Special synergistic auxiliary agent for metarhizium anisopliae Mr006

Abstract

The invention belongs to the technical field of microbial pesticides, and particularly relates to a special synergistic aid lecithin for metarhizium anisopliae Mr006. The lecithin additive has good compatibility with the metarhizium anisopliae Mr006, spore production can be effectively promoted, the insecticidal activity of the metarhizium anisopliae is remarkably improved, the infection time of target pests is effectively shortened, and the insecticidal time efficiency of the metarhizium anisopliae is improved. The metarhizium anisopliae Mr006 and lecithin are combined for use, and lecithin has a synergistic effect on the metarhizium anisopliae Mr006, so that the control effect on beet armyworms and chilo suppressalis can be improved. Meanwhile, the lecithin additive is relatively high in safety to non-target organisms, so that a new technical support is provided for the development of green agriculture.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial pesticides, and specifically relates to a special synergistic adjuvant for Metarhizium rileyi Mr006, which is used to improve the prevention and control of Lepidoptera pests such as Spodoptera exigua and Chilo suppressalis. Background Art

[0002] Entomogenous fungi are a type of microorganisms that were first identified as insect pathogens and are also an important resource that can be developed into environmentally friendly biological pesticides. There are many types of entomogenous fungi, which grow and reproduce rapidly and are easy to produce in large quantities; under suitable conditions, they will cause fungal epidemics to break out in insect populations, effectively controlling the growth of pest population densities. In addition, the infection of pests can be achieved not only through the body wall, but also through the digestive tract and respiratory tract of the host. Due to its unique infection method and its advantages in terms of quantity and target of action, entomogenous fungi have become the first choice for biological control of pests. Nowadays, many entomogenous fungi such as Beauveria bassiana, Metarhizium rileyi, and Metarhizium anisopliae have been developed and are widely used in pest control in environments such as farmland and greenhouse greenhouses. Research has found that using fungi to control pests is not only environmentally friendly but also can overcome the generation of insect resistance to chemical pesticides.

[0003] Although entomogenous fungi have potential as a biological insecticide, their actual effects are greatly affected by environmental factors such as temperature and humidity. Therefore, in practical applications, their control effects are not stable enough, and the insecticidal speed is also relatively slow. These problems limit the popularization and application of entomogenous fungi in agricultural control. To overcome these challenges, scholars at home and abroad are actively looking for effective methods to improve the insecticidal effects of entomogenous fungi to enhance their application in biological control.

[0004] Currently, it has been reported that adding nutrients can increase the sporulation amount of entomogenous fungi or promote spore germination, thereby shortening the infection time of target pests and achieving the effect of improving infection virulence. Surfactants are a commonly used carrier and one of the most important adjuvants, with excellent wetting and penetration properties, which can reduce the surface tension of hydrophobic conidia of entomogenous fungi, thereby enhancing their insecticidal effects. However, there are few research examples on the combined application of other types of adjuvants and entomogenous fungi, and their compatibility and synergistic effects need to be explored.

[0005] Metarhizium rileyi Mr006 was isolated and identified from the cadavers of Spodoptera frugiperda infected by entomogenous fungi in the field during an investigation in the Taihe corn planting area by the biological control team of the Institute of Plant Protection and Agro - product Quality Safety, Anhui Academy of Agricultural Sciences. This Metarhizium rileyi Mr006 has been publicly disclosed in CN202210572361.8 and was preserved in the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on May 9, 2022. The preservation address is: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC NO.40171.

