Genetically engineered bacterium for producing rhamnolipid at high yield, construction method and application of genetically engineered bacterium

By overexpressing the rhlAB gene of Pseudomonas aeruginosa and the key carbon metabolism pathway genes of Pseudomonas putida in Pseudomonas putida, the distribution of carbon metabolic flow is optimized, and the high-yield rhamnolipid gene engineering bacteria was constructed, which solved the bottleneck problem of the increase in Pseudomonas putida yield and achieved efficient production of rhamnolipid, suitable for biosurfactants, medicine and environmental protection fields.

CN120249157APending Publication Date: 2025-07-04ZHEJIANG UNIV OF TECH
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510409186.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-02
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

In the prior art, Pseudomonas putida has a bottleneck in the process of synthesizing rhamnolipid, and although Pseudomonas aeruginosa has high yield but poor biosafety, it is urgent to build a genetically engineered bacteria with high safety and high yield to improve the production efficiency of rhamnolipid.

Method used

In Pseudomonas putida △flag, the rhlAB gene of Pseudomonas putida PAO1 and the maeb, mdh, idh, lpdG, edd, gltA, eda, PP_3923, PP_2652, PP_3443, and lpd genes of Pseudomonas putida KT2440 are overexpressed, and carbon metabolic flow distribution is optimized, and genetically engineered bacteria with high yield rhamnolipids are constructed.

Benefits of technology

Through genetic engineering, rhamnolipid production has significantly increased, reaching 6.65g/L, an increase of more than 110% compared with the control. It has the advantages of high safety and stable yield and is suitable for biosurfactants, medicine and environmental protection fields.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249157A_ABST
    Figure CN120249157A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of genetic engineering, and discloses a genetically engineered bacterium of high-yield pseudomonas putida as well as a construction method and application of the genetically engineered bacterium. According to the invention, key genes maeb, mdh, idh, lpdG, edd, gltA, eda, PP3923, PP2652, PP3443 and lpd in a central carbon metabolic pathway are screened through CRISPRi and sRNA technologies, and tandem overexpression with rhlAB is carried out on the basis of pseudomonas putida flag, so that carbon metabolic flux distribution is optimized. The rhamnolipid yield of the constructed strain g-maeb in shake flask fermentation reaches 6.65 g / L, and is increased by 110% or above compared with that of a control group. The strain provided by the invention has the advantages of high safety, stable yield and the like, and can be applied to the fields of biosurfactants, medicines, environmental protection and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical fields of microorganisms and genetic engineering, and relates to a genetically engineered bacterium with high rhamnolipid production, a construction method thereof, and an application thereof in the preparation of rhamnolipids by microbial fermentation. More specifically, the present invention relates to a genetically engineered bacterium with high rhamnolipid production, a construction method thereof, and an application thereof in the preparation of rhamnolipids by microbial fermentation, which is obtained by overexpressing the rhlAB gene of Pseudomonas aeruginosa PAO1 and key gene targets on the central carbon metabolism pathway of rhamnolipids in the genome of Pseudomonas putida KT2440 in Pseudomonas putida △flag. Background Art

[0002] Rhamnolipids (RL) are produced by Pseudomonas aeruginosa through fermentation using various hydrophobic or hydrophilic carbon sources under aerobic conditions. Structurally, they are mainly composed of one to two hydrophilic rhamnose units and one to two hydrophobic fatty acid chains. Rhamnolipids are a type of biosurfactant with advantages such as non-toxicity, environmental friendliness, biodegradability, and biocompatibility. They are the biosurfactant with the longest research time and the most mature application technology, and are widely used in industries such as oil extraction, environmental pollution remediation, agriculture, and cosmetics. Therefore, rhamnolipids have excellent properties and broad application prospects.

[0003] Although Pseudomonas aeruginosa has the superior ability to synthesize rhamnolipids at high titers, it is a conditional pathogen with poor biosafety. Burkholderia is another natural rhamnolipid-producing strain, but its fermentation production is limited due to its long fermentation period and low rhamnolipid yield. To solve this problem, Pseudomonas putida, as a safe strain, has attracted the attention of researchers for rhamnolipid biosynthesis.

[0004] Pseudomonas putida KT2440 is a model strain of Pseudomonas with GRAS-certified environmental safety. It has a clear genetic background, and the biosynthesis process of its products is not affected by cell quorum sensing. It has excellent ability to degrade environmental pollutants and strong survival ability under harsh conditions. At the same time, it also has the advantage that the biosynthesis process of its products is not affected by cell quorum sensing, and it is an ideal cell chassis for the production of rhamnolipids. The synthesis of rhamnolipids depends on three metabolic pathways, namely the synthesis pathway of lipid precursor β-hydroxy fatty acids (HAAs), the synthesis pathway of glycosyl precursor dTDP-L-rhamnose, and the polymerization of lipid precursor and glycosyl precursor to form rhamnolipids. Among them, these three metabolic pathways are composed of a cascade reaction of 3 key enzymes rhlA, rhlB, and rhlC: among them, rhlA catalyzes the precursor β-hydroxyacyl-ACP to obtain β-hydroxy fatty acids (HAAs), and the latter reacts with one molecule of dTDP-L-rhamnose to obtain monorhamnolipid under the catalysis of rhlB (rhamnosyltransferase I), and monorhamnolipid reacts with one molecule of dTDP-L-rhamnose to generate dirhamnolipid under the catalysis of rhlC (rhamnosyltransferase II). Previously, deleting competitive bypasses or overexpressing key enzymes in the pathway could improve the metabolic flux in the synthesis pathways of lipid precursor β-hydroxy fatty acids and glycosyl precursor dTDP-L-rhamnose, thereby increasing the yield of rhamnolipids. With the in-depth transformation, some bottleneck problems have been encountered in terms of yield improvement. Introducing heterologous biosynthetic pathways will disrupt the complex microbial metabolic network, which requires systematic analysis of the metabolic network, mining more gene targets, improving the adaptability of endogenous and exogenous modules, and thus enhancing the production capacity of cells. Systematic optimization of the central carbon metabolic pathway is one of the commonly used strategies. By rational transformation, the carbon metabolic flux is redistributed, effectively improving the synthesis efficiency of products such as β-alanine, tert-butanol, mevalonic acid, succinic acid, and N-acetylglucosamine. However, in the study of transforming Pseudomonas putida to synthesize rhamnolipids, there has been no report on the rational transformation of the central carbon metabolic pathway, which may become a new direction for further improving the yield of rhamnolipids by Pseudomonas putida.

[0005] Therefore, there is an urgent need to construct a genetically engineered bacterium that can promote the ability of Pseudomonas putida to highly express rhamnolipids. Summary of the Invention

[0006] In view of this, the present invention provides a method for constructing a genetically engineered bacterium with high rhamnolipid production and its application. The genetically engineered bacterium with high rhamnolipid production provided by the present invention uses Pseudomonas putida △flag as the chassis bacterium, overexpresses the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1, and the maeb gene, mdh gene, idh gene, lpdG gene, edd gene, gltA gene, eda gene, PP_3923 gene, PP_2652 gene, PP_3443 gene, lpd gene combination in the genome of Pseudomonas putida, so as to increase the rhamnolipid production in Pseudomonas putida. The genetically engineered bacterium obtained is used for fermenting and preparing rhamnolipid with a relatively high titer.

[0007] One of the objectives of the present invention is to provide a genetically engineered bacterium with high rhamnolipid production, including a chassis bacterium and a recombinant plasmid that can self-replicate and is introduced into the chassis bacterium; the chassis bacterium is Pseudomonas putida △flag; the recombinant plasmid contains the rhlAB gene of Pseudomonas aeruginosa and one or more arbitrary combinations of the maeb gene, mdh gene, idh gene, lpdG gene, edd gene, gltA gene, eda gene, PP_3923 gene, PP_2652 gene, PP_3443 gene, lpd gene in the genome of Pseudomonas putida.

[0008] As a preference of the present invention, the nucleotide sequence of the rhlAB gene is as shown in SEQ ID NO.1.

[0009] As a preference of the present invention, the nucleotide sequence of the maeb gene is as shown in SEQ ID NO.2.

[0010] As a preference of the present invention, the nucleotide sequence of the mdh gene is as shown in SEQ ID NO.3.

[0011] As a preference of the present invention, the nucleotide sequence of the idh gene is as shown in SEQ ID NO.4.

[0012] As a preference of the present invention, the nucleotide sequence of the lpdG gene is as shown in SEQ ID NO.5.

[0013] As a preference of the present invention, the nucleotide sequence of the edd gene is as shown in SEQ ID NO.6.

[0014] As a preference of the present invention, the nucleotide sequence of the gltA gene is as shown in SEQ ID NO.7.

[0015] As a preference of the present invention, the nucleotide sequence of the eda gene is as shown in SEQ ID NO.8.

[0016] As a preference of the present invention, the PP_3923 gene has a nucleotide sequence as shown in SEQ ID NO.9.

[0017] As a preference of the present invention, the PP_2652 gene has a nucleotide sequence as SEQ ID NO.10.

[0018] As a preference of the present invention, the PP_3443 gene has a nucleotide sequence as shown in SEQ ID NO.11.

[0019] As a preference of the present invention, the lpd gene has a nucleotide sequence as shown in SEQ ID NO.12.

[0020] As a preference of the present invention, Pseudomonas putida △flag is a mutant strain with the flag gene cluster knocked out in the genome of Pseudomonas putida.

[0021] As a preference of the present invention, the strain type of the Pseudomonas putida in the present invention is Pseudomonas putida KT2440.

[0022] As a preference of the present invention, the strain type of the Pseudomonas aeruginosa in the present invention is Pseudomonas aeruginosa PA01.

[0023] As a preference of the present invention, the recombinant plasmid contains the rhlAB gene of Pseudomonas aeruginosa PA01 and the maeb gene in the genome of Pseudomonas putida.

