onion, Pseudomonas syringae pv. lachrymans of cucumber, Pseudomonas syringae pv. lachrymans of muskmelon, Pseudomonas syringae pv. glycinea of soybean, Pseudomonas syringae pv. syringae of sorghum, Xanthomonas axonopodis pv. citri of citrus, Pseudomonas syringae pv. actinidiae of kiwifruit, Clavibacter michiganensis subsp. michiganensis of tomato, Xanthomonas oryzae pv. oryzae of rice, Xanthomonas campestris pv. musacearum of banana, Xanthomonas campestris pv. campestris of rape, Xanthomonas campestris pv. campestris of cabbage.
[0015] 8. The use according to item 6 or 7, wherein the plants are selected from one or more of the following: pumpkin, eggplant, tomato, pepper, cucumber, potato, Chinese cabbage, rape, celery, cabbage, watermelon, mango, strawberry, grape, banana, pear, apple, muskmelon, citrus, kiwifruit, wheat, corn, highland barley.
[0016] 9. The use of the Bacillus licheniformis described in item 1 or the biological bacterial agent described in any one of items 2 - 5 in promoting plant growth.
[0017] 10. The use according to item 9, wherein the plants are selected from one or more of the following: pumpkin, eggplant, tomato, pepper, cucumber, potato, Chinese cabbage, rape, celery, cabbage, watermelon, mango, strawberry, grape, banana, pear, apple, muskmelon, citrus, kiwifruit, wheat, corn, highland barley, sorghum, rice, soybean, cotton, sunflower, ginger, welsh onion.
[0018] Advantages of the present application
[0019] The strain of the present application has a good broad - spectrum antibacterial effect, and has a good inhibitory effect on various plant fungal pathogens and bacterial pathogens that cause plant diseases. In particular, it has a good control effect on Colletotrichum orbiculare of pumpkin. Using a bacterial agent dilution of 10 million cfu / mL, the control effect on Colletotrichum orbiculare of pumpkin reaches more than 95%, and the control efficacy is remarkable.
[0020] The strain of the present application and the biological bacterial agent containing the strain can effectively overcome the defect of single control effect of existing products, and can further promote the growth of crop plants. Moreover, the Bacillus licheniformis is collected from the natural environment, safe, environmentally friendly and pollution-free, and has broad application prospects. Description of the Drawings
[0021] Figure 1 It is the colony morphology diagram of Bacillus licheniformis.
[0022] Figure 2 It is the schematic diagram of the comparison of the growth of pumpkin stalks after using the Bacillus licheniformis (Treatment 2) and the conventional treatment.
[0023] Figure 3 It is the schematic diagram of the comparison of the single-plant yield of eggplants after using the Bacillus licheniformis (Treatment 2) and the conventional treatment. Detailed Embodiments
[0024] The present application will be further described below in conjunction with embodiments. It should be understood that the embodiments are only used to further illustrate and explain the present application, and are not used to limit the present application.
[0025] Unless otherwise defined, the technical and scientific terms in this specification have the same meaning as commonly understood by those skilled in the art. Although methods and materials similar or equivalent to those described herein can be used in experiments or practical applications, the materials and methods are still described below. In case of conflict, the present specification, including the definitions therein, shall prevail. In addition, the materials, methods and examples are for illustrative purposes only and are not restrictive. The present application will be further described below in conjunction with specific embodiments, but is not used to limit the scope of the present application.
[0026] Definition
[0027] As used herein, "broad-spectrum" means having a wide range of uses and acting on most objects. In the present application, it means that it can be used for a variety of plants and has a control effect on a variety of plants.
[0028] For example, in some embodiments, the Bacillus licheniformis of the present application can be used to prevent and control a variety of plant diseases, including but not limited to pumpkin anthracnose, pepper anthracnose, tomato anthracnose, watermelon anthracnose, mango anthracnose, eggplant basal rot, pepper basal rot, cucumber basal rot, strawberry basal rot, wheat basal rot, corn basal rot, tomato gray mold, cucumber gray mold, strawberry gray mold, grape gray mold, tomato early blight, potato early blight, wheat smut, highland barley smut, corn smut, potato verticillium wilt, watermelon verticillium wilt, strawberry verticillium wilt, cotton verticillium wilt, banana wilt, pepper wilt, watermelon wilt, rape sclerotinia blight, sunflower sclerotinia blight, tomato damping-off, cucumber damping-off, soybean damping-off, potato black scurf, tomato damping-off, cucumber damping-off, watermelon damping-off, watermelon downy mildew, Chinese cabbage downy mildew, tomato bacterial wilt, potato bacterial wilt, pepper bacterial wilt, ginger bacterial wilt, pear fire blight, apple fire blight, celery soft rot, Chinese cabbage soft rot, tomato soft rot, cucumber soft rot, welsh onion soft rot, cucumber angular leaf spot, melon angular leaf spot, soybean angular leaf spot, sorghum bacterial leaf spot, citrus canker, kiwifruit canker, tomato canker, rice bacterial leaf blight, banana bacterial leaf blight, rape black rot, cabbage black rot.
