Bacillus subtilis engineering strain as well as preparation method and application thereof

By introducing optimized IL-2 and DnaK genes into Bacillus subtilis WB800n and combining with the optimization of fermentation conditions, the problem of low expression efficiency of IL-2 in poultry is solved, efficient production and application of IL-2 is achieved, and the immunity and egg laying performance of poultry are improved.

CN120249165AInactive Publication Date: 2025-07-04QILU UNIVERSITY OF TECHNOLOGY (SHANDONG ACADEMY OF SCIENCES)
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510694161.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-28
Publication Date
2025-07-04
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

The low homology of poultry IL-2 amino acid sequence with mammals leads to insufficient activation efficiency of mammalian IL-2 on poultry immune cells. The existing IL-2 preparations are insufficient in poultry breeding, making it difficult to effectively improve immunity and egg laying performance.

Method used

Bacillus subtilis WB800n is used as the starting strain, and the heterologous expression of IL-2 is achieved by introducing the optimized IL-2 gene and DnaK gene, and the fermentation conditions and feeding strategies are controlled during the fermentation process to improve the yield and stability of IL-2.

Benefits of technology

It significantly improves the immunity and egg production performance of poultry, simplifies the extraction and purification process of IL-2, reduces production costs, and improves the yield and stability of IL-2.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249165A_ABST
    Figure CN120249165A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of genetic engineering, in particular to a bacillus subtilis engineering strain as well as a preparation method and application thereof. According to the invention, the bacillus subtilis WB800n is used as an original strain, and the IL-2 gene and the DnaK gene are introduced, so that heterologous expression of the IL-2 is realized, and the yield of the IL-2 is increased. Meanwhile, the IL-2-containing bacillus subtilis disclosed by the invention can be used for improving the immunity and egg laying performance of poultry, and has a good application effect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a Bacillus subtilis engineering strain, a preparation method thereof, and an application thereof. Background Art

[0002] Interleukin-2 (IL-2) is a cytokine with a relative molecular mass of 15,500, which has a bidirectional regulatory effect on the immune system and is an important molecule for maintaining the homeostasis of the immune system. Therefore, it has received extensive attention in the field of immunology in recent years. When IL-2 was first discovered, it was called T cell growth factor (TCGF) because it can promote the proliferation of T cells. Later, with the in-depth research, it was officially named Interleukin-2 (IL-2). In terms of biological functions, IL-2 is an important factor for the growth and differentiation of T cells, and can promote the proliferation, differentiation and clonal expansion of T cells. At the same time, IL-2 is the main cytokine regulating the survival and function of regulatory T cells (Tregs). In autoimmune diseases, the use of low-dose IL-2 can restore the function of Treg cells, thereby regulating the immune balance. By enhancing the activity of immune cells, IL-2 can enhance the activities of natural killer cells (NK cells) and cytotoxic T cells (CTLs), thereby enhancing the immune surveillance and anti-tumor ability of the body.

[0003] In intensive poultry farming, multiple pathogens (such as avian influenza virus, Newcastle disease virus) need to be dealt with. IL-2 has attracted much attention due to its broad-spectrum immune enhancement potential. However, the amino acid sequences of IL-2 in poultry (such as chickens and ducks) have low homology with those of mammals, resulting in significantly insufficient activation efficiency of mammalian-derived IL-2 on poultry immune cells. At the same time, the main addition method of IL-2 preparations in the poultry industry is through feed or drinking water, and IL-2 preparations are required to have high stability. Therefore, realizing the heterologous expression of IL-2 and improving the yield of IL-2 are the primary problems to be solved at present. Summary of the Invention

[0004] In view of this, the present invention provides a Bacillus subtilis engineering strain, a preparation method thereof, and an application thereof. The present invention uses Bacillus subtilis ( Bacillus subtilis ) WB800n as the starting strain, and realizes the heterologous expression of IL-2 and improves the yield of IL-2 by introducing the IL-2 gene and the DnaK gene. At the same time, the Bacillus subtilis containing IL-2 of the present invention can be used to improve the immunity and egg production performance of poultry, and has good application effects. Based on the above research, the present invention is completed.

[0005] In order to achieve the above invention purposes, the present invention provides the following technical solutions: In the first aspect of the present invention, there is provided an engineered Bacillus subtilis strain, which includes key genes in the cytokine synthesis pathway, and the key gene in the cytokine synthesis pathway is the IL-2 gene.

[0006] As a preferred embodiment, the starting strain of the engineered Bacillus subtilis strain is Bacillus subtilis ( Bacillus subtilis ) WB800n.

[0007] As a preferred embodiment, the IL-2 gene is derived from the chicken IL-2 gene. By adjusting codon usage bias, GC content, removing repetitive sequences and bad motifs, etc., the chicken IL-2 gene sequence is optimized to improve its expression efficiency in Bacillus subtilis. The sequence of the IL-2 gene is shown as SEQ ID NO.1.

[0008] As a preferred embodiment, the engineered Bacillus subtilis strain also introduces the molecular chaperone DnaK heat shock protein gene to increase the expression level of IL-2 in Bacillus subtilis. The sequence of the DnaK gene is shown as SEQ ID NO.2.