[0006] The specific sequencing results are as follows (540bp):

[0007] GCTACCTGATTCGAGGTCACTCTTGGAGAAGTTTGTGCGTTTTACGGCAGTGGCCGCGCCGCGCTCCTGTTGCGAGGTTGTGCTACTACGCAGAGGAGGCCGCGACGGGGCCGCCAATTCATTTCGGGGGCGGCGCCGCAGGGAACCGCCTGAGCGGCCCGGCTGACAATCGCCGGCCCCCAACACCAAACCGCGGGGGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTTGTATGATTCCACTCAGACGTGCCAAAGGCTAAGAGATACAGAGTTTCGGTCCCGCGGCGGGCGCCTGTTTCCGGGCGGGCTCTGGACGAGCCCGGTCCGGGGCAAATGACCCGCCGAGGCAACAGGAAAAGGGTATAAGTTCACATGGGGTTGGGAGTGA

[0008] Long-term chemical use has led to pest resistance to traditional insecticides. The extensive use of chemical agents has also brought a series of environmental and ecological problems, which have forced the search for alternative measures. Entomopathogenic fungi such as Metarhizium rileyi Mr006, as a widely used insect pathogenic microorganism, showed good insecticidal effects in previous laboratory studies, but there are deficiencies such as unstable control efficacy, narrow insecticidal spectrum, and slow effect in field use. In order to develop and promote the application of entomopathogenic fungi in pest biological control, in addition to the combined application technology of bacteria and drugs, explore the compatibility of different types of adjuvants with Metarhizium rileyi Mr006, determine the effects of adjuvants on germination rate, colony diameter, and sporulation amount, and further evaluate the synergistic effect of adjuvants on insecticidal toxicity, in order to obtain a technology for improving the efficient control application of Metarhizium rileyi Mr006, which can also provide a new method for the green control of pests. Summary of the Invention

[0009] The present invention belongs to the technical field of microbial pesticides, and specifically relates to a special synergistic adjuvant for Metarhizium rileyi Mr006, which is used to improve the prevention and control of Lepidoptera pests such as Spodoptera exigua and Chilo suppressalis. The specific technical solutions are as follows:

[0010] Use of lecithin adjuvant to improve the spore germination rate, mycelial growth and sporulation amount of Metarhizium rileyi.

[0011] Use of lecithin adjuvant to improve the insecticidal activity or insecticidal efficacy of Metarhizium rileyi against Spodoptera exigua.

[0012] Use of lecithin adjuvant to improve the control effect of Metarhizium rileyi on crop pests, where the crop pests are Spodoptera exigua and Chilo suppressalis.

[0013] Preferably, the Metarhizium rileyi is Metarhizium rileyi Mr006.

[0014] A microbial composition containing Metarhizium rileyi according to the present invention comprises Metarhizium rileyi and lecithin; the suspension concentration of the Metarhizium rileyi spores is 1.0×10 6 spores / mL - 1.0×10 9 spores / mL; the mass concentration of lecithin in the composition is 0.05 - 1%.

[0015] Preferably, the suspension concentration of the Metarhizium rileyi spores is 1.0×10 6 spores / mL - 1.0×10 8 spores / mL; the mass concentration of lecithin in the composition is 0.05 - 0.5%.

[0016] The types of adjuvants screened in the present invention:

[0017] Agricultural organosilicon is mainly composed of ethoxy-modified trisiloxane and is a polyether-modified special organosilicon surfactant with low surface tension, super spreading property, excellent permeability, high internal absorption and conductivity, which can enhance the adhesion of the liquid medicine and improve the utilization rate of pesticides.

[0018] Tangerine peel oil is extracted from unique tangerine peel raw materials, and its main component is D-limonene, which can enhance the penetration strength and physical sealing effect, thereby improving the drug efficacy.

[0019] Lecithin, especially animal-derived lecithin, is mainly extracted from animal tissues or by-products, such as egg yolks, dairy products (milk), etc. The most common source is egg yolk lecithin. Animal-derived lecithin has a relatively high content of phosphatidylcholine (PC) (60-70%), and also contains phosphatidylethanolamine (PE), phosphatidylinositol (PI), etc. It has the functions of emulsifying and decomposing oils and fats. In agriculture, it can be used as a surfactant to help pesticides adhere evenly to the surface of plant leaves or insect bodies, improving the efficacy of pesticides. However, due to the high cost, its application is less. In this invention, animal-derived lecithin is used, which can be extracted from either milk or egg yolks.