[0029] As used herein, the term "plant disease" refers to the phenomenon that a plant undergoes a series of morphological, physiological, and biochemical pathological changes under the influence of biological or abiotic factors, which hinders the normal growth and development process and thus affects the economic benefits of humans.
[0030] Strains and biological agents
[0031] The present application provides a Bacillus licheniformis ( Bacillus licheniformis ), which was deposited on December 7, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing 100101. Its taxonomic name is Bacillus licheniformis ( Bacillus licheniformis ), and the deposit number is CGMCC No. 29258.
[0032] The sequence of the 16S rRNA of the Bacillus licheniformis is shown as SEQ ID NO: 3:
[0033]
[0034] The strain of the present application was screened from soil samples in the Tibetan area of Ganzi Plateau. The strain has excellent control effects. For example, it has good control effects on diseases such as pumpkin anthracnose, eggplant basal stem rot, and tomato bacterial wilt. Especially for pumpkin anthracnose, its control effect can reach more than 95% when the dilution concentration is 10 million cfu / mL.
[0035] In the present application, the control effect is calculated by the following formula:
[0036] Relative control effect (%) = (disease index of the control group - disease index of the treatment group) / disease index of the control group × 100.
[0037] The present application also provides a biological bactericide, which contains the above-mentioned Bacillus licheniformis.
[0038] In some embodiments, the biological bactericide further contains agriculturally acceptable excipients.
[0039] In the present application, the agriculturally acceptable excipients are commonly used excipients in the art and can be used to prepare corresponding dosage forms.
[0040] In some embodiments, the excipients can be selected from one or more of the following: solvents, synergists, stabilizers, dispersants, fillers, wetting agents, adhesives, mainly including water, glucose, amino acids, citric acid, starch, xanthan gum, sodium alginate, polyethylene glycol, etc.
[0041] In some embodiments, the dosage form of the biological bactericide can be wettable powder, water dispersible granule, granule, liquid agent, powder, water emulsion, suspension, suspo-emulsion, microemulsion, capsule, tablet or biofilm agent.
[0042] In the present application, the preparation methods of wettable powder, water dispersible granule, granule, liquid agent, powder, water emulsion, suspension, suspo-emulsion, microemulsion, capsule, tablet or biofilm agent are not limited in any way, and they can be prepared by conventional methods in the art.
[0043] The concentration of Bacillus licheniformis in the biological bacterial agent can be adjusted according to actual needs. In some embodiments, the concentration of Bacillus licheniformis in the biological bacterial agent is 100,000 cfu / mL - 50 million cfu / mL. For example, it can be 100,000 cfu / mL, 1 million cfu / mL, 2 million cfu / mL, 3 million cfu / mL, 4 million cfu / mL, 5 million cfu / mL, 6 million cfu / mL, 7 million cfu / mL, 8 million cfu / mL, 9 million cfu / mL, 10 million cfu / mL, 15 million cfu / mL, 20 million cfu / mL, 25 million cfu / mL, 30 million cfu / mL, 35 million cfu / mL, 40 million cfu / mL, 45 million cfu / mL, 50 million cfu / mL, etc.
[0044] In some embodiments, the concentration of Bacillus licheniformis in the biological bacterial agent is 1 million cfu / mL - 10 million cfu / mL.
[0045] Uses of the strains
[0046] The present application provides the use of the above-mentioned Bacillus licheniformis or the above-mentioned biological bacterial agent in preventing and controlling plant diseases.
[0047] In some embodiments, the plant diseases are selected from one or two of the following: pumpkin anthracnose, pepper anthracnose, tomato anthracnose, watermelon anthracnose, mango anthracnose, eggplant basal stem rot, pepper basal stem rot, cucumber basal stem rot, strawberry basal stem rot, wheat basal stem rot, corn basal stem rot, tomato gray mold, cucumber gray mold, strawberry gray mold, grape gray mold, tomato early blight, potato early blight, wheat smut, highland barley smut, corn smut, potato verticillium wilt, watermelon verticillium wilt, strawberry verticillium wilt, cotton verticillium wilt, banana wilt, pepper wilt, watermelon wilt, rape sclerotinia rot, sunflower sclerotinia rot, tomato damping-off, cucumber damping-off, soybean damping-off, potato black scurf, tomato damping-off, cucumber damping-off, watermelon damping-off, watermelon downy mildew, Chinese cabbage downy mildew, tomato bacterial wilt, potato bacterial wilt, pepper bacterial wilt, ginger bacterial wilt, pear fire blight, apple fire blight, celery soft rot, Chinese cabbage soft rot, tomato soft rot, cucumber soft rot, welsh onion soft rot, cucumber angular leaf spot, melon angular leaf spot, soybean angular leaf spot, sorghum bacterial leaf spot, citrus canker, kiwifruit canker, tomato canker, rice bacterial blight, banana bacterial blight, rape black rot, cabbage black rot.