[0024] The second object of the present invention is to provide a method for constructing a genetically engineered bacterium with high rhamnolipid production, comprising the following steps:

[0025] Step 1, prepare the competent cells of Pseudomonas putida △flag;

[0026] Step 2, construct the genetically engineered bacterium: overexpress one or any combination of two or more of the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1, the maeb gene, mdh gene, idh gene, lpdG gene, edd gene, gltA gene, eda gene, PP_3923 gene, PP_2652 gene, PP_3443 gene, and lpd gene in the genome of Pseudomonas putida by one-step cloning method in the expression vector pMK to obtain a recombinant plasmid; use Pseudomonas putida △flag as the chassis bacterium and overexpress the recombinant plasmid to obtain the genetically engineered bacterium with high rhamnolipid production.

[0027] As a preference of the present invention, in step 1, preparing the competent cells of Pseudomonas putida △flag includes: knocking out the flag gene cluster of Pseudomonas putida KT2440 to obtain the gene knockout mutant KT2440Δflag;

[0028] Preferably, the method for knocking out the flag gene cluster of Pseudomonas putida KT2440 is homologous recombination.

[0029] Specifically, knocking out the flag gene cluster of Pseudomonas putida KT2440 includes the following steps:

[0030] Using the genome of Pseudomonas putida KT2440 as a template, the upstream and downstream homologous arm fragments of the flag gene are amplified using primer pairs P25 / P26 and P27 / P28, and then the two fragments are ligated by overlapping PCR using primers P25 / P28 to obtain the Δflag fragment; the pPribmobsacB vector is double-digested with HindIII and EcoRI, and the Δflag fragment is ligated to the pPribmobsacB vector using C115 ligase to obtain the suicide vector pPrib-Δflag; the suicide vector pPrib-Δflag is introduced into the competent cells of Pseudomonas putida KT2440 by electroporation, and the gene knockout mutant KT2440Δflag is obtained by co-screening with gentamicin and ampicillin.

[0031] Preferably, constructing the genetically engineered bacteria in step 2 includes:

[0032] (1) Overexpressing the maeb gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 in the expression vector pMK, and introducing the vector into Pseudomonas putida △flag to obtain the genetically engineered bacterium g-maeb;

[0033] (2) Overexpressing the mdh gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 in the expression vector pMK, and introducing the vector into Pseudomonas putida △flag to obtain the genetically engineered bacterium g-mdh;

[0034] (3) Overexpressing the idh gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 in the expression vector pMK, and introducing the vector into Pseudomonas putida △flag to obtain the genetically engineered bacterium g-idh;

[0035] (4) Overexpressing the lpdG gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 in the expression vector pMK, and introducing the vector into Pseudomonas putida △flag to obtain the genetically engineered bacterium g-lpdG;

[0036] (5) Overexpress the edd gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 in the expression vector pMK, and introduce the vector into Pseudomonas putida △flag to obtain the genetically engineered bacterium g-edd;

[0037] (6) Overexpress the gltA gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 in the expression vector pMK, and introduce the vector into Pseudomonas putida △flag to obtain the genetically engineered bacterium g-gltA;

[0038] (7) Overexpress the eda gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 in the expression vector pMK, and introduce the vector into Pseudomonas putida △flag to obtain the genetically engineered bacterium g-eda;

[0039] (8) Overexpress the PP_3923 gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 in the expression vector pMK, and introduce the vector into Pseudomonas putida △flag to obtain the genetically engineered bacterium g-PP_3923.

[0040] (9) Overexpress the PP_2652 gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 in the expression vector pMK, and introduce the vector into Pseudomonas putida △flag to obtain the genetically engineered bacterium g-PP_2652;

[0041] (10) Overexpress the PP_3443 gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 in the expression vector pMK, and introduce the vector into Pseudomonas putida △flag to obtain the genetically engineered bacterium g-PP_3443; and / or

[0042] (11) Overexpress the lpd gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 in the expression vector pMK, and introduce the vector into Pseudomonas putida △flag to obtain the genetically engineered bacterium g-lpd.

[0043] As a preference of the present invention, the method for tandem expression of the maeb gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene of Pseudomonas aeruginosa PA01 in Pseudomonas putida △flag is:

[0044] Using the Pseudomonas aeruginosa PAO1 genome as a template, the rhlAB gene fragment was amplified with primers P1 and P2 and cloned in one step with the expression plasmid pMK (the expression plasmid pMK needs to be pre-digested with EcoRI and KpnI); after correct sequencing, the recombinant plasmid pMK-P46-rhlAB was linearized with primers XP1 and XP2 and cloned in one step with the P46-maeb gene fragment amplified with primers P3 and P4, and the recombinant plasmid after one-step cloning was electrotransformed into electrocompetent Pseudomonas putida △flag.

[0045] As a preference of the present invention, the method for tandem expression of the mdh gene in the Pseudomonas putida KT2440 genome and the rhlAB gene of Pseudomonas aeruginosa PA01 in △flag is as follows:

[0046] Using the Pseudomonas aeruginosa PAO1 genome as a template, the rhlAB gene fragment was amplified with primers P1 and P2 and cloned in one step with the expression plasmid pMK (the expression plasmid pMK needs to be pre-digested with EcoRI and KpnI); after correct sequencing, the recombinant plasmid pMK-P46-rhlAB was linearized with primers XP1 and XP2 and cloned in one step with the P46-mdh gene fragment amplified with primers P5 and P6, and the recombinant plasmid after one-step cloning was electrotransformed into electrocompetent Pseudomonas putida △flag.

[0047] As a preference of the present invention, the method for tandem expression of the idh gene in the Pseudomonas putida KT2440 genome and the rhlAB gene of Pseudomonas aeruginosa PA01 in △flag is as follows:

[0048] Using the Pseudomonas aeruginosa PAO1 genome as a template, the rhlAB gene fragment was amplified with primers P1 and P2 and cloned in one step with the expression plasmid pMK (the expression plasmid pMK needs to be pre-digested with EcoRI and KpnI); after correct sequencing, the recombinant plasmid pMK-P46-rhlAB was linearized with primers XP1 and XP2 and cloned in one step with the P46-idh gene fragment amplified with primers P7 and P8, and the recombinant plasmid after one-step cloning was electrotransformed into electrocompetent Pseudomonas putida △flag.

[0049] As a preference of the present invention, the method for tandem expression of the lpdG gene in the Pseudomonas putida KT2440 genome and the rhlAB gene of Pseudomonas aeruginosa PA01 in △flag is as follows:

[0050] Using the Pseudomonas aeruginosa PAO1 genome as a template, the rhlAB gene fragment was amplified with primers P1 and P2 and cloned in one step with the expression plasmid pMK (the expression plasmid pMK needs to be digested with EcoRI and KpnI in advance); after correct sequencing, the recombinant plasmid pMK-P46-rhlAB was linearized with primers XP1 and XP2, and cloned in one step with the P46-lpdG gene fragment amplified with primers P9 and P10. The recombinant plasmid after one-step cloning was electrotransformed into electrocompetent Pseudomonas putida △flag.

[0051] As a preference of the present invention, the method for tandem expression of the edd gene in the Pseudomonas putida KT2440 genome and the rhlAB gene of Pseudomonas aeruginosa PA01 in △flag is as follows:

[0052] Using the Pseudomonas aeruginosa PAO1 genome as a template, the rhlAB gene fragment was amplified with primers P1 and P2 and cloned in one step with the expression plasmid pMK (the expression plasmid pMK needs to be digested with EcoRI and KpnI in advance); after correct sequencing, the recombinant plasmid pMK-P46-rhlAB was linearized with primers XP1 and XP2, and cloned in one step with the P46-edd gene fragment amplified with primers P11 and P12. The recombinant plasmid after one-step cloning was electrotransformed into electrocompetent Pseudomonas putida △flag.

[0053] As a preference of the present invention, the method for tandem expression of the gltA gene in the Pseudomonas putida KT2440 genome and the rhlAB gene of Pseudomonas aeruginosa PA01 in △flag is as follows:

[0054] Using the Pseudomonas aeruginosa PAO1 genome as a template, the rhlAB gene fragment was amplified with primers P1 and P2 and cloned in one step with the expression plasmid pMK (the expression plasmid pMK needs to be digested with EcoRI and KpnI in advance); after correct sequencing, the recombinant plasmid pMK-P46-rhlAB was linearized with primers XP1 and XP2, and cloned in one step with the P46-gltA gene fragment amplified with primers P13 and P14. The recombinant plasmid after one-step cloning was electrotransformed into electrocompetent Pseudomonas putida △flag.

[0055] As a preference of the present invention, the method for tandem expression of the eda gene in the Pseudomonas putida KT2440 genome and the rhlAB gene of Pseudomonas aeruginosa PA01 in △flag is as follows:

[0056] Using the Pseudomonas aeruginosa PAO1 genome as a template, the rhlAB gene fragment was amplified with primers P1 and P2 and cloned in one step with the expression plasmid pMK (the expression plasmid pMK needs to be digested with EcoRI and KpnI in advance); after correct sequencing, the recombinant plasmid pMK-P46-rhlAB was linearized with primers XP1 and XP2 and cloned in one step with the P46-eda gene fragment amplified with primers P15 and P16, and the recombinant plasmid after one-step cloning was electrotransformed into electrocompetent Pseudomonas putida △flag.

[0057] As a preference of the present invention, the method for tandem expression of the PP_3923 gene in the Pseudomonas aeruginosa KT2440 genome and the rhlAB gene of Pseudomonas aeruginosa PA01 in △flag is as follows:

[0058] Using the Pseudomonas aeruginosa PAO1 genome as a template, the rhlAB gene fragment was amplified with primers P1 and P2 and cloned in one step with the expression plasmid pMK (the expression plasmid pMK needs to be digested with EcoRI and KpnI in advance); after correct sequencing, the recombinant plasmid pMK-P46-rhlAB was linearized with primers XP1 and XP2 and cloned in one step with the P46-PP_3923 gene fragment amplified with primers P17 and P18, and the recombinant plasmid after one-step cloning was electrotransformed into electrocompetent Pseudomonas putida △flag.