[0020] PDMS-01 is a wetting composition containing dimethylpolysiloxane (Patent Application No.: 2022108986649), which is self-developed by the Institute of Plant Protection and Agro-Product Quality Safety, Anhui Academy of Agricultural Sciences.

[0021] Compared with the prior art, the present invention has the following beneficial technical effects:

[0022] The present invention proves that the lecithin adjuvant has good compatibility with Metarhizium rileyi Mr006, can effectively promote sporulation, significantly improve the insecticidal activity of Metarhizium rileyi Mr006, effectively shorten the infection time of target pests, and enhance the insecticidal efficiency of Metarhizium rileyi Mr006. When Metarhizium rileyi Mr006 is used in combination with lecithin, lecithin has a synergistic effect on Metarhizium rileyi Mr006, and can improve the control efficacy against Spodoptera exigua and Chilo suppressalis, but has no improvement effect on the control efficacy against Ostrinia furnacalis.

[0023] Lecithin can be used as a carrier for the conidia of Metarhizium rileyi, improving its adhesion and stability on the surface of pests; by regulating the lipid metabolism of pests, it may reduce the resistance of pests to Metarhizium rileyi. At the same time, the antioxidant effect of lecithin can protect the activity of the conidia of Metarhizium rileyi and improve its infection efficiency.

[0024] The combined application of Metarhizium rileyi and lecithin has a significant synergistic effect in the control of agricultural pests. Lecithin enhances the adhesion and stability of Metarhizium rileyi, improves its lethality to pests, and has a relatively high safety for non-target organisms, providing new technical support for the development of green agriculture. Description of the Drawings

[0025] Figure 1 Effect of different treatments on the germination rate of Metarhizium rileyi Mr006

[0026] Figure 2 Effect of different treatments on the colony diameter of Metarhizium rileyi Mr006

[0027] Figure 3 Effect of different treatments on the sporulation amount per unit area of Metarhizium rileyi Mr006 Detailed Implementation Modes

[0028] The present invention can be better understood according to the following embodiments. However, those skilled in the art can easily understand that the content described in the embodiments is only used to illustrate the present invention and should not and will not limit the present invention described in detail in the claims.

[0029] Example 1: Screening test of special synergistic adjuvants for Metarhizium rileyi Mr006

[0030] Metarhizium rileyi Mr006 has good effects on Spodoptera frugiperda, Spodoptera exigua, Prodenia litura, etc. Based on this, the effects of 4 adjuvants (silicone, tangerine peel oil, lecithin, PDMS-01) on the germination rate, colony diameter and sporulation amount of Metarhizium rileyi Mr006 were studied to determine the compatibility between the tested adjuvants and entomogenous fungi, and to measure the influence of adjuvants on insecticidal toxicity, so as to provide a theoretical basis for exploring the high-efficiency application of Metarhizium rileyi Mr006.

[0031] I. Materials and methods

[0032] 1. Test strains and insects

[0033] The tested entomogenous fungus Metarhizium rileyi Mr006 was provided by the Institute of Plant Protection and Agro-Product Quality Safety, Anhui Academy of Agricultural Sciences.

[0034] The Spodoptera exigua used in this experiment was artificially subcultured in the laboratory. The environmental conditions of the insect rearing room were temperature (27±1°C), relative humidity (70±10%), and photoperiod L:D = 16h:8h.

[0035] The Chilo suppressalis population was kindly donated by Teacher Qiu Lin of Hunan Agricultural University. The rearing conditions were temperature (28±1)°C, relative humidity 70% - 80%, and photoperiod 16L:8D. The newly molted 3rd instar larvae with consistent size and good growth status were selected for the test.

[0036] The Ostrinia furnacalis were all subcultured indoors in this laboratory. They were reared in an insect rearing room with temperature (27±1)°C, relative humidity 50% - 75%, and photoperiod L / / D = 14h / / 10h. The 3rd instar larvae of the same age were selected for the test.