[0009] In the second aspect of the present invention, there is provided a method for preparing the above-mentioned engineered Bacillus subtilis strain, which includes transferring the IL-2 protein gene and the DnaK gene into Bacillus subtilis to obtain the engineered Bacillus subtilis strain.

[0010] Specifically, the preparation method includes: Connect the IL-2 gene and the DnaK gene with a vector, transfer them into a recipient cell for cloning and amplification to obtain a recombinant; Extract the target plasmid from the recombinant, transfer the target plasmid into Bacillus subtilis to obtain the engineered Bacillus subtilis strain.

[0011] As a preferred embodiment, the vector is pMA5; the recipient cell is Escherichia coli; the method for transferring the target plasmid into Bacillus subtilis includes electrotransformation and chemical transformation methods, and preferably the chemical transformation method.

[0012] As a preferred embodiment, the Bacillus subtilis is Bacillus subtilis WB800n.

[0013] As a preferred embodiment, the preparation method is specifically as follows: (1) Obtain the IL-2 gene: By designing primer sequences (SEQ ID NO.3, SEQ ID NO.4) containing Hind III and Xba I two restriction enzyme sites, amplify the chicken IL-2 gene fragment and clone it into the prokaryotic expression vector pUC18Hind III and Xba In I, pUC18-IL-2 was constructed. The recombinant plasmid was transformed into Escherichia coli DH5α for replication. After extracting the plasmid, single enzyme digestion verification was carried out, and the target band was detected correctly by 1% agarose gel electrophoresis. After obtaining the recombinant plasmid pUC18-IL-2, it was sent for sequencing. Then, the recombinant plasmid pUC18-IL-2 with correct sequencing was transformed into Escherichia coli DH5α for replication, and the plasmid pUC18-IL-2 was extracted for standby.

[0014] (2)Construction of pMA5-IL-2-DnaK plasmid: Using plasmid pUC18-IL-2 as a template, the IL-2 gene fragment was amplified using primers A1 / A2 (SEQ ID NO.5-6). Using plasmid pMA5 as a template, the linearized vector fragment was amplified using primers B1 / B2 (SEQ ID NO.7-8). The IL-2 gene was inserted into plasmid pMA5 by DNA seamless cloning technology to obtain pMA5-IL-2 plasmid. Primers DnaK-F (SEQ ID NO.9) and DnaK-R (SEQ ID NO.10) containing BamH I / Mlu I sites were designed, and the DnaK gene fragment (SEQ ID NO.2) was obtained by PCR amplification. The amplified DnaK gene fragment (SEQ ID NO.2) and plasmid pMA5-IL-2 were digested with BamH I and Mlu I respectively, and the two fragments were ligated to obtain pMA5-IL-2-DnaK plasmid. Subsequently, the synthesized plasmid pMA5-IL-2-DnaK was transformed into Escherichia coli DH5α for replication, and the pMA5-IL-2-DnaK plasmid was extracted for standby.

[0015] (3)Preparation of competent cells of Bacillus subtilis WB800n: The Bacillus subtilis WB800n strain was inoculated on an LB plate and cultured overnight at 37°C. A fresh cultured wild-type colony was picked and inoculated into GMI, and cultured overnight at 30°C, 100 rpm. The overnight cultured bacterial liquid was transferred to GMII (the volume ratio of the bacterial liquid to GMII was 1:9), and cultured at 37°C, 200 rmp until OD 600 =0.85. The bacterial liquid with OD 600 =0.85 was transferred to GMII (the volume ratio of the bacterial liquid to GMII was 1:9), and cultured at 37°C, 100 rpm for 90 min, then centrifuged at 5000 rpm for 10 min, and the supernatant was discarded. The cells were resuspended with 10 mL of resuspension solution (8 mL GMII and 2 mL 50% glycerol). The resuspended cells were competent cells, which could be directly used for transformation or aliquoted at 500 μL and stored at -80°C for standby.

[0016] (4)Preparation of the engineered Bacillus subtilis strain The plasmids pMA5-IL-2 and pMA5-IL-2-DnaK were respectively transferred into the competent cells of Bacillus subtilis WB800n, and the recombinant strains containing the plasmids pMA5-IL-2 and pMA5-IL-2-DnaK were respectively screened to obtain the engineered Bacillus subtilis strain.

[0017] In this specification, "plasmid" and "vector" can sometimes be used interchangeably, because the plasmid is the most commonly used form of vector at present. However, the present invention is intended to include such other forms of expression vectors that play an equivalent role and are known or will become known in the art, including but not limited to: plasmids, bacteriophage particles, viral vectors, and / or only potential genomic inserts. In specific embodiments, the nucleic acid encoding the fusion protein provided by the present invention can be constructed in various expression vectors.

[0018] The recombinant vector described in the present invention refers to a recombinant nucleic acid vector, which is a recombinant DNA molecule containing the desired coding sequence and the appropriate nucleic acid sequences or elements essential for the expression of the operably linked coding gene in a specific host organism.