[0048] In some embodiments, the plant diseases are selected from one or more of pumpkin anthracnose, eggplant basal stem rot, and tomato bacterial wilt.
[0049] In some embodiments, the plant is selected from one or more of the following: pumpkin, eggplant, tomato, pepper, cucumber, potato, Chinese cabbage, rape, celery, cabbage, watermelon, mango, strawberry, grape, banana, pear, apple, melon, citrus, kiwifruit, wheat, corn, highland barley, sorghum, rice, soybean, cotton, sunflower, ginger, green onion.
[0050] The strain has an excellent control effect on pumpkin anthracnose, and the control effect on pumpkin anthracnose can reach 95.22%. In addition, the strain also has a good control effect on pepper anthracnose, tomato anthracnose, watermelon anthracnose, mango anthracnose, eggplant basal rot, pepper basal rot, cucumber basal rot, strawberry basal rot, wheat basal rot, corn basal rot, tomato gray mold, cucumber gray mold, strawberry gray mold, grape gray mold, tomato early blight, potato early blight, wheat smut, highland barley smut, corn smut, potato verticillium wilt, watermelon verticillium wilt, strawberry verticillium wilt, cotton verticillium wilt, banana wilt, pepper wilt, watermelon wilt, rape sclerotinia, sunflower sclerotinia, tomato damping-off, cucumber damping-off, soybean damping-off, potato black scurf, tomato damping-off, cucumber damping-off, watermelon damping-off, watermelon downy mildew, Chinese cabbage downy mildew, tomato bacterial wilt, potato bacterial wilt, pepper bacterial wilt, ginger bacterial wilt, pear fire blight, apple fire blight, celery soft rot, Chinese cabbage soft rot, tomato soft rot, cucumber soft rot, green onion soft rot, cucumber angular leaf spot, melon angular leaf spot, soybean angular leaf spot, sorghum bacterial leaf spot, citrus canker, kiwifruit canker, tomato canker, rice bacterial blight, banana bacterial blight, rape black rot, cabbage black rot, etc., that is, the strain has a good broad-spectrum antibacterial effect.
[0051] The present application provides the use of the above-mentioned Bacillus licheniformis or the above-mentioned biological bactericide in promoting plant growth.
[0052] In some embodiments, the plant is selected from one or more of the following: pumpkin, eggplant, tomato, pepper, cucumber, potato, Chinese cabbage, rape, celery, cabbage, watermelon, mango, strawberry, grape, banana, pear, apple, melon, citrus, kiwifruit, wheat, corn, highland barley, sorghum, rice, soybean, cotton, sunflower, ginger, green onion.
[0053] When the strain of the present application acts on pumpkins, it can increase the stem diameter, stem height, average single fruit yield and growth rate of pumpkins; when it acts on eggplants, it can increase the stem diameter, plant height, average single fruit yield and growth rate of eggplants; when it acts on cherry tomatoes, it can increase the stem diameter, plant height, average single fruit yield and growth rate of cherry tomatoes.
[0054] In summary, the Bacillus licheniformis described in the present application has excellent control effects on plant diseases, especially for pumpkin anthracnose, the control effect is extremely significant. In addition, the strain can promote the growth of crop plants and greatly improve the production performance of plants.
[0055] In addition, the Bacillus licheniformis described in the present application has a broad spectrum of plant diseases, and compared with the prior art, it can overcome the defect of single protective effect.
[0056] Example
[0057] The present application provides a general and / or specific description of the materials and test methods used in the experiments. In the following examples, unless otherwise specified, % represents wt%, i.e., weight percentage. The reagents or instruments used without indicating the manufacturer are all conventional reagent products that can be purchased commercially.
[0058] Example 1 Strain origin, screening and identification
[0059] (1) Source of strain
[0060] The Bacillus licheniformis strain was isolated from the soil of the Tibetan area of Ganzi Plateau, and the isolation and purification method was as follows:
[0061] Take 1-3 g of soil sample, add 30 mL of PBS buffer, and add culture medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 5 g / L glucose), and culture at 37°C and 200 rpm for 30-60 min. After the culture is completed, let it settle naturally, take 100 μL of supernatant, spread it on the LB solid plate, and culture it at 37°C for 14-16 h. After the colony on the plate grows to 2 / 3 of the culture medium, pick a single colony for separation and purification until the colonies grown on each plate have the same morphology and color, that is, a single strain, and save the purified strain on the slant culture medium.