[0059] As a preference of the present invention, the method for tandem expression of the PP_2652 gene in the Pseudomonas aeruginosa KT2440 genome and the rhlAB gene of Pseudomonas aeruginosa PA01 in △flag is as follows:

[0060] Using the Pseudomonas aeruginosa PAO1 genome as a template, the rhlAB gene fragment was amplified with primers P1 and P2 and cloned in one step with the expression plasmid pMK (the expression plasmid pMK needs to be digested with EcoRI and KpnI in advance); after correct sequencing, the recombinant plasmid pMK-P46-rhlAB was linearized with primers XP1 and XP2 and cloned in one step with the P46-PP_2652 gene fragment amplified with primers P19 and P20, and the recombinant plasmid after one-step cloning was electrotransformed into electrocompetent Pseudomonas putida △flag.

[0061] As a preference of the present invention, the method for tandem expression of the PP_3443 gene in the Pseudomonas aeruginosa KT2440 genome and the rhlAB gene of Pseudomonas aeruginosa PA01 in △flag is as follows:

[0062] Using the genome of Pseudomonas aeruginosa PAO1 as a template, the rhlAB gene fragment was amplified with primers P1 and P2 and cloned in one step with the expression plasmid pMK (the expression plasmid pMK needs to be digested with EcoRI and KpnI in advance); after correct sequencing, the recombinant plasmid pMK-P46-rhlAB was linearized with primers XP1 and XP2 and cloned in one step with the P46-PP_3443 gene fragment amplified with primers P21 and P22, and the recombinant plasmid after one-step cloning was electrotransformed into electrocompetent Pseudomonas putida △flag.

[0063] As a preference of the present invention, the method for tandem expression of the lpd gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene of Pseudomonas aeruginosa PA01 in △flag is as follows:

[0064] Using the genome of Pseudomonas aeruginosa PAO1 as a template, the rhlAB gene fragment was amplified with primers P1 and P2 and cloned in one step with the expression plasmid pMK (the expression plasmid pMK needs to be digested with EcoRI and KpnI in advance); after correct sequencing, the recombinant plasmid pMK-P46-rhlAB was linearized with primers XP1 and XP2 and cloned in one step with the P46-lpd gene fragment amplified with primers P23 and P24, and the recombinant plasmid after one-step cloning was electrotransformed into electrocompetent Pseudomonas putida △flag.

[0065] As a preference of the present invention, in step 2, using Pseudomonas putida Δflag as the chassis bacterium, overexpressing to obtain a recombinant plasmid includes:

[0066] The step of preparing electrocompetent cells of Pseudomonas putida △flag; and

[0067] The step of electrotransforming the recombinant plasmid with correct sequencing into electrocompetent cells of Pseudomonas putida △flag at a voltage of 1.35 kV.

[0068] The third object of the present invention is to provide an application of a genetically engineered bacterium with high yield of Pseudomonas putida or the genetically engineered bacterium obtained by the construction method in the microbial fermentation to prepare rhamnolipid.

[0069] As a preference of the present invention, the application includes the following steps:

[0070] Inoculating the genetically engineered bacterium into a fermentation medium at an inoculum size of 2% (v / v), and fermenting and culturing under the conditions of natural pH and a temperature of 30 °C; the composition of the fermentation medium is as follows: glucose 10 g / L, yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L, the solvent is deionized water, and the pH value is natural.

[0071] Specifically, the application includes the following steps:

[0072] The genetically engineered bacteria were streaked on an LB plate containing ampicillin and kanamycin, and cultured until single colonies grew. Single colonies were picked and inoculated into an LB liquid medium containing ampicillin and kanamycin, and cultured overnight at 30 °C and 200 rpm to be used as a seed solution; the seed solution was inoculated into the fermentation medium at an inoculation amount of 2% (v / v), and fermented and cultured under the conditions of natural pH and a temperature of 30 °C. The fermentation broth was taken, and rhamnolipid was separated and purified; wherein, the final concentration of kanamycin in the medium was 0.05 mg / L; the final concentration of ampicillin in the medium was 0.1 mg / L.

[0073] As a preference of the present invention, the fermentation medium is composed of the following: 10 g / L of glucose, 5 g / L of yeast extract, 10 g / L of peptone, 10 g / L of sodium chloride, the solvent is deionized water, and the pH value is natural.

[0074] As a preference of the present invention, the LB liquid medium is composed of the following: 10 g / L of peptone, 5 g / L of yeast extract, 10 g / L of NaCl, the solvent is tap water, and the pH value is natural.

[0075] As a preference of the present invention, the LB plate is prepared by adding 16 g / L of agar to the LB liquid medium.

[0076] In the present invention, on the basis of Pseudomonas putida △flag, the rhlAB gene from Pseudomonas aeruginosa was heterologously overexpressed, and at the same time, the key gene targets maeb gene, mdh gene, idh gene, lpdG gene, edd gene, gltA gene, eda gene, PP_3923 gene, PP_2652 gene, PP_3443 gene, lpd gene on the central carbon metabolism pathway of rhamnolipid were overexpressed, so that the yield of rhamnolipid was further improved. In the metabolism of the strain, there are non-linear associations between different metabolic pathways, as well as the competition and cooperation relationships between cofactors and the main metabolic pathway. The genetically engineered bacteria g-maeb, g-mdh, g-idh, g-lpdG, g-edd, g-gltA, g-edd, g-PP_3923, g-PP_2652, g-PP_3443, g-lpd provided by the present invention for improving the yield of rhamnolipid have higher yields compared with the control genetically engineered strain rhlAB-△flag.

[0077] Compared with the prior art, the present invention has the following technical effects:

[0078] 1. The present invention overexpresses the rhamnosyltransferase subunit A gene rhlA and the rhamnosyltransferase subunit B gene rhlB from Pseudomonas aeruginosa PAO1 heterologously on the basis of Pseudomonas putida rhlAB-△flag; at the same time, overexpresses the key gene targets maeb gene, mdh gene, idh gene, lpdG gene, edd gene, gltA gene, eda gene, PP_3923 gene, PP_2652 gene, PP_3443 gene, lpd gene in the central carbon metabolism pathway of rhamnolipid, so as to further improve the rhamnolipid yield;

[0079] 2. The genetically engineered bacterium g-maeb for improving rhamnolipid yield provided by the present invention increases the supply of the rhamnolipid synthesis precursor HAA by overexpressing the maeb gene, thereby increasing the rhamnolipid yield by 110.4% compared with Pseudomonas putida rhlAB-△flag;

[0080] 3. The genetically engineered bacterium g-mdh for improving rhamnolipid yield provided by the present invention increases the supply of the rhamnolipid synthesis precursor HAA by overexpressing the mdh gene, thereby increasing the rhamnolipid yield by 103.9% compared with Pseudomonas putida rhlAB-△flag;

[0081] 4. The genetically engineered bacterium g-idh for improving rhamnolipid yield provided by the present invention increases the supply of the rhamnolipid synthesis precursor HAA by overexpressing the idh gene, thereby increasing the rhamnolipid yield by 98.9% compared with Pseudomonas putida rhlAB-△flag;

[0082] 5. The genetically engineered bacterium g-lpdG for improving rhamnolipid yield provided by the present invention increases the supply of the rhamnolipid synthesis precursor HAA by overexpressing the lpdG gene, thereby increasing the rhamnolipid yield by 99.6% compared with Pseudomonas putida rhlAB-△flag;

[0083] 6. The genetically engineered bacterium g-edd for improving rhamnolipid yield provided by the present invention increases the supply of the rhamnolipid synthesis precursor HAA by overexpressing the edd gene, thereby increasing the rhamnolipid yield by 92.3% compared with Pseudomonas putida rhlAB-△flag;

[0084] 7. The genetically engineered bacterium g-gltA for improving rhamnolipid yield provided by the present invention increases the supply of the rhamnolipid synthesis precursor HAA by overexpressing the gltA gene, thereby increasing the rhamnolipid yield by 85.1% compared with Pseudomonas putida rhlAB-△flag;

[0085] 8. The genetically engineered bacterium g-eda for increasing the production of rhamnolipid provided by the present invention increases the supply of HAA, a precursor for rhamnolipid synthesis, by overexpressing the eda gene, thereby increasing the production of rhamnolipid by 71% compared to Pseudomonas putida rhlAB-△flag;

[0086] 9. The genetically engineered bacterium g-PP_3923 for increasing the production of rhamnolipid provided by the present invention increases the supply of HAA, a precursor for rhamnolipid synthesis, by overexpressing the PP_3923 gene, thereby increasing the production of rhamnolipid by 78.8% compared to Pseudomonas putida rhlAB-△flag;

[0087] 10. The genetically engineered bacterium g-PP_2652 for increasing the production of rhamnolipid provided by the present invention increases the supply of HAA, a precursor for rhamnolipid synthesis, by overexpressing the PP_2652 gene, thereby increasing the production of rhamnolipid by 76.5% compared to Pseudomonas putida rhlAB-△flag;

[0088] 11. The genetically engineered bacterium g-PP_3443 for increasing the production of rhamnolipid provided by the present invention increases the supply of HAA, a precursor for rhamnolipid synthesis, by overexpressing the PP_3443 gene, thereby increasing the production of rhamnolipid by 58.2% compared to Pseudomonas putida rhlAB-△flag;

[0089] 12. The genetically engineered bacterium g-lpd for increasing the production of rhamnolipid provided by the present invention increases the supply of HAA, a precursor for rhamnolipid synthesis, by overexpressing the lpd gene, thereby increasing the production of rhamnolipid by 26.2% compared to Pseudomonas putida rhlAB-△flag;

[0090] 13. The genetically engineered bacterium provided by the present invention is applied to the microbial fermentation production of rhamnolipid, which has the characteristics of high yield, cheap substrate, and easy separation, and has industrialization prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0091] Figure 1 It is a schematic diagram of the rhamnolipid synthesis pathway and modification in Pseudomonas putida;