[0019] In the third aspect of the present invention, there is provided the use of the above-mentioned engineered Bacillus subtilis strain in the production of IL-2.

[0020] In the fourth aspect of the present invention, there is provided a method for preparing IL-2, which includes fermenting and culturing the above-mentioned engineered Bacillus subtilis strain to obtain IL-2.

[0021] Specifically, the expression level of IL-2 is increased by controlling the temperature, pH, and feeding strategy of the fermentation conditions.

[0022] As a preferred embodiment, the fermentation culture includes: culturing in a fermentation medium at 35 °C, a rotation speed of 200 rpm, and a pH of 7.

[0023] As a preferred embodiment, the fermentation medium formulation is: glycerol 20 g / L, peptone 20 g / L, yeast powder 5 g / L, corn flour 20 g / L, dipotassium hydrogen phosphate 4 g / L, potassium dihydrogen phosphate 2 g / L, magnesium sulfate heptahydrate 2 g / L, ammonium chloride 3.2 g / L.

[0024] As a preferred embodiment, the inoculation amount of the engineered Bacillus subtilis strain is 4%.

[0025] As a preferred embodiment, an appropriate amount of carbon source and nitrogen source are added during the mid-fermentation stage of the fermentation culture process.

[0026] As a preferred embodiment, the carbon source is fructose, the nitrogen source is a mixture of yeast powder and peptone, and the mixing ratio of yeast powder to peptone is 2:1.

[0027] As a preferred embodiment, the fructose concentration is 20 g / L.

[0028] As a preferred embodiment, the nitrogen source concentration is 10 g / L.

[0029] As a preferred embodiment, the volume ratio of carbon source to nitrogen source is 5:1.

[0030] As a preferred embodiment, the total volume of the supplemented carbon source and nitrogen source is 2 times the volume of the initial fermentation broth.

[0031] In the fifth aspect of the present invention, a bacterial agent is provided, which comprises the above-mentioned Bacillus subtilis engineering strain or its fermentation broth.

[0032] As a preferred embodiment, the bacterial agent comprises the fermentation broth of the above-mentioned Bacillus subtilis engineering strain.

[0033] As a preferred embodiment, the dosage form of the bacterial agent is powder.

[0034] As a preferred embodiment, the bacterial agent further comprises acceptable excipients and adjuvants.

[0035] As a preferred embodiment, the excipient is maltodextrin and the adjuvant is antimicrobial peptide.

[0036] As a preferred embodiment, the preparation method of the bacterial agent comprises: the Bacillus subtilis fermentation broth obtained after fermentation is mixed with the excipient maltodextrin at a ratio of 1:10 (m:V), and then spray-dried to obtain the bacterial powder containing IL-2. The bacterial powder containing IL-2 and the adjuvant are mixed evenly at a mass ratio of 2:1 to obtain the bacterial agent.

[0037] In the sixth aspect of the present invention, the application of the above-mentioned Bacillus subtilis engineering strain or the above-mentioned bacterial agent in the preparation of products for enhancing the immunity and egg-laying performance of poultry is provided.

[0038] As a preferred embodiment, the enhancement of poultry immunity specifically refers to promoting the early development of the poultry intestinal immune system and maintaining the growth and reproduction of poultry lymphocytes.

[0039] As a preferred embodiment, the application method is: according to each growth stage of poultry, the strain or the bacterial agent is dissolved in the drinking water of poultry for feeding.

[0040] As a preferred embodiment, the application ratio is to dissolve 1 g of the bacterial agent containing IL-2 in 100 L of drinking water.

[0041] As a preferred embodiment, the poultry is a chicken.

[0042] As a preferred embodiment, the feeding time is specifically as follows: Early feeding and continuous addition: In the chick stage (1 - 21 days), the bacterium agent containing IL-2 is added when the chicks start to feed and drink water, and it continues until 21 days.

[0043] Regular supplementation: In the growth period (22 - 42 days), the drinking water containing the bacterium agent of IL-2 is supplemented every 3 - 5 days.

[0044] Maintenance feeding: In the laying period (after 43 days), continuous feeding is carried out.

[0045] The present invention has the following effects: (1) The present invention uses Bacillus subtilis ( Bacillus subtilis ) WB800n as the starting strain, and can secrete the expressed IL-2 into the extracellular medium. This secretion expression mode can not only simplify the protein extraction and purification process, reduce the production cost, but also avoid the degradation of the target protein by intracellular proteases, and improve the stability and yield of IL-2.

[0046] (2) The present invention optimizes the codons of the chicken IL-2 gene. By adjusting the codon usage bias, GC content, removing repetitive sequences and bad motifs and other methods, the IL-2 gene sequence is optimized to improve its expression efficiency in Bacillus subtilis. At the same time, the molecular chaperone DnaK heat shock protein is introduced to further improve the expression level of IL-2 in Bacillus subtilis. Under the optimal fermentation conditions, the yield of the Bacillus subtilis engineering strain WB800n-IL-2-DnaK is increased by 36.84% compared with that of the Bacillus subtilis engineering strain WB800n-IL-2.