[0037] 2. Culture medium

[0038] Sabouraud Maltose Agar with Yeast Extract (SMAY) solid medium: Weigh 75 g of powdered SMAY reagent, pour in an appropriate amount of distilled water, stir evenly until there are no lumps or fine powder particles, place it on an induction cooker and boil until the water boils, then supplement with sterile water to 1 L, and sterilize it in a high-pressure steam sterilizer at 121°C for 20 min.

[0039] 3. Tested adjuvants

[0040] One kind of additive a - silicone-based, one kind of additive b - plant essential oil, one kind of additive c - lecithin, one kind of additive d - PDMS-01, where additive d is prepared by Anhui Academy of Agricultural Sciences.

[0041] 4. Test methods

[0042] 4.1 Experiment on the growth effect of four additives on Metarhizium rileyi Mr006

[0043] Filter the four additives (silicone, tangerine peel oil, lecithin, PDMS-01) into centrifuge tubes, shake for 3 min, and then place them in a laminar flow hood for standby. After the medium is sterilized, prepare two concentrations of 0.5% and 0.05% in the laminar flow hood (see Table 1 for details). Pour about 15 mL of the medium into each petri dish and let it cool. Culture Metarhizium rileyi Mr006 on an SMAY plate for 14 days. Wash the spores with sterile water containing 0.05% Tween-80, collect them in a beaker, stir well with a magnetic stirrer, and dilute to an appropriate concentration. Check the spore concentration using a microscope and a hemocytometer, and adjust the concentration to 1.0×10 8 spores / mL as the mother liquor. Inoculate 2 μL of the prepared 1×10 7 spores / mL suspension into the center of each cooled petri dish.

[0044] Table 1 Treatment methods of four additives on Metarhizium rileyi Mr006

[0045]

[0046]

[0047] Note: Additive a: silicone; Additive b: tangerine peel oil; Additive c: lecithin; Additive d: PDMS-01

[0048] 4.1.1 Effect of additives on spore germination

[0049] Add 18 mL of SMY culture medium and 2 mL of spore solution with different additives (see Table 1) to a 50 mL centrifuge tube in sequence. The final concentration of spores is 1.0×10 per milliliter 7 spores. Then, tie the centrifuge tube with a rubber band and place it in a shaker. Set the temperature to (28±1) °C and the rotation speed to 150 r / min. Take it out after culturing Metarhizium rileyi Mr006 for 18 hours. Observe the spore germination situation using a microscope. Repeat each treatment method 3 times, observe 100 spores each time, record the number of germinated spores, and calculate the spore germination rate. At the same time, conduct an experiment with the spore solution without additives as the control group.

[0050] 4.1.2 Effect of additives on mycelial growth

[0051] Appropriately add auxiliaries to the SMAY medium to prepare media containing 0.05% and 0.5% auxiliaries. Inoculate the spore suspension in the center of the media containing different concentrations of auxiliaries respectively. After sealing the media, place them in an incubator for cultivation. After 15 days of cultivation, measure the colony diameter using the cross method. Conduct 3 replicate experiments for each treatment, and set the medium without added auxiliaries as the control group.

[0052] 4.1.3 Effect of auxiliaries on sporulation

[0053] Use a glass spreader to scrape spores from the colony of Metarhizium rileyi Mr006 that has been cultured for 15 days, and transfer them into sterile water containing 0.05% Tween-80. After fully mixing and shaking for 10 minutes, appropriately dilute the spore suspension, and check the spore concentration using a hemocytometer under a microscope. Calculate the sporulation amount per unit area for each treatment using the spore concentration and colony diameter to compare the sporulation under different treatment conditions.