[0062] (2) Screening of strains
[0063] Method 1: Fungal pathogens were isolated using the plate confrontation method. The fungal pathogens required for the experiment were inoculated on the PDA culture medium for activation and culture. After the center of the plate was determined by the cross method, a sterile puncher with a diameter of 5 mm was used to punch holes at the edge of the activated pathogen colony and take the bacterial cake. The side with mycelium on the bacterial cake was transferred to the center of the blank PDA plate with a sterile toothpick facing down. The strains to be screened were inoculated at equal distances from the center around it and placed in an incubator for culture. Three replicates were set for each group of treatments to observe the growth of the pathogens and screen out strains with good inhibition of the growth of fungal pathogens.
[0064] Method 2: For bacterial pathogens, the inhibition zone method is used. The bacterial pathogens required for the experiment are separately inoculated on LB medium for activation and cultured for standby. Single colonies of the strains to be screened are picked and inoculated into LB liquid medium, and cultured with shaking at 200 rpm and 37 °C for 24 h. The cultured bacterial solution is diluted with sterile water and spotted in the center of a blank LB plate, sprayed with the diluted pathogenic bacterial solution, and cultured in an incubator at 37 °C for 24 h. Three replicates are set for each treatment, the situation of the inhibition zone is observed, and the strains with good effects on inhibiting the growth of bacterial pathogens are screened out.
[0065] The results of Method 1 show that the said strains have good antibacterial effects on the pathogens (fungal) of Colletotrichum orbiculare of pumpkin, Colletotrichum capsici of pepper, Colletotrichum lycopersici of tomato, Colletotrichum orbiculare of watermelon, Colletotrichum gloeosporioides of mango, Rhizoctonia solani of eggplant, Rhizoctonia solani of pepper, Rhizoctonia solani of cucumber, Rhizoctonia solani of strawberry, Rhizoctonia solani of wheat, Rhizoctonia solani of corn, Botrytis cinerea of tomato, Botrytis cinerea of cucumber, Botrytis cinerea of strawberry, Botrytis cinerea of grape, Alternaria solani of tomato, Alternaria solani of potato, Tilletia caries of wheat, Ustilago nuda of highland barley, Ustilago maydis of corn, Verticillium dahliae of potato, Verticillium dahliae of watermelon, Verticillium dahliae of strawberry, Verticillium dahliae of cotton, Fusarium oxysporum f. sp. cubense of banana, Fusarium oxysporum f. sp. capsici of pepper, Fusarium oxysporum f. sp. niveum of watermelon, Sclerotinia sclerotiorum of rape, Sclerotinia sclerotiorum of sunflower, Rhizoctonia solani of tomato, Rhizoctonia solani of cucumber, Rhizoctonia solani of soybean, Rhizoctonia solani of potato, Pythium aphanidermatum of tomato, Pythium aphanidermatum of cucumber, Pythium aphanidermatum of watermelon, Pseudoperonospora cubensis of watermelon, Peronospora parasitica of Chinese cabbage. The results are shown in Table 1.
[0066] Table 1 Antibacterial spectrum of the screened strains against fungal pathogens
[0067]
[0068] Note: If there is an antagonistic effect, it is indicated by "+"; if there is no antagonistic effect, it is indicated by "-".
[0069] The results of Method 2 show that the said strains have good antibacterial effects on the pathogens (bacterial) of bacterial wilt of tomato, bacterial wilt of potato, bacterial wilt of pepper, bacterial wilt of ginger, Erwinia amylovora of pear, Erwinia amylovora of apple, soft rot of celery, soft rot of Chinese cabbage, soft rot of tomato, soft rot of cucumber, soft rot of Chinese onion, angular leaf spot of cucumber, angular leaf spot of melon, angular leaf spot of soybean, bacterial leaf spot of sorghum, citrus canker, kiwifruit canker, tomato canker, bacterial blight of rice, bacterial blight of banana, black rot of rape, black rot of cabbage. The results are shown in Table 2.
[0070] Table 2 Antibacterial spectrum of the screened strains against bacterial pathogens
[0071]
[0072] (3) Strain identification of the screened strains
[0073] The colony morphology of the screened strains is as Figure 1As shown, the colony morphology is light yellow, moist, with a transparent mucus at the edge, and there is an umbrella-shaped line fold bulge in the center of the colony.