[0047] (3) The present invention further improves the expression amount of IL-2 by controlling the feeding strategy. By carrying out feeding treatment in the middle stage of fermentation, the IL-2 yield of the Bacillus subtilis engineering strain WB800n-IL-2-DnaK is increased by about 14.375% on average (compared with no feeding).

[0048] (4) Compared with other eukaryotes, the advantage of the Bacillus subtilis engineering strain capable of expressing IL-2 prepared by the present invention is that Bacillus subtilis WB800n does not need to be renatured for producing IL-2, and it has low cost and simple fermentation process. The yield and productivity can be increased by increasing the scale of production. At the same time, it can be well applied to the feeding process of poultry, and significantly improves the immunity of poultry. Brief Description of the Drawings

[0049] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art.

[0050] Figure 1 Schematic diagram of constructing the pUC18-IL-2 plasmid in the embodiment of the present invention; Figure 2 Schematic diagram of the influence of temperature control on the fermentation culture of Bacillus subtilis engineering strains in the embodiment of the present invention; wherein, A is the influence of temperature control on the Bacillus subtilis engineering strain WB800n-IL-2; B is the influence of temperature control on the Bacillus subtilis engineering strain WB800n-IL-2-DnaK; Figure 3 Influence of pH control on the fermentation culture of Bacillus subtilis engineering strains in the embodiment of the present invention; wherein, A is the influence of pH control on the Bacillus subtilis engineering strain WB800n-IL-2; B is the influence of pH control on the Bacillus subtilis engineering strain WB800n-IL-2-DnaK; Figure 4 Influence of the feeding strategy on the fermentation culture of the Bacillus subtilis engineering strain WB800n-IL-2-DnaK in the embodiment of the present invention. Detailed implementation manners

[0051] The present invention discloses a Bacillus subtilis engineering strain, its preparation method and application. Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and those skilled in the art can obviously make changes or appropriate changes and combinations to the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technical solutions of the present invention.

[0052] Example 1 Obtaining chicken IL-2 gene Cell separation and culture: Select the spleen of healthy Sanhuang chickens, and aseptically isolate splenic lymphocytes. Place the spleen in PBS (pH 7.2) without Ca²⁺ and Mg²⁺, grind it with a mortar and pestle, centrifuge at 300 g for 10 minutes, take the supernatant and centrifuge at 500 g for 30 minutes to collect lymphocytes. Wash three times with PBS buffer, and then wash twice with RPMI 1640 culture medium. Use the 1% trypan blue staining method for viable cell counting. After ensuring that the number of viable cells is more than 90%, dilute the cells with RPMI 1640 culture medium into a single-cell suspension with a certain concentration.

[0053] mRNA extraction and cDNA synthesis: The prepared spleen lymphocyte suspension was cultured under the optimized in vitro IL-2 induction conditions and stimulated with ConA for different durations (6, 12, 18, 24, 36, 48, 72 hours). Total RNA of lymphocytes was extracted using the one-step method with the Trizol kit. A pair of primers, P1 and P2, was designed and reverse transcription was performed using the Superscript™ Preamplification System reverse transcription kit to obtain cDNA.

[0054] The sequences of primers P1 / P2 are as follows: P1: TGGGACACTGCCATGATG (SEQ ID NO.11); P2: AATTTATTAAATGTCATCTAGAAG (SEQ ID NO.12).

[0055] PCR amplification and identification: PCR amplification was carried out using the Expand High Fidelity PCR System. The optimized PCR amplification conditions are shown in Table 1, specifically: pre-denaturation at 95°C for 3 min, 30 cycles (denaturation at 95°C for 15 sec, annealing at 59°C for 15 sec, extension at 72°C for 1 min), and final extension at 72°C. The PCR products were identified by 1% agarose gel electrophoresis, and a chicken IL-2 gene fragment with a length of 439 bp was obtained. The codons of the chicken IL-2 gene were optimized. The IL-2 gene sequence (SEQ ID NO.1) was optimized by adjusting codon usage bias, GC content, removing repetitive sequences and bad motifs, etc., to improve its expression efficiency in Bacillus subtilis.

[0056] Table 1 PCR reaction conditions

[0057] Gene cloning: The optimized IL-2 gene sequence was synthesized by the company. Using the optimized IL-2 sequence as a template, a pair of primers IL-F / R was designed and restriction enzyme sites Hind III and Xba I were introduced. The obtained chicken IL-2 gene fragment was cloned between the Hind III and Xba I sites of the prokaryotic expression vector pUC18 (purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd.) to construct the recombinant plasmid pUC18-IL-2 ( Figure 1 ). The recombinant plasmid was transformed into Escherichia coli DH5α for expression. After plasmid extraction, the single enzyme digestion verification system is shown in Table 2, and the target band was detected correctly by 1% agarose gel electrophoresis.