[0092] Figure 2 It is a comparison chart of the OD 600 of g-maeb and the rhamnolipid content with the titer of the control strain rhlAB-△flag in Example 1 of the present invention;

[0093] Figure 3 It is a comparison chart of the OD 600 of g-mdh and the rhamnolipid content with the titer of the control strain rhlAB-△flag in Example 2 of the present invention;

[0094] Figure 4OD of g-idh in Example 3 of the present invention 600 and the comparison chart of rhamnolipid content and titer of the control strain rhlAB-△flag;

[0095] Figure 5 OD of g-lpdG in Example 4 of the present invention 600 and the comparison chart of rhamnolipid content and titer of the control strain rhlAB-△flag;

[0096] Figure 6 OD of g-edd in Example 5 of the present invention 600 and the comparison chart of rhamnolipid content and titer of the control strain rhlAB-△flag;

[0097] Figure 7 OD of g-gltA in Example 6 of the present invention 600 and the comparison chart of rhamnolipid content and titer of the control strain rhlAB-△flag;

[0098] Figure 8 OD of g-eda in Example 7 of the present invention 600 and the comparison chart of rhamnolipid content and titer of the control strain rhlAB-△flag;

[0099] Figure 9 OD of g-PP_3923 in Example 8 of the present invention 600 and the comparison chart of rhamnolipid content and titer of the control strain rhlAB-△flag;

[0100] Figure 10 OD of g-PP_2652 in Example 9 of the present invention 600 and the comparison chart of rhamnolipid content and titer of the control strain rhlAB-△flag;

[0101] Figure 11 OD of g-PP_3443 in Example 10 of the present invention 600 and the comparison chart of rhamnolipid content and titer of the control strain rhlAB-△flag;

[0102] Figure 12 OD of g-lpd in Example 11 of the present invention 600 and the comparison chart of rhamnolipid content and titer of the control strain rhlAB-△flag;

[0103] Figure 13 OD of the genetically engineered bacteria in Examples 1 to 11 of the present invention 600 and the comparison chart of rhamnolipid content and titer of the control strain rhlAB-△flag. Detailed implementation manners

[0104] The following describes the embodiments of the present invention through specific examples. Those skilled in the art can easily understand the other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0105] It should be noted that the process equipment or devices not specifically noted in the following embodiments all adopt conventional equipment or devices in the art.

[0106] In addition, it should be understood that one or more method steps mentioned in the present invention do not exclude the existence of other method steps before and after the combined steps or the insertion of other method steps between these clearly mentioned steps, unless otherwise specified; it should also be understood that the combined connection relationship between one or more devices / devices mentioned in the present invention does not exclude the existence of other devices / devices before and after the combined devices / devices or the insertion of other devices / devices between these two clearly mentioned devices / devices, unless otherwise specified. Moreover, unless otherwise specified, the numbers of each method step are only convenient tools for identifying each method step, rather than restricting the arrangement order of each method step or limiting the scope of implementation of the present invention. The change or adjustment of their relative relationship, without substantial change in technical content, should also be regarded as the scope of implementation of the present invention.

[0107] The present invention will be further described below in conjunction with embodiments.

[0108] The starting strains of the present invention, Pseudomonas putida KT2440, Pseudomonas aeruginosa PAO1, and the pMK vector were all purchased from Hangzhou Hongsai Biotechnology Co., Ltd. In the following embodiments, the final concentration of kanamycin in the medium was 0.05 mg / L; the final concentration of ampicillin in the medium was 0.1 mg / L.

[0109] The primer sequence information used in Examples 1-8 is shown in Table 1.

[0110] Table 1

[0111] Primer Name Sequence (5’-3’) P1 ACGACGGCCAGTGCCAAGCTTCAGATTGATCTGCCGCAACC P2 TTGTCGAGTGCCTCATCGCTCCCCCGTGTATAAAGGACGT P3 ACGGCTAAGGAGGTTTTCTAATGTCAGACCTGAAAACCGC P4 GATGCATGCCATGGTACCTCAGCCGTTGAACACTTCATCC P5 CGGCTAAGGAGGTTTTCTACTGGTGAACAAATTAACGATTGTG P6 GATGCATGCCATGGTACCCTACAACGCCTTCATCTCGG P7 CGGCTAAGGAGGTTTTCTAATGCCCACCCGTTCCAAG P8 GATGCATGCCATGGTACCTTACAGGGCAGCGATGGC P9 ACGGCTAAGGAGGTTTTCTAATGACCCAGAAATTCGACGT P10 GATGCATGCCATGGTACCTTAACGCTTCTTACGGTTGGC P11 ACGGCTAAGGAGGTTTTCTAATGCATCCGCGCATCCTT P12 TCGATGCATGCCATGGTACCTCATTTGAGGTGCTCCAGGG P13 ACGGCTAAGGAGGTTTTCTAATGGCTGACAAAAAAGCGC P14 GATGCATGCCATGGTACCTTACTTGCGGTCTTTCAGGGC P15 ACGGCTAAGGAGGTTTTCTAGTGCCCATGAGCCAAGGA P16 GATGCATGCCATGGTACCTCAGTTGGCGTCCAGCAG P17 ACGGCTAAGGAGGTTTTCTAGTGGGCAATCTCTACCTGATT P18 CGATGCATGCCATGGTACCTTATCGGTAGGTGACAAGCTCC P19 AAACGGCTAAGGAGGTTTTCTAATGAACCGTTCGCTCTTCG P20 GATGCATGCCATGGTACCTTACAGCGTAAACGTCAGGGT P21 AAAACGGCTAAGGAGGTTTTCTAATGGACCGTTTGCTCGATTC P22 GATGCATGCCATGGTACCTCAGAAGATGTAGTCGGTGGTC P23 ACGGCTAAGGAGGTTTTCTAATGAAATCCTATGACGTGGTGATCA P24 ATGCATGCCATGGTACCTCAGATTTGCATGGCCAT P25 CCATGGACGTAACCGGGTAG P26 GCTTCGACTGCGAGTCGAAG P27 AACGACGGCCAGTGCCAAGCTTAACAGCAGGATGAGCATGGACG P28 GATTGTATACAACCTGTCGAGCCCG XP1 GGTACCATGGCATGCATCG XP2 TCACTCCTGGTTGGCCA

[0112] In the following embodiments, the determination of rhamnolipid content was detected by UHPLC. The specific detection method is as follows:

[0113] (1) Chromatographic conditions: C18 column (150×4.6 mm, particle size 3 μm, Thermo Fisher Scientific Inc., Waltham, MA, USA), electrospray detector;

[0114] (2) Mobile phase: acetonitrile, 0.2% formic acid (v / v);

[0115] (3) Instrument method: within 1 - 9 min, the concentration of acetonitrile linearly increases from 70% to 100%, and within 11 - 12 min, the concentration of acetonitrile linearly decreases from 95% to 70%, column temperature: 40 °C;

[0116] (4) Data acquisition time: 15 min.

[0117] In the following examples, the composition of the culture medium is as follows:

[0118] LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, the solvent is tap water, and the pH value is natural.

[0119] LB plate is prepared by adding 16 g / L agar to the LB liquid medium.

[0120] LBS solid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 100 g / L sucrose, 4 g / L agar, the solvent is tap water, and the pH value is natural.

[0121] Fermentation medium: 10 g / L glucose, 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride, the solvent is deionized water, and the pH value is natural.

[0122] In the examples of the present invention, the added concentrations of kanamycin (Kan), ampicillin (Amp), and gentamicin (Gm) are 25 mg / L, 100 mg / L, and 25 mg / L respectively.

[0123] The chassis bacterium Pseudomonas putida △flag in this application is obtained by referring to the preparation method in Chinese invention patent CN117511841A.

[0124] Example 1. Construction of genetically engineered bacterium g - maeb

[0125] S1. Preparation of competent cells of chassis bacterium Pseudomonas putida △flag;

[0126] Streak Pseudomonas putida △flag on LB solid medium and incubate overnight at 30 °C. Pick a single colony and inoculate it into 10 ml of LB liquid medium. After culturing at 30 °C and 200 rpm for 12 h, inoculate the seed liquid at an inoculation volume of 2% into 50 ml of LB liquid medium and culture at 30 °C and 200 rpm until OD 600 = 0.7 - 1.4, and immediately place it in an ice bath for 30 min. Transfer the bacterial solution to a pre-cooled 50 ml sterile centrifuge tube, centrifuge at 5000 rpm for 10 min, discard the supernatant, resuspend it with 20 ml of pre-cooled HEPES buffer, centrifuge at 5000 rpm for 10 min, repeat the washing three times, and finally resuspend it with 1 ml of 10% glycerol and aliquot it into sterile 1.5 ml EP tubes, 100 μL per tube, and store at -80 °C.

[0127] S2. Construction of recombinant plasmid PMK-AB-maeb:

[0128] Using primer pair P1 / P2, amplify the rhlAB gene (nucleotide sequence shown in SEQ ID NO.1) by PCR with Pseudomonas aeruginosa PAO1 bacterial solution as the template. Using primer pair P3 / P4, amplify the gene maeb (nucleotide sequence shown in SEQ ID NO.2) by PCR with Pseudomonas putida KT2440 bacterial solution as the template. The PCR reaction system refers to Table 2 in Example 1, and the PCR program refers to Table 3 in Example 1; the pMK plasmid is digested with EcoRI and KpnI, and then the rhlAB gene, maeb gene, and pMK (EcoRI, KpnI) are ligated with C115 from Vazyme Company, and verified by sequencing to obtain the recombinant plasmid PMK-AB-maeb.