[0074] The 16s rRNA sequence of this strain was amplified with the universal primers 27F (5'-3') AGAGTTTGATCCTGGCTCAG (SEQ ID NO:1) and 1492R (5'-3'): TACGGCTACCTTGTTACGACTT (SEQ ID NO:2). Among them, the amplification reaction system is shown in Table 3, and the amplification reaction conditions are shown in Table 4.
[0075] Table 3 PCR amplification system
[0076]
[0077] Table 4 PCR reaction conditions
[0078]
[0079] Based on the PCR reaction, the 16s rRNA sequence was obtained, which is shown as SEQ ID NO:3. It was compared for homology with other 16s rRNA sequences in the NCBI database (National Center for Biotechnology Information, National Center for Biotechnology Information (nih.gov)), and the screened strain was identified as Bacillus licheniformis.
[0080]
[0081] This strain was deposited on December 7, 2023 at the China General Microbiological Culture Collection Center (CGMCC), located at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. Its taxonomic name is Bacillus licheniformis ( Bacillus licheniformis ), and the deposit number is CGMCC No. 29258.
[0082] Example 2 Field experiment on the strain's effect in controlling pumpkin anthracnose and promoting growth
[0083] (1) Test site: Mu Us Sandy Land, Yanchi County, Wuzhong City, Ningxia Hui Autonomous Region
[0084] (2) Test design: Root irrigation was carried out 7 days after pumpkin transplantation. The irrigation volume each time was 200 mL, and root irrigation was carried out 2 times, with a 10-day interval between each time. Five bactericide treatments were set, with water treatment as the blank control. Three replicates were set for each treatment group, totaling 18 plots, and each plot was 100 m 2 . The bactericide treatment was prepared by a conventional method in the art, that is, the seed liquid containing activated Bacillus licheniformis was inoculated into LB liquid medium, and cultured with shaking at 37 °C and a shaking speed of 200 r / min for 36 h.
[0085] At the adult plant stage, the disease spot incidence of pumpkin leaves in the control group and the treatment group was examined, the total number of investigated plants and the total number of diseased plants were recorded, and classified, and the disease index and control effect were calculated. At the harvest stage, 20 pumpkins were selected by the 5-point sampling method in each plot, tagged and tracked to record the yield. From the start to the end of the harvest, they were picked and weighed respectively and recorded, and the average single fruit weight and the yield increase rate were calculated; at the same time, indicators such as the stem diameter and stem height at the harvest stage were investigated and statistically analyzed.
[0086] (3) Test treatment design is shown in Table 5
[0087] Table 5 Information on the treatment grouping of the test design
[0088]
[0089] (4) Investigation method and results
[0090] The incidence of pumpkin anthracnose was investigated. The incidence rate was measured by the 5-point sampling method, with 5 m at each point 2, investigate the total number of plants at each point, calculate the total number of plants in each plot from the average value of each point, and finally calculate the incidence rate and disease index of each plot. Calculate the relative control effect from the disease index. The calculation methods are as follows: Incidence rate (%) = Number of diseased plants / Total number of plants investigated × 100, Disease index = 100 × ∑(Number of diseased plants at each level × Level) / (Total number of plants × Representative value of the highest level), Relative control effect (%) = (Disease index of the control group - Disease index of the treatment group) / Disease index of the control group × 100.
[0091] Grading standard: Grade 0: The plant shows no anthracnose symptoms, and the leaves, stems, and fruits all appear healthy with no lesions on the surface. Grade 1: A small number (1 - 5) of round lesions appear on the leaves. The color of the lesions is relatively light, mostly brown; no lesions are seen on the stems and fruits. Grade 2: The number of lesions on the leaves increases to 6 - 10, the color of the lesions deepens, and a grayish-white color may appear in the center. 1 - 2 small lesions appear on the stems; the fruits are not diseased yet. Grade 3: The number of lesions on the leaves exceeds 10, and some lesions begin to merge. The leaves show slight yellowing and curling; the number of lesions on the stems reaches 3 - 5, and the lesions are slightly sunken; a small number (1 - 3) of round lesions begin to appear on the fruits, and the color of the lesions is relatively dark. Grade 4: The lesions on the leaves are largely merged, and the lesion area exceeds 50% of the total leaf area. The leaves are severely yellowed and withered, and some leaves begin to fall off; the number of lesions on the stems is greater than 5, and the lesions are significantly sunken; the number of lesions on the fruits is relatively large, more than 3, and signs of rot begin to appear at the lesion sites, with black dots or pink sticky substances. The test results are shown in Table 6.