[0058] Table 2 Single Enzyme Digestion Verification System

[0059] The nucleotide sequence of the optimized IL-2 gene is as follows: Atgatgtgcaaggtgcttattttcggttgcattagcgttgcaatgttgatgacaacagcatacggcgcatcattgtcatcagagaagtggaaaacactccagacgttgatcaaggatttggagatcctcgagaacatcaagaacaagatccacctcgagttatacacaccgacagagacacaagaatgtacacaacaaacgctgcaatgttacttaggggaagtggttacacttaagaaggaaacggaagacgacacagagattaaagaggagttcgtgacagcgattcagaatatcgagaagaacttgaagagccttacgggtttgaatcacacaggtagcgagtgtaaaatctgcgaagcgaacaacaaaaagaaattcccggacttccttcatgaacttacgaatttcgtgagatacctgcaaaaataa (SEQ ID NO.1).

[0060] The sequences of primers IL-F / R are as follows: IL-F: GACAAGCTTATGATGTGCAAGGTGCTTATT (SEQ ID NO.3); IL-R: CTAGTCTAGATTATTTTTGCAGGTATCTCACG (SEQ ID NO.4).

[0061] Gene sequencing: After obtaining the recombinant plasmid pUC18-IL-2, it was sent for sequencing and the result was correct. Then the recombinant plasmid pUC18-IL-2 was transformed into Escherichia coli DH5α for amplification.

[0062] Example 2 Construction of pMA5-IL-2-DnaK Using plasmid pUC18-IL-2 as a template, the IL-2 gene fragment was amplified using primers A1 / A2 (SEQ ID NO.5-6). Using plasmid pMA5 (purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd.) as a template, a linearized vector fragment was amplified using primers B1 / B2 (SEQ ID NO.7-8). The IL-2 gene was inserted into plasmid pMA5 to obtain pMA5-IL-2 through DNA seamless cloning technology (the kit was purchased from Nanjing Novozymes). The reaction system is shown in Table 3. The recombinant reaction conditions were: 50°C, 5 - 5 min; cooled to 4°C or immediately placed on ice; after recombination was completed, it was transformed into Escherichia coli DH5α to screen for recombinant strains with the correct pMA5-IL-2 sequence.

[0063] Table 3 Gene recombination reaction system

[0064] Among them, the sequences of primers A1 / A2 are: A1: taaaaaggagcgatttacatATGATGTGCAAGGTGCTTATTTTC (SEQ ID NO.5); A2: cgacctgcaggcatgcaagcTTATTTTTGCAGGTATCTCACGAAA (SEQ ID NO.6); The sequences of primers B1 / B2 are: B1: GCTTGCATGCCTGCAGGT (SEQ ID NO.7); B2: ATGTAAATCGCTCCTTTTTAGGTGG (SEQ ID NO.8).

[0065] Using Escherichia coli DH5α as a template, primers DnaK-F (SEQ ID NO.9) and DnaK-R (SEQ ID NO.10) containing BamH I / Mlu I sites were designed respectively, and the open reading frame (ORF) (SEQ ID NO.2) of the gene encoding the DnaK heat shock protein in Escherichia coli was obtained by PCR amplification. The amplified DnaK gene fragment (SEQ ID NO.2) and plasmid pMA5-IL-2 were digested with BamH I and Mlu I respectively, and the two fragments were ligated to obtain the pMA5-IL-2-DnaK plasmid. Subsequently, the pMA5-IL-2-DnaK plasmid was transformed into Escherichia coli DH5α for replication.

[0066] The sequences of primers DnaK-F / R are as follows: DnaK-F: GGATCCATGGGTAAAATAATTGGTATCG (SEQ ID NO.9); DnaK-R: ACGCGTTTATTTTTTGTCTTTGACTTCT (SEQ ID NO.10).

[0067] The sequence of the DnaK gene is as follows:

[0068] Take out the Escherichia coli DH5α competent cells from -80 °C and quickly place them on ice to melt. Add the plasmid pMA5-IL-2-DnaK (200 - 300 ng) to be transformed into 100 μL of competent cells, gently flick the tube wall to mix evenly (avoid pipetting), and let it stand on ice for 30 min. After heat shock in a 42 °C water bath for 60 s, quickly place it on ice and let it stand for 2 min. Do not shake the centrifuge tube. Add 900 μL of LB liquid medium (without antibiotics) to the centrifuge tube, mix well and place it in a shaker at 37 °C and 200 rpm for 1 h to recover (do not light the alcohol lamp, and operate on ice throughout the process). Take it out from the shaker, pipette 100 - 200 μL and spread it evenly on an LB solid medium plate containing ampicillin (the final concentration of resistance is 50 μg / mL). Place the plate in a 37 °C incubator for 10 min. After the bacterial liquid is completely absorbed, invert the plate and culture it overnight. After single colonies grow on the resistance plate, pick a single colony into an LB liquid medium containing ampicillin resistance and culture it at 37 °C and 200 rpm for about 12 h. After extracting the plasmid, verify it by 1% agarose gel electrophoresis to obtain the pMA5 -IL-2-DnaK plasmid, and store it at -20 °C for later use.

[0069] Example 3 Preparation of competent cells of Bacillus subtilis WB800n and preparation of engineering strains Bacillus subtilis ( Bacillus subtilis ) WB800n was purchased from Beijing Tianjingsha Gene Technology Co., Ltd.