[0129] Table 2 Composition table of gene amplification PCR system

[0130] Component Dosage Template (PAO1 genome) 1 μL Forward primer (10 μM) 1 μL Reverse primer (10 μM) 1 μL 2×Phanta Max Buffer 25 μL dNTP Mix (10 mM) 1 μL Phanta Max Super-Fidelity DNA Polymerase 0.5 μL <![CDATA[dd H2O]]> Make up to 50 μL

[0131] Table 3 Gene amplification PCR program table

[0132]

[0133] Table 4 Composition table of colony verification PCR system

[0134] Component Dosage Template (recombinant plasmid) 1 μL Forward primer (10 μM) 1 μL Reverse primer (10 μM) 1 μL 2×Phanta Max Buffer 25 μL dNTP Mix (10 mM) 1 μL Phanta Max Super-Fidelity DNA Polymerase 0.5 μL <![CDATA[dd H2O]]> Make up to 50 μL

[0135] Table 5 Colony verification PCR program table

[0136]

[0137] S3. Construction of genetically engineered strain g-maeb:

[0138] The correctly sequenced recombinant plasmid PMK-AB-maeb was electrotransformed into competent △flag cells at a voltage of 1.35 kV. Then, 1 - 2 ml of LB was added, and the cells were resuscitated in a shaker at 30 °C and 200 rpm for 1.5 h. After that, the bacterial solution was spread on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L). The plate was incubated until single colonies grew. Single colonies were picked and inoculated into 10 ml of LB liquid containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30 °C and 200 rpm for 12 h, 600 μL of the bacterial solution was added to 600 μL of 50% glycerol and placed in a 2 ml sterile glycerol tube for storage at -80 °C. The strain was named g-maeb.

[0139] S4. The overexpressing strain g-maeb was streaked on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L). The plate was incubated until single colonies grew. Single colonies were picked and inoculated into 10 ml of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L) and cultured overnight at 30 °C and 200 rpm to be used as the seed solution. 500 μL of the seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented for 72 h. The control strain rhlAB-△flag was streaked on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L). The plate was incubated until single colonies grew. Single colonies were picked and inoculated into 10 ml of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L) and cultured overnight at 30 °C and 200 rpm to be used as the seed solution. 500 μL of the seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented for 72 h. After fermentation, 1 mL of the fermentation broth was centrifuged at 12000 rpm for 2 min at room temperature. 500 μL of the supernatant was mixed with 500 μL of acetonitrile and left overnight at 4 °C. Then, according to the HPLC detection method in the specific implementation manner, the content of rhamnolipid was detected, and 1 mL of the fermentation broth was used to measure the biomass OD 600 . The OD 600 in the supernatant of the fermentation broth and the rhamnolipid content were compared with those of the control strain as Figure 2 shown. The genetically engineered bacterium g-maeb for improving the production of rhamnolipid provided by the present invention increases the supply of the rhamnolipid synthesis precursors dTDP-L-rhamnose and HAA by overexpressing the maeb gene, thereby increasing the production of rhamnolipid by 110.4% compared with rhlAB-△flag.

[0140] Example 2. Construction of the genetically engineered bacterium g-mdh

[0141] S1. Construction of the recombinant plasmid PMK-AB-mdh;

[0142] Using primer pair P1 / P2, the rhlAB gene was amplified with Pseudomonas aeruginosa PAO1 bacterial solution as the template. Using primer pair P5 / P6, the mdh gene (the nucleotide sequence is shown in SEQ ID NO.3) was amplified with Pseudomonas putida KT2440 bacterial solution as the template. The pMK plasmid was digested with EcoRI and KpnI, and then the rhlAB gene, mdh gene and pMK (EcoRI, KpnI) were ligated with C115 from Vazyme Co., Ltd. Sequencing verification (the component tables and program tables of gene amplification PCR and colony verification PCR are shown in Table 2-5) was performed to obtain the vector PMK-AB-mdh.

[0143] S2. Construct the genetically engineered bacterium g-mdh;

[0144] The correctly sequenced vector PMK-AB-mdh was electrotransformed into competent △flag cells at a voltage of 1.35 kV. After adding 1 - 2 ml of LB and recovering in a shaker at 30 °C and 200 rpm for 1.5 h, the bacterial solution was spread on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing until single colonies grew, a single colony was picked and inoculated into 10 ml of LB liquid containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30 °C and 200 rpm for 12 h, 600 μL of the bacterial solution was added to 600 μL of 50% glycerol, placed in a 2 ml sterile glycerol tube and stored at -80 °C. The strain was named g-mdh.

[0145] S3. The overexpressing strain g-mdh was streaked on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing until single colonies grew, a single colony was picked and inoculated into 10 ml of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L) and cultured overnight at 30 °C and 200 rpm to be used as the seed solution; 500 μL of the seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented for 72 h. The control strain rhlAB-△flag was streaked on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing until single colonies grew, a single colony was picked and inoculated into 10 ml of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L) and cultured overnight at 30 °C and 200 rpm to be used as the seed solution; 500 μL of the seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented for 72 h. After fermentation, 1 mL of the fermentation broth was centrifuged at 12000 rpm for 2 min at room temperature. 500 μL of the supernatant was mixed with 500 μL of acetonitrile. After overnight at 4 °C, the content of rhamnolipid was detected according to the HPLC detection method in the specific implementation manner, and 1 mL of the fermentation broth was used to measure the biomass OD 600。The OD in the supernatant of the fermentation broth 600 and the rhamnolipid content are compared with those of the control strain as Figure 3 shown. The genetically engineered bacterium g-mdh for improving rhamnolipid production provided by the present invention increases the supply of dTDP-L-rhamnose and HAA, the precursors of rhamnolipid synthesis, by overexpressing the mdh gene, thereby increasing the rhamnolipid production by 103.9% compared with rhlAB-△flag.

[0146] Example 3: Construction of strain g-idh

[0147] S1. Construction of recombinant plasmid PMK-AB-idh;

[0148] Using primer pair P1 / P2, the rhlAB gene was amplified with the Pseudomonas aeruginosa PAO1 bacterial solution as a template. Using primer pair P7 / P8, the idh gene (nucleotide sequence as shown in SEQ ID NO.4) was amplified with the Pseudomonas putida KT2440 bacterial solution as a template. The pMK plasmid was digested with EcoRI and KpnI, and then the rhlAB gene, idh gene, and pMK (EcoRI, KpnI) were ligated with C115 from Vazyme Co., Ltd. After sequencing verification (the system composition table and program table of gene amplification PCR and colony verification PCR are shown in Table 2-5), the vector PMK-AB-idh was obtained.

[0149] S2. Construction of the genetically engineered bacterium g-idh;

[0150] The correctly sequenced vector PMK-AB-idh was electrotransformed into △flag competent cells at a voltage of 1.35 kV. After adding 1-2 ml of LB and recovering in a shaker at 30 °C and 200 rpm for 1.5 h, the bacterial solution was spread on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing until single colonies grew, single colonies were picked and inoculated into 10 ml of LB liquid containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30 °C and 200 rpm for 12 h, 600 μL of the bacterial solution was added to 600 μL of 50% glycerol and placed in a 2 ml sterile glycerol tube for storage at -80 °C. The strain was named g-idh.

[0151] S3. Streak the overexpressing strain g-idh on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), culture until single colonies grow, pick a single colony and inoculate it into 10 mL of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture overnight at 30 °C and 200 rpm to be used as a seed solution; inoculate 500 μL of the seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. Streak the control strain rhlAB-△flag on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), culture until single colonies grow, pick a single colony and inoculate it into 10 mL of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture overnight at 30 °C and 200 rpm to be used as a seed solution; inoculate 500 μL of the seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. After fermentation, take 1 mL of the fermentation broth, centrifuge at 12000 rpm for 2 min at room temperature, take 500 μL of the supernatant, mix it with 500 μL of acetonitrile, and after overnight at 4 °C, detect the content of rhamnolipid according to the HPLC detection method in the specific implementation manner, and take 1 mL of the fermentation broth to measure the biomass OD 600 . The OD 600 in the supernatant of the fermentation broth and the content of rhamnolipid are compared with those of the control strain as Figure 4 shown. The genetically engineered bacterium g-idh for improving the production of rhamnolipid provided by the present invention increases the supply of rhamnolipid synthesis precursors dTDP-L-rhamnose and HAA by overexpressing the idh gene, so that the production of rhamnolipid is increased by 98.9% compared with rhlAB-△flag.

[0152] Example 4. Construction of strain g-lpdG

[0153] S1. Construct the recombinant plasmid PMK-AB-lpdG;

[0154] Using the primer pair P1 / P2, amplify the rhlAB gene with the Pseudomonas aeruginosa PAO1 bacterial solution as a template, and using the primer pair P9 / P10, amplify the lpdG gene (nucleotide sequence as shown in SEQ ID NO.5) with the Pseudomonas putida KT2440 bacterial solution as a template. The pMK plasmid is digested with EcoRI and KpnI, and then the rhlAB gene, lpdG gene and pMK (EcoRI, KpnI) are ligated with C115 from Vazyme Co., Ltd., and verified by sequencing (the system component table and program table of gene amplification PCR and colony verification PCR are shown in Table 2-5), and the vector PMK-AB-lpdG is obtained.

[0155] S2. Construct the genetically engineered bacterium g-lpdG;

[0156] The correctly sequenced vector PMK-AB-lpdG was electrotransformed into Δflag competent cells at a voltage of 1.35 kV. Add 1-2 ml of LB, and resuscitate in a shaker at 30 °C and 200 rpm for 1.5 h. Then spread the bacterial solution on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture until single colonies grow. Pick a single colony and inoculate it into 10 ml of LB liquid containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30 °C and 200 rpm for 12 h, take 600 μL of the bacterial solution and add 600 μL of 50% glycerol, place it in a 2 ml sterile glycerol tube and store it at -80 °C. The strain was named g-lpdG.