[0092] Table 6 Control situation of different treatment groups of Bacillus licheniformis on pumpkin anthracnose
[0093]
[0094] Investigate the stem diameter and stem height of the pumpkin, and calculate the average weight per fruit and the yield increase rate at the harvesting stage. The average weight per fruit is measured by the five-point sampling method, with 5 m at each point 2 , and calculate based on the average yield of the five points. The formula for the yield increase rate is as follows: Yield increase rate % = (Average yield of the treatment plot - Average yield of the CK water plot) / Average yield of the CK water plot * 100%. The test results are shown in Table 7.
[0095] Table 7 Growth promotion situation of different treatment groups of Bacillus licheniformis on pumpkin anthracnose
[0096]
[0097] As can be seen from Table 6 and Table 7, Bacillus licheniformis has a good control effect on Colletotrichum orbiculare of pumpkin, and during the test process, no phytotoxicity to pumpkin was found, and the plants grew well. The incidence rate of the bacterium agent treatment group decreased significantly, and Treatment 2 decreased by 89.71% compared with the control group. The root irrigation treatment with Bacillus licheniformis bacterium agent not only controls Colletotrichum orbiculare of pumpkin, but also further promotes the growth of pumpkin. The stem diameter and stem height have increased to varying degrees, and the average single fruit weight has increased by up to 81.67% compared with the control group (see Figure 2 ), effectively improving the growth and production quality of pumpkin plants.
[0098] Example 3 Field Test of the Strain in Controlling Eggplant Stem Rot and Growth Promotion Effect
[0099] (1) Test site: Vegetable base in Shouguang City, Weifang City, Shandong Province.
[0100] (2) Test design: Root irrigation treatment was carried out 7 days after eggplant transplantation. The irrigation volume each time was 200 mL, and the root irrigation was carried out 2 times, with an interval of 10 days each time. 5 bacterium agent treatments were set, and the water treatment was used as the blank control. 3 replicates were set for each treatment group, with a total of 18 plots, and each plot was 100 m 2 . The preparation method of the bacterium agent is the same as that in Example 2.
[0101] During the adult plant stage, check the disease incidence of the eggplant plants in the control group and the treatment group, record the total number of investigated plants and the total number of diseased plants, and classify them to calculate the disease index and control effect. During the harvest period, 20 eggplants were selected by the 5-point sampling method in each plot, tagged and tracked to record the yield. From the start of harvesting to the end of harvesting, they were picked, weighed and recorded respectively, and the average single fruit weight and yield increase rate were calculated; at the same time, the stem diameter, plant height and other indicators during the harvest period were investigated and statistically analyzed.
[0102] (3) The test treatment design principle is the same as that in Example 2.
[0103] (4) Investigation method and results
[0104] Investigate the disease incidence of eggplant stem rot. The calculation methods of the incidence rate, disease index and relative control effect are the same as those in Example 2.
[0105] Grading criteria: Grade 0: There are no disease spots at the base of the plant stem, no abnormal phenomena such as discoloration and rot, the overall growth of the plant is strong, and there are no abnormal above-ground manifestations such as yellowing and wilting of leaves that may be caused by basal stem rot. Grade 1: Slight symptoms appear at the base of the stem, the diseased spot area accounts for less than 10% of the total area of the stem base, the shape is irregular, only limited to the epidermis, and has not penetrated into the internal tissue. Occasionally, 1 - 2 leaves above the ground are slightly yellowed, and the plant growth is basically normal, without obvious dwarfing or wilting. Grade 2: The diseased spot has developed, and the area accounts for 10% - 30% of the total area of the stem base. The color of the diseased spot deepens to dark brown and begins to expand into the internal tissue of the stem base. Some leaves above the ground are yellowed, and slight dwarfing may occur, but there is no obvious wilting. Grade 3: The diseased spot area at the base of the stem further expands to reach 30% - 50% of the total area of the stem base. The color of the diseased spot turns black-brown, and the internal tissue is significantly rotten. The leaves above the ground are severely yellowed, the plant is significantly dwarfed, some branches show wilting, and the growth is severely inhibited. Grade 4: The diseased spot almost covers most of the stem base area, exceeding 50% of the total area. The stem base is severely rotten, showing a soft rot state, easily broken when gently pinched by hand, the plant loses its supporting ability and topples to the ground. Most of the leaves above the ground are withered and yellow, the plant basically stops growing and faces death. The test results are shown in Table 8.
[0106] Table 8 Control situation of different treatment groups of Bacillus licheniformis on eggplant basal stem rot
[0107]
[0108] Investigate the stem diameter and plant height of eggplants at the harvest stage, and calculate the average single fruit weight and yield increase rate during the harvest period. The calculation method of the average single fruit weight is the same as that in Example 2. The test results are shown in Table 9.