[0070] Reagents required for preparation: 10x spizizen salts stock solution: K2HPO4 14 g, KH2PO4 6 g, (NH4)SO4 2 g, Na3C6H5O7·2H2O 1 g, MgSO4·7H2O 0.2 g, 50% glycerol, 10% yeast powder solution, 5% acid hydrolysate casein solution, 0.5 M MgCl2, 0.1 M CaCl2, 50% glucose solution, 0.25% tryptophan solution, sterilized distilled water.

[0071] Media required for preparation: GMI: 5 mL of 10xSPI stock solution, 500 μL of 10% yeast powder, 500 μL of 50% glucose, 200 μL of 5% acid hydrolysate casein, and supplement sterilized distilled water to 50 mL with 43.5 mL.

[0072] GMII: 10 mL of 10x SPI stock solution, 40 μL of 10% yeast powder, 1 mL of 50% glucose, 80 μL of 5% acid-hydrolyzed casein, 500 μL of 0.1M CaCl2, 500 μL of 0.5M MgCl2, supplemented with 87.88 mL of sterilized distilled water to 100 mL.

[0073] Activation of Bacillus subtilis WB800n by streak plate method: Inoculate the strain on an LB plate by streaking and incubate overnight at 37°C. Pick a fresh single wild-type colony and inoculate it into a 50 mL centrifuge tube containing 5 mL of GMI (the centrifuge tube was sterilized in advance), and incubate at 30°C and 100 rpm overnight. Take 2 mL of the overnight culture (transfer it to 18 mL of GMII), and incubate at 37°C and 200 rmp until OD 600 = 0.85 (about three hours). Take 10 mL of the above and transfer it to 90 mL of GMII, incubate at 37°C and 100 rpm for 90 min. Centrifuge at 5000 rpm for 10 min, discard the supernatant, and resuspend with 10 mL of resuspension solution (8 mL of GMII and 2 mL of 50% glycerol). The resuspended cells are competent cells, which can be directly used for transformation or aliquoted into 500 μL and stored at -80°C for later use.

[0074] Place the prepared competent cells on an ice box to melt, add plasmid pMA5-IL-2 and pMA5-IL-2-DnaK respectively (the plasmid addition amount is 200 - 300 ng), incubate in a water bath at 37°C for 30 min, then culture at 37°C and 200 rpm for 1 h, and spread on an LB plate containing kanamycin (the final concentration of the resistance is 50 μg / mL) overnight.

[0075] After single colonies grow on the resistance plate the next day, pick a single colony into an LB liquid medium containing kanamycin resistance, culture at 37°C and 200 rpm for about 12 h, extract the plasmid, and after verification by 1% agarose gel electrophoresis, the target band shows correct, and the engineered Bacillus subtilis strains WB800n-IL-2 and WB800n-IL-2-DnaK are prepared.

[0076] Example 4 Fermentation process The fermentation medium formula is: 20 g / L of glycerol, 20 g / L of peptone, 5 g / L of yeast powder, 20 g / L of corn flour, 4 g / L of dipotassium hydrogen phosphate, 2 g / L of potassium dihydrogen phosphate, 2 g / L of magnesium sulfate heptahydrate, 3.2 g / L of ammonium chloride. Inoculate the engineered Bacillus subtilis strains WB800n-IL-2 and WB800n-IL-2-DnaK respectively, with an inoculation amount of 4%, during the culture process, the rotation speed is 200 rpm, and culture for 48 h - 56 h.

[0077] The cell concentration at different time points during the fermentation process was determined by turbidimetry (expressed as OD 600nm value), and a standard curve was plotted (y = 6.6218x - 0.0173, where x represents the OD value). Further, the enzyme activity (U / mL) of IL-2 was determined and calculated by the DNS method based on the OD 600nm value.

[0078] Fermentation condition control: Temperature control: The fermentation pH was set to 7. According to the growth characteristics of the strain and the expression conditions of the target product, the culture temperatures were set to 25 °C, 30 °C, 35 °C, 40 °C, and 45 °C, and the culture was carried out for 48 h. The fermentation broth concentration and the enzyme activity of IL-2 in the fermentation broth of the Bacillus subtilis engineering strains WB800n-IL-2 and WB800n-IL-2-DnaK under different temperature conditions were measured. The results are shown in Figure 2 A and B of. The growth curves of the Bacillus subtilis engineering strains WB800n-IL-2 and WB800n-IL-2-DnaK were basically consistent at different culture temperatures. The broth concentration and enzyme activity reached the highest at 35 °C. The yield of the Bacillus subtilis engineering strain WB800n-IL-2-DnaK was 56.25% higher than that of the Bacillus subtilis engineering strain WB800n-IL-2 (at 35 °C).