[0157] S3. Streak the overexpressing strain g-lpdG on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture until single colonies grow. Pick a single colony and inoculate it into 10 ml of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture overnight at 30 °C and 200 rpm to be used as a seed solution; inoculate 500 μL of the seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. Streak the control strain rhlAB-Δflag on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture until single colonies grow. Pick a single colony and inoculate it into 10 ml of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture overnight at 30 °C and 200 rpm to be used as a seed solution; inoculate 500 μL of the seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. After fermentation, take 1 mL of the fermentation broth and centrifuge at 12000 rpm for 2 min at room temperature. Take 500 μL of the supernatant and mix it with 500 μL of acetonitrile, and leave it overnight at 4 °C. Then detect the content of rhamnolipid according to the HPLC detection method in the specific implementation manner, and take 1 mL of the fermentation broth to measure the biomass OD 600 . The OD 600 in the supernatant of the fermentation broth and the rhamnolipid content are compared with those of the control strain as Figure 5 shown. The genetically engineered bacterium g-lpdG for improving the production of rhamnolipid provided by the present invention increases the supply of rhamnolipid synthesis precursors dTDP-L-rhamnose and HAA by overexpressing the lpdG gene, so that the production of rhamnolipid is increased by 99.6% compared with rhlAB-Δflag.

[0158] Example 5. Construction of strain g-edd

[0159] S1. Construct the recombinant plasmid PMK-AB-edd;

[0160] Using primer pair P1 / P2, the rhlAB gene was amplified with Pseudomonas aeruginosa PAO1 bacterial solution as the template. Using primer pair P11 / P12, the edd gene (nucleotide sequence shown in SEQ ID NO.6) was amplified with Pseudomonas putida KT2440 bacterial solution as the template. The pMK plasmid was digested with EcoRI and KpnI, and then the rhlAB gene, mdh gene and pMK (EcoRI, KpnI) were ligated with C115 from Vazyme company and verified by sequencing (the system component table and program table of gene amplification PCR and colony verification PCR are shown in Table 2-5), and the vector PMK-AB-edd was obtained.

[0161] S2. Construct the genetically engineered bacterium g-edd;

[0162] The correctly sequenced vector PMK-AB-edd was electrotransformed into △flag competent cells at a voltage of 1.35 kV. After adding 1-2 ml of LB and recovering in a shaker at 30 °C and 200 rpm for 1.5 h, the bacterial solution was spread on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing until single colonies grew, a single colony was picked and inoculated into 10 ml of LB liquid containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30 °C and 200 rpm for 12 h, 600 μL of the bacterial solution was added to 600 μL of 50% glycerol, placed in a 2 ml sterile glycerol tube and stored at -80 °C. The strain was named g-edd.

[0163] S3. The overexpressing strain g-edd was streaked on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing until single colonies grew, a single colony was picked and inoculated into 10 ml of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L) and cultured overnight at 30 °C and 200 rpm as the seed solution; 500 μL of the seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented for 72 h. The control strain rhlAB-△flag was streaked on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing until single colonies grew, a single colony was picked and inoculated into 10 ml of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L) and cultured overnight at 30 °C and 200 rpm as the seed solution; 500 μL of the seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented for 72 h. After fermentation, 1 mL of the fermentation broth was centrifuged at 12000 rpm for 2 min at room temperature. 500 μL of the supernatant was mixed with 500 μL of acetonitrile and left overnight at 4 °C. Then, according to the HPLC detection method in the specific implementation manner, the content of rhamnolipid was detected, and 1 mL of the fermentation broth was taken to measure the biomass OD 600。The OD in the supernatant of the fermentation broth 600 and the rhamnolipid content were compared with those of the control strain as Figure 6 shown. The genetically engineered bacterium g-edd for improving the production of rhamnolipid provided by the present invention increases the supply of dTDP-L-rhamnose and HAA, the precursors of rhamnolipid synthesis, by overexpressing the edd gene, so that the production of rhamnolipid is increased by 92.3% compared with rhlAB-△flag.

[0164] Example 6. Construction of strain g-gltA

[0165] S1. Construction of recombinant plasmid PMK-AB-gltA;

[0166] Using primer pair P1 / P2, the rhlAB gene was amplified with the Pseudomonas aeruginosa PAO1 bacterial solution as the template, and using primer pair P13 / P14, the gltA gene (nucleotide sequence shown in SEQ ID NO.7) was amplified with the Pseudomonas putida KT2440 bacterial solution as the template. The pMK plasmid was digested with EcoRI and KpnI, and then the rhlAB gene, mdh gene and pMK (EcoRI, KpnI) were ligated with C115 from Vazyme Co., Ltd. and verified by sequencing (the component tables and procedure tables of gene amplification PCR and colony verification PCR are shown in Table 2-5) to obtain the vector PMK-AB-gltA.

[0167] S2. Construction of genetically engineered bacterium g-gltA;

[0168] The correctly sequenced vector PMK-AB-gltA was electrotransformed into △flag competent cells at a voltage of 1.35 kV. After adding 1-2 ml of LB and recovering in a shaker at 30 °C and 200 rpm for 1.5 h, the bacterial solution was spread on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and cultured until single colonies grew. Single colonies were picked and inoculated into 10 ml of LB liquid containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and cultured at 30 °C and 200 rpm for 12 h. Then, 600 μL of the bacterial solution was added to 600 μL of 50% glycerol, placed in a 2 ml sterile glycerol tube and stored at -80 °C. The strain was named g-gltA.

[0169] S3. Streak the overexpressing strain g-gltA on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), culture until single colonies grow, pick a single colony and inoculate it into 10 mL of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture overnight at 30 °C and 200 rpm to be used as a seed solution; inoculate 500 μL of the seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. Streak the control strain rhlAB-△flag on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), culture until single colonies grow, pick a single colony and inoculate it into 10 mL of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture overnight at 30 °C and 200 rpm to be used as a seed solution; inoculate 500 μL of the seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. After fermentation, take 1 mL of the fermentation broth and centrifuge at 12000 rpm for 2 min at room temperature, take 500 μL of the supernatant and mix it with 500 μL of acetonitrile, and after overnight at 4 °C, detect the content of rhamnolipid according to the HPLC detection method in the specific implementation manner, and take 1 mL of the fermentation broth to measure the biomass OD 600 . The OD 600 in the supernatant of the fermentation broth and the content of rhamnolipid are compared with those of the control strain as Figure 7 shown. The genetically engineered bacterium g-gltA for improving the production of rhamnolipid provided by the present invention increases the supply of dTDP-L-rhamnose and HAA, the precursors for rhamnolipid synthesis, by overexpressing the gltA gene, thereby increasing the production of rhamnolipid by 85.1% compared with rhlAB-△flag.

[0170] Example 7. Construction of strain g-eda;

[0171] S1. Construct the recombinant plasmid PMK-AB-eda;

[0172] Using the primer pair P1 / P2, amplify the rhlAB gene with the Pseudomonas aeruginosa PAO1 bacterial solution as a template, and using the primer pair P15 / P16, amplify the eda gene (nucleotide sequence as shown in SEQ ID NO.8) with the Pseudomonas putida KT2440 bacterial solution as a template. The pMK plasmid is digested with EcoRI and KpnI, and then the rhlAB gene, eda gene and pMK (EcoRI, KpnI) are ligated with C115 from Vazyme Co., Ltd. and verified by sequencing (the system component tables and program tables for gene amplification PCR and colony verification PCR are shown in Table 2-5) to obtain the vector PMK-AB-eda.

[0173] S2. Construct the genetically engineered bacterium g-eda;

[0174] The correctly sequenced vector PMK-AB-eda was electrotransformed into Δflag competent cells at a voltage of 1.35 kV. Add 1-2 ml of LB, and resuscitate in a shaker at 30 °C and 200 rpm for 1.5 h. Then spread the bacterial solution on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture until single colonies grow. Pick a single colony and inoculate it into 10 ml of LB liquid containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30 °C and 200 rpm for 12 h, take 600 μL of the bacterial solution and add 600 μL of 50% glycerol, place it in a 2 ml sterile glycerol tube and store it at -80 °C. The strain was named g-eda.

[0175] S3. Streak the overexpressing strain g-eda on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture until single colonies grow. Pick a single colony and inoculate it into 10 ml of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture overnight at 30 °C and 200 rpm to be used as a seed solution; inoculate 500 μL of the seed solution into a 500 mL shaker flask containing 50 mL of fermentation medium and ferment for 72 h. Streak the control strain rhlAB-Δflag on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture until single colonies grow. Pick a single colony and inoculate it into 10 ml of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture overnight at 30 °C and 200 rpm to be used as a seed solution; inoculate 500 μL of the seed solution into a 500 mL shaker flask containing 50 mL of fermentation medium and ferment for 72 h. After fermentation, take 1 mL of the fermentation broth and centrifuge at 12000 rpm for 2 min at room temperature. Take 500 μL of the supernatant and mix it with 500 μL of acetonitrile. After overnight at 4 °C, detect the content of rhamnolipid according to the HPLC detection method in the specific implementation manner. Take 1 mL of the fermentation broth to measure the biomass OD 600 . The OD 600 in the supernatant of the fermentation broth and the content of rhamnolipid are compared with those of the control strain as Figure 8 shown. The genetically engineered bacterium g-eda for improving the production of rhamnolipid provided by the present invention increases the supply of dTDP-L-rhamnose and HAA, the precursors of rhamnolipid synthesis, by overexpressing the eda gene, so that the production of rhamnolipid is increased by 71% compared with rhlAB-Δflag.

[0176] Example 8. Construction of strain g-PP_3923

[0177] S1. Construct the recombinant plasmid PMK-AB-PP_3923;

[0178] Using primer pair P1 / P2, the rhlAB gene was amplified with Pseudomonas aeruginosa PAO1 bacterial solution as a template. Using primer pair P17 / P18, the PP_3923 gene (nucleotide sequence shown in SEQ ID NO.9) was amplified with Pseudomonas putida KT2440 bacterial solution as a template. The pMK plasmid was digested with EcoRI and KpnI, and then the rhlAB gene, PP_3923 gene and pMK (EcoRI, KpnI) were ligated with C115 from Vazyme company. After sequencing verification (the system component table and program table of gene amplification PCR and colony verification PCR are shown in Table 2-5), the vector PMK-AB-PP_3923 was obtained.