[0109] Table 9 Growth promotion situation of different treatment groups of Bacillus licheniformis on eggplant basal stem rot
[0110]
[0111] As can be seen from Table 8 and Table 9, Bacillus licheniformis has a good control effect on eggplant basal stem rot, and during the test process, no phytotoxicity to eggplants was found, and the plants grew well. The incidence rate of the bacterial agent treatment group was significantly reduced, and Treatment 2 was reduced by 78.95% compared with the control group. The root irrigation treatment with Bacillus licheniformis bacterial agent not only controlled the eggplant basal stem rot but also further promoted the growth of eggplants. The stem diameter and plant height both increased to varying degrees, and the maximum yield increase rate could reach 67.86%, effectively improving the yield of eggplant plants (see Figure 3 )
[0112] Example 4 Field test of the strain on controlling tomato bacterial wilt and growth promotion effect
[0113] (1)Test site: Tomato greenhouse in Shenxian County, Liaocheng City, Shandong Province.
[0114] (2)Root irrigation treatment was carried out 7 days after the planting of cherry tomatoes. The irrigation amount each time was 200 mL, and the root irrigation was carried out 2 times with an interval of 10 days between each time. Five bacterium agent treatments were set, and the treatment with clear water was used as the blank control. Three replicates were set for each treatment group, with a total of 18 plots, and each plot was 100 m 2 . The preparation method of the bacterium agent was the same as that in Example 2.
[0115] During the adult plant stage, the disease incidence of cherry tomato plants in the control group and the treatment group was examined, the total number of surveyed plants and the total number of diseased plants were recorded, and they were classified, and the disease index and control effect were calculated. During the harvest period, 20 cherry tomatoes were selected by the five-point sampling method in each plot, tagged and tracked to record the yield. From the start of harvesting to the end of harvesting, they were picked, weighed and recorded respectively, and the average yield per plant and the yield increase rate were calculated; at the same time, the stem diameter, plant height and other indicators during the harvest period were investigated and statistically analyzed.
[0116] (3)The design principle of the test treatment was the same as that in Example 2.
[0117] (4)Investigation method and results
[0118] The disease incidence of cherry tomato bacterial wilt was investigated, and the calculation methods of the incidence rate, disease index and relative control effect were the same as those in Example 2.
[0119] Classification standard: Grade 0: The plant has no symptoms, grows normally, and no bacterial wilt-related symptoms appear in the stem, leaves and other parts. Grade 1: Only a few leaves of the plant show slight wilting, generally not exceeding 25% of the total number of leaves of the whole plant, and there is no obvious lesion at the base of the stem. Grade 2: 25% - 50% of the leaves of the plant show wilting, the base of the stem begins to change color, showing light brown, but the lesion does not surround the base of the stem. Grade 3: 50% - 75% of the leaves of the plant wilt, the color of the lesion at the base of the stem deepens, becoming dark brown, and the lesion surrounds 50% - 75% of the base of the stem. The representative value is 3. Grade 4: More than 3 / 4 of the leaves of the plant wilt, or even the whole plant withers, the lesion at the base of the stem surrounds the base of the stem for more than one week, and the vascular bundle inside the stem turns brown seriously. The test results are shown in Table 10.
[0120] Table 10 Control of tomato bacterial wilt by different treatment groups of Bacillus licheniformis
[0121]
[0122] The stem diameter and plant height of cherry tomatoes during the harvest period were investigated, and the average yield per plant and the yield increase rate during the harvest period were calculated. The calculation method of the average weight of a single fruit was the same as that in Example 2. The test results are shown in Table 11.
[0123] Table 11 Growth promotion of tomato bacterial wilt by different treatment groups of Bacillus licheniformis
[0124]
[0125] As can be seen from Table 10 and Table 11, Bacillus licheniformis has a good control effect on bacterial wilt of cherry tomatoes, and during the experiment, no phytotoxicity to tomatoes was found, and the plants grew well. The incidence of the bacterial agent treatment group decreased significantly, and the relative control effect was up to over 80% at most. The root irrigation treatment with the Bacillus licheniformis bacterial agent not only controlled the bacterial wilt of cherry tomatoes but also further promoted the growth of tomato plants. The stem diameter and plant height both increased to varying degrees, and the highest yield increase rate could reach 64.34%, effectively improving the production performance of cherry tomato plants.
[0126] Example 5 Field Experiment of the Strain on Other Plants
[0127] The experimental treatment design of Example 5 was the same as that of Examples 2 - 4, all of which were root irrigation applications. The irrigation amount each time was 200 mL, and the root irrigation was carried out 2 times with an interval of 10 days between each time. Five bacterial agent treatments were set, with the water treatment as the blank control, and 3 replicates were set for each treatment. Among them, the calculation methods of the relative control effect and the yield increase rate were the same as those in Example 2, and the results are shown in Table 12 (fungal diseases) and Table 13 (bacterial diseases).