[0079] pH value control: During the fermentation process, the pH value has an important impact on cell growth and product synthesis. According to the growth characteristics of the strain and the expression conditions of the target product, the culture pH was set to 5, 6, 7, 8, and 9, the culture temperature was 35 °C, and the culture was carried out for 48 h. The fermentation broth concentration and the enzyme activity of IL-2 in the fermentation broth of the Bacillus subtilis engineering strains WB800n-IL-2 and WB800n-IL-2-DnaK under different pH conditions were measured. The results are shown in A and B of 3. The growth curves of the Bacillus subtilis engineering strains WB800n-IL-2 and WB800n-IL-2-DnaK were basically consistent at different pH conditions. During the fermentation process of the Bacillus subtilis engineering strain producing IL-2, although the cell growth amount was the highest at pH 9.0, the enzyme activity of IL-2 was relatively low, while the enzyme activity of IL-2 reached the highest value at pH 7.0. Therefore, adjusting the pH to 7.0 during the fermentation process is more conducive to the accumulation of IL-2. At pH 7.0, the yield of the Bacillus subtilis engineering strain WB800n-IL-2-DnaK was 36.84% higher than that of the Bacillus subtilis engineering strain WB800n-IL-2.

[0080] Feeding strategy: Select an appropriate feeding time according to the growth and metabolism of bacteria during the fermentation process. Set the culture pH to 7, the culture temperature to 35 °C, and culture for 48 - 56 h. Use the transformation of the empty vector pMA5 as the control group, and measure the relative activity of IL-2 (percentage increase relative to the control group) during the fermentation process of the Bacillus subtilis engineering strain WB800n-IL-2-DnaK with and without feeding operations. The results are as Figure 4 shown. Add 2 volumes of carbon source (fructose 20 g / L) and nitrogen source (a mixture of yeast powder and peptone with a mixing ratio of 2:1 and a concentration of 10 g / L) at the mid-fermentation stage (24 h). Among them, the volume ratio of carbon source to nitrogen source is 5:1. This can extend the fermentation time and increase the yield of the target product IL-2. The results show that between 16 h and 24 h, the relative activity of the product in both groups increased rapidly during the early fermentation stage without feeding, and the product activity of the non-fed group reached the peak value throughout the fermentation process. After feeding at 24 h, the product activity continued to increase and reached the peak value at 40 h. The relative activity of the fed group gradually decreased after reaching the peak value, but was still higher than that of the non-fed group. The relative activity of the non-fed group also decreased after reaching the peak value, and the decrease rate was faster. In the later stage, although the relative activity of the fed group decreased, it still remained at a relatively high level, while the activity of the non-fed group decreased faster. Therefore, feeding can significantly increase the relative activity, especially in the mid-stage, and maintain a relatively high activity level throughout the process, which helps to maintain a higher yield. From the above analysis, it can be seen that the relative activity values of the fed group at each time point are generally higher than those of the non-fed group, especially the differences at 40 h and 48 h are the largest, which are 35% and 40% respectively. The average relative activity values of the fed group and the non-fed group throughout the time period are 51.25% and 65.625% respectively. In summary, compared with non-feeding, the yield is increased by about 14.375% on average.

[0081] Example 5 Preparation of Bacterial Agent Mix the obtained Bacillus subtilis fermentation broth after fermentation with the auxiliary material maltodextrin at a ratio of 1:10 (m:V), and perform spray drying to obtain bacterial powder. Then add antibacterial peptide and mix it evenly with the bacterial powder. The ratio of antibacterial peptide to bacterial powder is 1:2 to prepare a dry bacterial agent for use before putting it into use.

[0082] Example 6 IL-2 Drinking Water Feeding Time and Method Early feeding and continuous addition: During the chick stage (1 - 21 days), the intestinal immune system has not yet fully developed. At this time, feeding the Bacillus subtilis bacterial agent containing IL-2 can promote the early development of the intestinal immune system and enhance the immunity of chicks. Add the bacterial agent containing IL-2 from the time when chicks start feeding and drinking water, and continue until about 21 days. This stage is a critical period for the establishment of the chicken intestinal flora, and continuous addition helps to form the advantage of beneficial flora.

[0083] Regular supplementation: During the growth period (22 - 42 days), the growth rate of chickens accelerates, increasing the demand for nutrition and immunity. Supplement the bacterial agent containing IL-2 every 3 - 5 days to maintain intestinal health and immune function.

[0084] Sustained feeding: During the laying period (after 43 days), the immune system of chickens bears a heavy burden. Continuously feeding the bacterial agent containing IL-2 helps maintain the immunity and egg-laying performance of chickens.

[0085] Feeding method: First, dissolve the bacterial agent containing IL-2 in drinking water. Dissolve it according to the ratio of 1 g of the bacterial agent containing IL-2 added to 100 L of drinking water to prepare a homogeneous solution suitable for feeding. Stir appropriately during the addition process to ensure that the bacterial agent is evenly distributed and mixed in the drinking water, so that each chicken can ingest enough bacterial agent containing IL-2.