[0179] S2. Construct the genetically engineered bacterium g-PP_3923;

[0180] The correctly sequenced vector PMK-AB-mdh was electrotransformed into △flag competent cells at a voltage of 1.35 kV. After adding 1-2 ml of LB and recovering in a shaker at 30 °C and 200 rpm for 1.5 h, the bacterial solution was spread on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing until single colonies grew, single colonies were picked and inoculated into 10 ml of LB liquid containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30 °C and 200 rpm for 12 h, 600 μL of the bacterial solution was added to 600 μL of 50% glycerol and placed in a 2 ml sterile glycerol tube for storage at -80 °C. The strain was named g-PP_3923.

[0181] S3. Streak the overexpressing strain g-mdh on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), culture until single colonies grow, pick a single colony and inoculate it into 10 mL of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture overnight at 30 °C and 200 rpm to use as a seed solution; inoculate 500 μL of the seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. Streak the control strain rhlAB-△flag on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), culture until single colonies grow, pick a single colony and inoculate it into 10 mL of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture overnight at 30 °C and 200 rpm to use as a seed solution; inoculate 500 μL of the seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. After fermentation, take 1 mL of the fermentation broth and centrifuge at 12,000 rpm for 2 min at room temperature, take 500 μL of the supernatant and mix it with 500 μL of acetonitrile, and after overnight at 4 °C, detect the content of rhamnolipid according to the HPLC detection method in the specific implementation manner, and take 1 mL of the fermentation broth to measure the biomass OD 600 . The OD 600 in the supernatant of the fermentation broth and the content of rhamnolipid are compared with those of the control strain as Figure 9 shown. The genetically engineered strain g-PP_3923 for improving the yield of rhamnolipid provided by the present invention increases the supply of the rhamnolipid synthesis precursors dTDP-L-rhamnose and HAA by overexpressing the PP_3923 gene, so that the yield of rhamnolipid is increased by 78.8% compared with rhlAB-△flag.

[0182] Example 9. Construction of strain g-PP_2652

[0183] S1. Construct the recombinant plasmid PMK-AB-PP_2652;

[0184] Using the primer pair P1 / P2, amplify the rhlAB gene with the Pseudomonas aeruginosa PAO1 bacterial solution as a template, and using the primer pair P19 / P20, amplify the PP_2652 gene (nucleotide sequence as shown in SEQ ID NO.10) with the Pseudomonas putida KT2440 bacterial solution as a template. The pMK plasmid is digested with EcoRI and KpnI, and then the rhlAB gene, the PP_2652 gene and pMK (EcoRI, KpnI) are ligated with C115 from Vazyme Co., Ltd., and verified by sequencing (the system component table and program table of gene amplification PCR and colony verification PCR are shown in Table 2-5) to obtain the vector PMK-AB-PP_2652.

[0185] S2. Construct the genetically engineered bacterium g-PP_2652;

[0186] Electroporate the vector PMK-AB-PP_2652 with correct sequencing into Δflag competent cells at 1.35 kV. Add 1 - 2 ml of LB, and resuscitate in a shaker at 30 °C and 200 rpm for 1.5 h. Then spread the bacterial solution on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture until single colonies grow. Pick a single colony and inoculate it into 10 ml of LB liquid containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture at 30 °C and 200 rpm for 12 h. Then take 600 μL of the bacterial solution, add 600 μL of 50% glycerol, place it in a 2 ml sterile glycerol tube, and store it at -80 °C. The strain is named g-PP_2652.

[0187] S3. Streak the overexpressing strain g-PP_2652 on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture until single colonies grow. Pick a single colony and inoculate it into 10 ml of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture overnight at 30 °C and 200 rpm to be used as the seed solution; inoculate 500 μL of the seed solution into a 500 mL shaker flask containing 50 mL of fermentation medium and ferment for 72 h. Streak the control strain rhlAB-Δflag on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture until single colonies grow. Pick a single colony and inoculate it into 10 ml of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture overnight at 30 °C and 200 rpm to be used as the seed solution; inoculate 500 μL of the seed solution into a 500 mL shaker flask containing 50 mL of fermentation medium and ferment for 72 h. After fermentation, take 1 mL of the fermentation broth, centrifuge at 12000 rpm at room temperature for 2 min, take 500 μL of the supernatant, mix it with 500 μL of acetonitrile, and leave it overnight at 4 °C. Then detect the content of rhamnolipid according to the HPLC detection method in the specific implementation manner, and take 1 mL of the fermentation broth to measure the biomass OD 600 . The OD 600 in the supernatant of the fermentation broth and the content of rhamnolipid are compared with those of the control strain as Figure 10 shown. The genetically engineered bacterium g-PP_2652 for improving the yield of rhamnolipid provided by the present invention increases the supply of dTDP-L-rhamnose and HAA, the precursors of rhamnolipid synthesis, by overexpressing the PP_2652 gene, so that the yield of rhamnolipid is increased by 76.5% compared with rhlAB-Δflag.

[0188] Example 10. Construction of strain g-PP_3443

[0189] S1. Construct the recombinant plasmid PMK-AB-PP_3443;

[0190] Using the primer pair P1 / P2, amplify the rhlAB gene with the Pseudomonas aeruginosa PAO1 bacterial solution as the template. Using the primer pair P21 / P22, amplify the PP_3443 gene (nucleotide sequence as shown in SEQ ID NO.11) with the Pseudomonas putida KT2440 bacterial solution as the template. Digest the pMK plasmid with EcoRI and KpnI, and then ligate the rhlAB gene, PP_3443 gene, and pMK (EcoRI, KpnI) using C115 from Vazyme Co., Ltd. Verify by sequencing (the system component table and program table for gene amplification PCR and colony verification PCR are shown in Table 2-5) to obtain the vector PMK-AB-PP_3443.

[0191] S2. Construct the genetically engineered bacterium g-PP_2652;

[0192] Electroporate the correctly sequenced vector PMK-AB-PP_3443 into △flag competent cells at a voltage of 1.35 kV. Add 1 - 2 ml of LB, and resuscitate in a shaker at 30 °C and 200 rpm for 1.5 h. Then spread the bacterial solution on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture until single colonies grow. Pick a single colony and inoculate it into 10 ml of LB liquid containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30 °C and 200 rpm for 12 h, take 600 μL of the bacterial solution, add 600 μL of 50% glycerol, place it in a 2 ml sterile glycerol tube, and store it at -80 °C. The strain is named g-PP_3443.

[0193] S3. Streak the overexpressing strain g-PP_3443 on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), culture until single colonies grow, pick a single colony and inoculate it into 10 mL of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture overnight at 30 °C and 200 rpm to use as a seed solution; inoculate 500 μL of the seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. Streak the control strain rhlAB-△flag on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L), culture until single colonies grow, pick a single colony and inoculate it into 10 mL of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture overnight at 30 °C and 200 rpm to use as a seed solution; inoculate 500 μL of the seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. After fermentation, take 1 mL of the fermentation broth, centrifuge at 12000 rpm at room temperature for 2 min, take 500 μL of the supernatant, mix it with 500 μL of acetonitrile, and after overnight at 4 °C, detect the content of rhamnolipid according to the HPLC detection method in the specific implementation manner, and take 1 mL of the fermentation broth to measure the biomass OD 600 . The OD 600 in the supernatant of the fermentation broth and the rhamnolipid content are compared with those of the control strain as Figure 11 shown. The genetically engineered bacterium g-PP_3443 for improving the production of rhamnolipid provided by the present invention increases the supply of rhamnolipid synthesis precursors dTDP-L-rhamnose and HAA by overexpressing the PP_3443 gene, so that the production of rhamnolipid is increased by 58.2% compared with rhlAB-△flag.

[0194] Example 11. Construction of strain g-lpd

[0195] S1. Construct the recombinant plasmid PMK-AB-lpd;

[0196] Using the primer pair P1 / P2, amplify the rhlAB gene with the Pseudomonas aeruginosa PAO1 bacterial solution as a template, and using the primer pair P23 / P24, amplify the lpd gene (nucleotide sequence as shown in SEQ ID NO.11) with the Pseudomonas putida KT2440 bacterial solution as a template. The pMK plasmid is digested with EcoRI and KpnI, and then the rhlAB gene, lpd gene and pMK (EcoRI, KpnI) are ligated with C115 of Vazyme Co., Ltd. and verified by sequencing (the system component table and program table of gene amplification PCR and colony verification PCR are shown in Table 2-5) to obtain the vector PMK-AB-lpd.

[0197] S2. Construct the genetically engineered bacterium g-lpd;

[0198] The correctly sequenced vector PMK-AB-lpd was electrotransformed into Δflag competent cells at a voltage of 1.35 kV. Then, 1-2 ml of LB was added, and the cells were resuscitated in a shaker at 30 °C and 200 rpm for 1.5 h. After that, the bacterial solution was spread on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L). The plate was incubated until single colonies grew. A single colony was picked and inoculated into 10 ml of LB liquid containing ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30 °C and 200 rpm for 12 h, 600 μL of the bacterial solution was added to 600 μL of 50% glycerol, placed in a 2 ml sterile glycerol tube, and stored at -80 °C. The strain was named g-lpd.

[0199] S3: The overexpressing strain g-lpd was streaked on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L). The plate was incubated until single colonies grew. A single colony was picked and inoculated into 10 ml of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and cultured overnight at 30 °C and 200 rpm to be used as a seed solution; 500 μL of the seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented for 72 h. The control strain rhlAB-Δflag was streaked on an LB plate containing ampicillin (100 mg / L) and kanamycin (25 mg / L). The plate was incubated until single colonies grew. A single colony was picked and inoculated into 10 ml of LB medium containing ampicillin (100 mg / L) and kanamycin (25 mg / L), and cultured overnight at 30 °C and 200 rpm to be used as a seed solution; 500 μL of the seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented for 72 h. After fermentation, 1 mL of the fermentation broth was centrifuged at 12000 rpm for 2 min at room temperature. 500 μL of the supernatant was mixed with 500 μL of acetonitrile and left overnight at 4 °C. Then, according to the HPLC detection method in the specific implementation manner, the content of rhamnolipid was detected, and 1 mL of the fermentation broth was used to measure the biomass OD 600 The OD 600 in the supernatant of the fermentation broth and the content of rhamnolipid were compared with those of the control strain as Figure 12 shown. The genetically engineered strain g-lpd for improving the production of rhamnolipid provided by the present invention increases the supply of the rhamnolipid synthesis precursors dTDP-L-rhamnose and HAA by overexpressing the lpd gene, thereby increasing the production of rhamnolipid by 26.6% compared with rhlAB-Δflag.