[0054] 4.2 Determination of the insecticidal activity of Metarhizium rileyi Mr006

[0055] Dilute the prepared spore suspension to 1.0×10 8 spores / mL, 1.0×10 7 spores / mL, 1.0×10 6 spores / mL, 1.0×10 5 spores / mL and 1.0×10 4 spores / mL. Using an aqueous solution of 0.05% Tween-80 as the control, put 3rd instar larvae of the same size into a tea strainer with a writing brush, soak them in the spore suspension for 20 s and then take them out, place them on sterile filter paper to absorb the excess water, transfer them to artificial feed for feeding, continuously investigate for 11 days, record the number of dead insects every day. Use a 12-well cell culture plate for the test and spray sterile water on the paper to keep it moist. There are 3 replicates for each treatment, and 24 insects for each replicate. The method for determining the insecticidal activity by adding different concentrations of auxiliaries to the above spore suspension is the same as above.

[0056] 4.3 Pot experiment to determine the control effect on different pests

[0057] Indoor, select 12 pots of rice seedlings, soybean seedlings, and corn seedlings cultivated with sterile soil respectively, and introduce 20 3rd instar larvae of Chilo suppressalis, Spodoptera exigua, and Ostrinia furnacalis respectively, that is, 5 pots for each treatment (i.e., 5×1 replicates), with 240 insects of Chilo suppressalis, Spodoptera exigua, and Ostrinia furnacalis each. Spray 1.0×10 7 spores / mL spore suspension of Metarhizium rileyi Mr006, 1.0×10 7Metarhizium rileyi Mr006 spore suspension at [spores / mL] + 0.5% lecithin adjuvant, 0.5% lecithin adjuvant, 0.05% Tween-80 aqueous solution were placed in a greenhouse for humidity-controlled and isolated culture for 14 days. The mortality was checked and the corrected mortality rate was calculated.

[0058] II. Results and Analysis

[0059] 1. Effects of 4 adjuvants on the germination rate of Metarhizium rileyi Mr006

[0060] Table 2 Effects of different treatments on the germination rate of Metarhizium rileyi Mr006

[0061]

[0062] (a1: 0.5% silicone, b1: 0.5% tangerine peel oil, c1: 0.5% lecithin, d1: 0.5% PDMS-01, a2: 0.05%

[0063] silicone, b2: 0.05% tangerine peel oil, c2: 0.05% lecithin, d2: 0.05% PDMS-01)

[0064] From Figure 1 and Table 2, it can be seen that the effects of the 4 adjuvants on the germination rate of Metarhizium rileyi Mr006 showed different differences due to different concentrations and types. Except for 0.05% concentration of silicone, the effects on the germination rate in the remaining treatments were extremely significantly different (p < 0.01) compared with the control group. Among them, the treatment with 0.5% concentration of silicone had an inhibitory effect on the germination rate. The Metarhizium rileyi Mr006 did not germinate in the treatments with 0.5% and 0.05% concentrations of PDMS-01 added. The treatments with 0.5% tangerine peel oil, 0.5% and 0.05% lecithin added had a promoting effect on the germination rate.

[0065] 2. Effects of 4 adjuvants on the colony diameter of Metarhizium rileyi Mr006

[0066] Table 3 Effects of different treatments on the colony diameter of Metarhizium rileyi Mr006

[0067]

[0068] (a1: 0.5% silicone, b1: 0.5% tangerine peel oil, c1: 0.5% lecithin, d1: 0.5% PDMS-01, a2: 0.05%

[0069] silicone, b2: 0.05% tangerine peel oil, c2: 0.05% lecithin, d2: 0.05% PDMS-01)

[0070] From Figure 2As can be seen from Table 3, the 4 kinds of additives have different effects on the colony diameter of Metarhizium rileyi Mr006 due to different concentrations and types. 0.5% silicone, 0.5% green tangerine oil, 0.5% and 0.05% of additive PDMS-01 have inhibitory effects on colony growth. There is no significant difference in adding 0.5% and 0.05% lecithin compared with the control group (p < 0.05).