[0128] Table 12 Control and Growth Promotion of Different Treatment Groups of Bacillus licheniformis on Fungal Diseases
[0129]
[0130]
[0131]
[0132] Table 13 Control and Growth Promotion of Different Treatment Groups of Bacillus licheniformis on Bacterial Diseases
[0133]
[0134]
[0135] As can be seen from Table 12 and Table 13, the strain has shown significant effects in the control of plant diseases, and its control scope covers most common plant disease types. Among these diseases, there are both fungal - induced diseases such as common anthracnose and gray mold, and bacterial - caused diseases such as bacterial wilt and soft rot. While controlling diseases, the strain also plays a role in promoting plant growth and increasing yields, and this characteristic makes it have great application potential in the field of plant disease control and can be applied to the control and growth promotion of common plant diseases.
Claims
1. A Bacillus licheniformis ( Bacillus licheniformis ), which is deposited in the China General Microbiological Culture Collection Center with the deposit number of CGMCC No. 29258.
2. A biological bactericide, which comprises the Bacillus licheniformis as claimed in claim 1.
3. The biological bactericide according to claim 2, wherein the biological bactericide further comprises an agriculturally acceptable auxiliary.
4. The biological bactericide according to claim 2 or 3, wherein the dosage form of the biological bactericide is wettable powder, water dispersible granule, granule, liquid agent, powder, emulsion in water, suspending agent, suspo-emulsion, microemulsion, capsule, tablet or biofilm agent.
5. The biological bactericide according to claim 2 or 3, wherein the concentration of the Bacillus licheniformis in the biological bactericide is 100,000 cfu / mL - 50,000,000 cfu / mL.
6. Use of the Bacillus licheniformis as claimed in claim 1 or the biological bactericide as claimed in any one of claims 2 - 5 in the prevention and control of plant diseases.
7. The use according to claim 6, wherein the plant diseases are selected from one or more of the following: pumpkin anthracnose, pepper anthracnose, tomato anthracnose, watermelon anthracnose, mango anthracnose, eggplant basal rot, pepper basal rot, cucumber basal rot, strawberry basal rot, wheat basal rot, corn basal rot, tomato gray mold, cucumber gray mold, strawberry gray mold, grape gray mold, tomato early blight, potato early blight, wheat smut, highland barley smut, corn smut, potato verticillium wilt, watermelon verticillium wilt, strawberry verticillium wilt, cotton verticillium wilt, banana fusarium wilt, pepper fusarium wilt, watermelon fusarium wilt, rape sclerotinia, sunflower sclerotinia, tomato damping-off, cucumber damping-off, soybean damping-off, potato black scurf, tomato damping-off, cucumber damping-off, watermelon damping-off, watermelon downy mildew, Chinese cabbage downy mildew, tomato bacterial wilt, potato bacterial wilt, pepper bacterial wilt, ginger bacterial wilt, pear fire blight, apple fire blight, celery soft rot, Chinese cabbage soft rot, tomato soft rot, cucumber soft rot, welsh onion soft rot, cucumber angular leaf spot, melon angular leaf spot, soybean angular leaf spot, sorghum bacterial leaf spot, citrus canker, kiwifruit canker, tomato canker, rice bacterial blight, banana bacterial blight, rape black rot, cabbage black rot.
8. The use according to claim 6 or 7, wherein the plants are selected from one or more of the following: pumpkin, eggplant, tomato, pepper, cucumber, potato, Chinese cabbage, rape, celery, cabbage, watermelon, mango, strawberry, grape, banana, pear, apple, melon, citrus, kiwifruit, wheat, corn, highland barley.
9. Use of the Bacillus licheniformis as claimed in claim 1 or the biological bactericide as claimed in any one of claims 2 - 5 in promoting plant growth.
10. The use according to claim 9, wherein the plants are selected from one or more of the following: pumpkin, eggplant, tomato, pepper, cucumber, potato, Chinese cabbage, rape, celery, cabbage, watermelon, mango, strawberry, grape, banana, pear, apple, melon, citrus, kiwifruit, wheat, corn, highland barley, sorghum, rice, soybean, cotton, sunflower, ginger, welsh onion.
Citation Information
Patent Citations
Bacillus subtilis and application thereof
CN110079483A
Bacillus licheniformis for preventing and treating plant diseases and application of bacillus licheniformis
CN113755381A
Cited By
Bacillus licheniformis MJ3 for the prevention and control of bacterial wilt and its application
CN122563831A