[0086] Example 7 Detection of IL-2 lymphocyte proliferation activity The MTT method was used to detect the lymphocyte proliferation-promoting activity of the IL-2-containing bacterial powder (hereinafter referred to as IL-2) prepared in Example 5. Sterile blood was collected from the wing vein of chickens, anticoagulated with heparin sodium (20 U / mL), and the anticoagulated blood was diluted with an equal volume of Hanks solution. 100 μL of meglumine diatrizoate at 760 g / L was added to 4 mL of lymphocyte separation solution and mixed evenly. Then, 2 mL of anticoagulated blood was slowly added on top of the lymphocyte separation solution, and centrifuged at 2000 r / min for 25 min. The white blood cell layer was gently aspirated with a pipette, and the cells were centrifuged and washed once with RPMI1640 culture medium without fetal bovine serum, and made into a lymphocyte suspension of 1×10 6 cells / mL with RPMI1640 complete medium containing 30 g / L fetal bovine serum. Take 90 μL of peripheral lymphocyte suspension and add it to a 96-well culture plate. Add 10 μL of IL-2 (final concentrations are 0.01, 0.05, 0.1, 0.5, 1.0, 5.0, and 10.0 μg / mL), ConA (0.5 μg / mL), and RP-MI1640 (0.5 μg / mL) culture medium respectively. Place the culture plate in 50 mL / L CO 2 and culture at 37 °C for 24 h; then add 20 μL of MTT (2.5 mg / mL) to each well and continue to culture for 6 h. Take out the culture plate, add 100 μL of isopropyl alcohol hydrochloride (isopropyl alcohol containing 0.04 mol / L HCl) to each well, react at 40 °C for 8 h, and then place it in the dark at room temperature for 15 min. Using ConA as the positive control and RPMI1640 as the negative control, use an enzyme-linked immunosorbent assay (ELISA) reader to detect OD 570nm value. The average and standard deviation of each treatment were calculated using SPSS 10.0, and the comparison between groups was carried out. The results are shown in Table 4.

[0087] Table 4 Detection of IL-2 activity

[0088] The results showed that there were significant differences between IL-2 at each concentration and the negative control; there were significant differences between IL-2 at 0.01, 0.05, 0.1, and 10.0 μg / mL and the positive control; there were no significant differences between IL-2 at 0.5, 1.0, and 5.0 μg / mL and the positive control. This indicates that within the concentration range of 0.5 - 5.0 μg / mL, the biological activity of IL-2 is equivalent to the proliferative ability of ConA on chicken peripheral lymphocytes, and it is an active recombinant protein that can very effectively maintain the growth and reproduction of chicken lymphocytes in vitro.

[0089] In summary, compared with other eukaryotes, the Bacillus subtilis engineering bacteria prepared in this application that can express IL-2 have the advantages that Bacillus subtilis WB800n does not need to be renatured when producing IL-2, has low cost, and a simple fermentation process, and the yield and productivity can be increased by increasing the scale of production. At the same time, it can be well applied to the feeding process of poultry, significantly improving the immunity of poultry.

[0090] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. An engineered Bacillus subtilis strain, characterized in that, The engineered Bacillus subtilis strain includes the key genes in the cytokine synthesis pathway. The key gene in the cytokine synthesis pathway is the IL-2 gene, and the sequence of the IL-2 gene is as shown in SEQ ID NO.

1.

2. The engineered Bacillus subtilis strain according to claim 1, characterized in that, The engineered Bacillus subtilis strain also contains the DnaK gene, and the sequence of the DnaK gene is as shown in SEQ ID NO.

2.

3. The preparation method of the engineered Bacillus subtilis strain according to claim 1, characterized in that, It includes transferring the IL-2 protein gene and the DnaK gene into Bacillus subtilis to obtain the engineered Bacillus subtilis strain.

4. The preparation method according to claim 3, characterized in that, The specific preparation method is as follows: Connect the IL-2 gene and the DnaK gene with a vector, transfer them into a recipient cell for cloning and amplification to obtain a recombinant; Extract the target plasmid from the recombinant, transfer the target plasmid into Bacillus subtilis to obtain the engineered Bacillus subtilis strain.

5. The preparation method according to claim 4, characterized in that, The vector is pMA5; the recipient cell is Escherichia coli; the method of transferring the target plasmid into Bacillus subtilis uses the chemical transformation method.

6. Use of the engineered Bacillus subtilis strain according to any one of claims 1-2 in the production of IL-2.

7. A preparation method of IL-2, characterized in that, Ferment and culture the engineered Bacillus subtilis strain according to claim 1 to obtain IL-2.

8. A bacterial agent, characterized in that, It contains the engineered Bacillus subtilis strain according to any one of claims 1-2 or its fermentation broth.

9. The microbial agent according to claim 8, wherein It also contains acceptable excipients and adjuvants.

10. Use of the engineered Bacillus subtilis strain according to claim 1 or the bacterial agent according to any one of claims 8-9 in the preparation of a product for enhancing the immunity and egg-laying performance of poultry.

Citation Information

Patent Citations

  • Expression box capable of efficiently achieving secretory expression of human FGF21 protein and application of expression box

    CN109988802A

  • Methods for the production of methacrylates

    CN112469813A

  • Recombinant bacillus for heterologous synthesis of ovotransferrin as well as construction method and application of recombinant bacillus

    CN119432701A

  • Integrated cytokine production system

    US20100279344A1