[0071] 3. Effects of 4 kinds of additives on the sporulation amount per unit area of Metarhizium rileyi Mr006

[0072] Table 4 Effects of different treatments on the sporulation amount per unit area of Metarhizium rileyi Mr006

[0073]

[0074] (a1: 0.5% silicone, b1: 0.5% green tangerine oil, c1: 0.5% lecithin, d1: 0.5% PDMS-01, a2: 0.05%

[0075] silicone, b2: 0.05% green tangerine oil, c2: 0.05% lecithin, d2: 0.05% PDMS-01)

[0076] From Figure 3 and Table 4, it can be seen that the 4 kinds of additives have different effects on the sporulation amount per unit area of Metarhizium rileyi Mr006 due to different concentrations and types. Adding 0.5% lecithin has a promoting effect on the sporulation amount per unit area of Metarhizium rileyi Mr006, and the sporulation amount reaches 3.180×10 7 pcs / cm 2 , which has a significant difference compared with the control group (p < 0.01). The rest of the treatments have inhibitory effects on the sporulation amount of Metarhizium rileyi Mr006, and there is a highly significant difference compared with the control group (p < 0.01). Among them, the treatments with 0.5% and 0.05% additive PDMS-01 do not sporulate.

[0077] The above test results show that silicone, green tangerine oil, lecithin, and PDMS-01 have different effects on the growth of Metarhizium rileyi Mr006 due to different concentrations and types. 0.5% and 0.05% PDMS-01 have inhibitory effects on spore germination, colony growth, and sporulation, and have poor compatibility with Metarhizium rileyi Mr006. Adding 0.5% concentration of lecithin in the culture medium, the sporulation amount per unit area of Metarhizium rileyi Mr006 reaches the highest of 3.18×10 8 pcs / cm 2 , compared with 1.4373×10 8 pcs / cm 2In comparison, the promoting effect was 121.28%, showing a significant promoting effect on sporulation. The remaining treatments all had an inhibitory effect on the sporulation amount of Metarhizium rileyi Mr006.

[0078] The lecithin adjuvant with a concentration of 0.5% had good compatibility with Metarhizium rileyi Mr006 and could promote sporulation. Subsequently, 0.5% lecithin will be added to the spore solution for soaking the larvae of pests such as Spodoptera exigua, and the LC 50 (median lethal concentration) and LT 50 (median lethal time) will be measured to study whether the lecithin adjuvant can improve the infection virulence and shorten the infection time of target pests.

[0079] Table 5 Median lethal concentration (LC 50 ) of Metarhizium rileyi Mr006 and lecithin adjuvant against Spodoptera exigua larvae

[0080]

[0081] 4. Determination of insecticidal activity of Metarhizium rileyi Mr006

[0082] As can be seen from Table 5, adding lecithin at concentrations of 0.05% and 0.5% could reduce the LC 50 (median lethal concentration) value of Metarhizium rileyi Mr006 against Spodoptera exigua. Among them, the reduction multiple of 0.5% lecithin reached more than 26 times, significantly improving the insecticidal activity of Metarhizium rileyi Mr006 against Spodoptera exigua.

[0083] Table 6 Median lethal time (LT50) of different treatments of Metarhizium rileyi Mr006 against Spodoptera exigua larvae

[0084] Concentration of Metarhizium rileyi Mr006 treatment (spores / mL) <![CDATA[Median lethal time LT 50 (d)]]> <![CDATA[10 6 > 12.63±3.05a <![CDATA[10 7 > 11.12±1.51ab <![CDATA[10 8 > 8.77±1.55bc <![CDATA[10 6 + 0.05% lecithin]]> 12.61±3.09a <![CDATA[10 7 + 0.05% lecithin]]> 9.42±1.01abc <![CDATA[10 8 + 0.05% lecithin]]> 7.75±1.31bc <![CDATA[10 6 + 0.5% lecithin]]> 9.09±0.53abc <![CDATA[10 7 + 0.5% lecithin]]> 7.46±1.13c <![CDATA[10 8 + 0.5% lecithin]]> 7.06±0.48c