[0200] In the present invention, the raw materials and equipment used, unless otherwise specified, are all common raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are all conventional methods in the art.

[0201] The present invention screens key genes in the central carbon metabolism pathway, namely maeb gene, mdh gene, idh gene, lpdG gene, edd gene, gltA gene, eda gene, PP_3923 gene, PP_2652 gene, PP_3443 gene, and lpd gene, through CRISPRi and sRNA technologies, and performs tandem overexpression with rhlAB on the basis of Pseudomonas putida △flag to optimize the distribution of carbon metabolic flux. The constructed strain g-maeb has a rhamnolipid yield of 6.65 g / L in shake flask fermentation, which is more than 110% higher than that of the control. The strain provided by the present invention has the advantages of high safety and stable yield, and can be applied to the fields of biosurfactants, medicine, environmental protection, etc.

[0202] SEQ ID NO.1

[0203] rhlAB (Pseudomonas aeruginosa PAO1: PP3890775-3893008):

[0204]

[0205]

[0206] maeb: (Pseudomonas putida KT2440: PP5808020-5809288):

[0207] mdh: (Pseudomonas putida KT2440: PP761969-762901):

[0208] idh: (Pseudomonas putida KT2440: PP4522152-4524377):

[0209]

[0210]

[0211] lpdG: (Pseudomonas putida KT2440: PP4730007-4731443):

[0212]

[0213]

[0214] edd: (Pseudomonas putida KT2440: PP1151276-1153102):

[0215] gltA: (Pseudomonas putida KT2440: PP4739474 - 4740763):

[0216]

[0217]

[0218] eda: (Pseudomonas putida KT2440: PP1167776 - 1168483):

[0219] PP_3923: (Pseudomonas putida KT2440: PP4428963 - 4429673):

[0220] PP_2652: (Pseudomonas putida KT2440: PP3040398 - 3041183):

[0221] PP_3443: (Pseudomonas putida KT2440: PP3899593 - 3901212):

[0222]

[0223]

[0224] lpd: (Pseudomonas putida KT2440: PP6115792 - 6117192):

[0225]

[0226] The above embodiments are for illustrating the embodiments disclosed in the present invention and should not be construed as limitations on the present invention. In addition, various modifications listed herein and changes in the methods and compositions of the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in connection with various specific preferred embodiments of the present invention, it should be understood that the present invention is not limited to these specific embodiments. In fact, all obvious modifications to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. A genetically engineered bacterium of Pseudomonas putida with high yield, characterized in that: It includes chassis bacteria and a recombinant plasmid introduced into the chassis bacteria that can self-replicate; the chassis bacteria is Pseudomonas putida △flag; the recombinant plasmid contains the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 and one or more arbitrary combinations of the maeb gene, mdh gene, idh gene, lpdG gene, edd gene, gltA gene, eda gene, PP_3923 gene, PP_2652 gene, PP_3443 gene, and g-lpd gene in the genome of Pseudomonas putida KT2440.

2. The genetically engineered bacterium of Pseudomonas putida with high yield according to claim 1, wherein: The nucleotide sequence of the rhlAB gene is as shown in SEQ ID NO.1; the nucleotide sequence of the maeb gene is as shown in SEQ ID NO.2; the nucleotide sequence of the mdh gene is as shown in SEQ ID NO.3; the nucleotide sequence of the idh gene is as shown in SEQ ID NO.4; the nucleotide sequence of the lpdG gene is as shown in SEQ ID NO.5; the nucleotide sequence of the edd gene is as shown in SEQ ID NO.6; the nucleotide sequence of the gltA gene is as shown in SEQ ID NO.7; the nucleotide sequence of the mdh gene is as shown in SEQ ID NO.8; the nucleotide sequence of the eda gene is as shown in SEQ ID NO.9; the nucleotide sequence of the PP_3923 gene is as shown in SEQ ID NO.10; the nucleotide sequence of the PP_3443 gene is as shown in SEQ ID NO.11; the nucleotide sequence of the g-lpd gene is as shown in SEQ ID NO.

12.

3. The genetically engineered bacterium of Pseudomonas putida with high yield according to claim 1, characterized in that: The Pseudomonas putida △flag is a mutant strain obtained by knocking out the flag gene cluster in the genome of Pseudomonas putida KT2440.

4. A method for constructing a genetically engineered bacterium of the high-yield Pseudomonas putida as described in claim 1, characterized in that, It includes the following steps: Step 1, prepare the competent cells of Pseudomonas putida △flag; Step 2, construct the recombinant plasmid: Use the one-step cloning method to overexpress the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 and one or more arbitrary combinations of the maeb gene, mdh gene, idh gene, lpdG gene, edd gene, gltA gene, eda gene, PP_3923 gene, PP_2652 gene, PP_3443 gene, and g-lpd gene in the genome of Pseudomonas putida KT2440 in the expression vector pMK to obtain the recombinant plasmid; use Pseudomonas putida △flag as the chassis bacteria and overexpress the recombinant plasmid to obtain the genetically engineered bacteria with high-yield rhamnolipids.

5. The construction method according to claim 4, characterized in that, In Step 1, preparing the competent cells of Pseudomonas putida △flag includes: knocking out the flag gene cluster of Pseudomonas putida KT2440 to obtain the gene knockout mutant strain KT2440Δflag.

6. The construction method according to claim 5, characterized in that: The method used to knock out the flag gene cluster of Pseudomonas putida KT2440 is homologous recombination.

7. The construction method according to claim 4, wherein: Step 2 of constructing the genetically engineered bacteria includes: (1) The rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 and the maeb gene in the genome of Pseudomonas putida KT2440 were tandemly expressed in the expression vector pMK; the vector was introduced into Pseudomonas putida Δflag to obtain the genetically engineered bacterium g-maeb with high rhamnolipid production; (2) The rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 and the mdh gene in the genome of Pseudomonas putida KT2440 were tandemly expressed in the expression vector pMK; the vector was introduced into Pseudomonas putida Δflag to obtain the genetically engineered bacterium g-mdh with high rhamnolipid production; (3) The rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 and the idh gene in the genome of Pseudomonas putida KT2440 were tandemly expressed in the expression vector pMK; the vector was introduced into Pseudomonas putida Δflag to obtain the genetically engineered bacterium g-idh with high rhamnolipid production; (4) The rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 and the lpdG gene in the genome of Pseudomonas putida KT2440 were tandemly expressed in the expression vector pMK; the vector was introduced into Pseudomonas putida Δflag to obtain the genetically engineered bacterium g-lpdG with high rhamnolipid production; (5) The rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 and the edd gene in the genome of Pseudomonas putida KT2440 were tandemly expressed in the expression vector pMK; the vector was introduced into Pseudomonas putida Δflag to obtain the genetically engineered bacterium g-edd with high rhamnolipid production; (6) The rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 and the gltA gene in the genome of Pseudomonas putida KT2440 were tandemly expressed in the expression vector pMK; the vector was introduced into Pseudomonas putida Δflag to obtain the genetically engineered bacterium g-gltA with high rhamnolipid production; (7) The rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 and the eda gene in the genome of Pseudomonas putida KT2440 were tandemly expressed in the expression vector pMK; the vector was introduced into Pseudomonas putida Δflag to obtain the genetically engineered bacterium g-eda with high rhamnolipid production; (8) The rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 and the PP_3923 gene in the genome of Pseudomonas putida KT2440 were tandemly expressed in the expression vector pMK; the vector was introduced into Pseudomonas putida Δflag to obtain the genetically engineered bacterium g-PP_3923 with high rhamnolipid production; (9) The rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 and the PP_2652 gene in the genome of Pseudomonas putida KT2440 were tandemly expressed in the expression vector pMK; the vector was introduced into Pseudomonas putida Δflag to obtain the genetically engineered bacterium g-PP_2652 with high rhamnolipid production; (10) The rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 and the PP_3443 gene in the genome of Pseudomonas putida KT2440 are tandemly expressed in the expression vector pMK; the vector is introduced into Pseudomonas putida Δflag to obtain a genetically engineered bacterium g-PP_3443 with high rhamnolipid production; and / or (11) The rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 and the lpd gene in the genome of Pseudomonas putida KT2440 are tandemly expressed in the expression vector pMK; the vector is introduced into Pseudomonas putida Δflag to obtain a genetically engineered bacterium g-lpd with high rhamnolipid production.

8. The construction method according to claim 4, characterized in that: In step 2, Pseudomonas putida Δflag is used as the chassis bacterium, and the recombinant plasmid is overexpressed, including: The step of preparing Pseudomonas putida Δflag competent cells; and The step of electrotransforming the recombinant plasmid with correct sequencing into Pseudomonas putida Δflag competent cells at a voltage of 1.35 kV.

9. Use of the genetically engineered bacterium of the high-yield Pseudomonas putida according to any one of claims 1 to 3 or the genetically engineered bacterium obtained by the construction method according to any one of claims 4 to 8 in the microbial fermentation for preparing rhamnolipid.

10. The application according to claim 9, wherein The application includes the following steps: inoculating the genetically engineered bacterium into the fermentation medium at an inoculum concentration of 2% by volume, and performing fermentation culture under the conditions of natural pH and a temperature of 30°C; the composition of the fermentation medium is as follows: glucose 10 g / L, yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L, the solvent is deionized water, and the pH value is natural.

Citation Information

Patent Citations

  • Genetically engineered bacterium for producing rhamnolipid at high yield, construction method and application of genetically engineered bacterium

    CN117511841A