[0085] As can be seen from Table 6, adding lecithin at concentrations of 0.05% and 0.5% could reduce the LT 50 (median lethal time) value of Metarhizium rileyi Mr006 against Spodoptera exigua. Among them, when 0.5% lecithin adjuvant was added to the spore suspensions with concentrations of 1.0×10 6 spores / mL, 1.0×10 7 spores / mL, and 1.0×10 8 spores / mL, the LT 50 values were shortened by 3.54 d, 3.66 d, and 1.71 d respectively, effectively shortening the infection time of target pests and improving the insecticidal efficiency of Metarhizium rileyi Mr006 against Spodoptera exigua.

[0086] 5. Determination of control effects on different pests in pot experiments

[0087] Table 7 Control effect of Metarhizium rileyi Mr006 + lecithin adjuvant against Spodoptera exigua

[0088]

[0089]

[0090] As can be seen from Table 7, after adding the lecithin adjuvant at a concentration of 0.5%, the average corrected mortality rate of Metarhizium rileyi Mr006 against Spodoptera exigua increased from 40.68% to 62.07%, proving that the lecithin at a concentration of 0.5% can improve the control effect of Metarhizium rileyi Mr006 against Spodoptera exigua.

[0091] Table 8 Control effect of Metarhizium rileyi Mr006 + lecithin adjuvant against Chilo suppressalis

[0092]

[0093] As can be seen from Table 8, after adding the lecithin adjuvant at a concentration of 0.5%, the average corrected mortality rate of Metarhizium rileyi Mr006 against Chilo suppressalis increased from 38.33% to 52.54%, proving that the lecithin at a concentration of 0.5% can improve the control effect of Metarhizium rileyi Mr006 against Chilo suppressalis.

[0094] Table 8 Control effect of Metarhizium rileyi Mr006 + lecithin adjuvant against Ostrinia furnacalis

[0095]

[0096]

[0097] As can be seen from Table 9, after adding the lecithin adjuvant at a concentration of 0.5%, the average corrected mortality rate of Metarhizium rileyi Mr006 against Ostrinia furnacalis basically remained unchanged, proving that the lecithin at a concentration of 0.5% has no effect on the control effect of Metarhizium rileyi Mr006 against Ostrinia furnacalis.

[0098] The results of the previous experiments showed that the lecithin adjuvant had good compatibility with Beauveria bassiana Bb455 and Metarhizium anisopliae Ma40 preserved in this laboratory, and could promote sporulation, but had no effect on the LC 50 (median lethal concentration), LT 50 (median lethal time).

[0099] The above are only the preferred embodiments of the present invention. For those skilled in the art, without departing from the raw materials of the present invention, appropriate improvements can be made, and these improvements are also within the protection scope of the present invention.

Claims

1. Use of lecithin for improving the spore germination rate, mycelial growth and sporulation amount of Metarhizium rileyi.

2. Use of lecithin for improving the insecticidal activity or insecticidal efficacy of Metarhizium rileyi against Spodoptera exigua.

3. Use of lecithin for improving the control effect of Metarhizium rileyi on crop pests, characterized in that, The crop pests are Spodoptera exigua and Chilo suppressalis.

4. The use according to any one of claims 1 to 3, characterized in that, The Metarhizium rileyi is Metarhizium rileyi Mr006.

5. A microbial composition comprising Metarhizium rileyi, characterized in that, Comprising Metarhizium rileyi and lecithin; The suspension concentration of the Metarhizium rileyi spores is 1.0×10 6 spores / mL - 1.0×10 9 spores / mL; The mass concentration of lecithin in the composition is 0.05 - 1%.

6. The microbial composition according to claim 5, wherein The Metarhizium rileyi is Metarhizium rileyi Mr006.

7. The microbial composition according to claim 5 or 6, characterized in that, The suspension concentration of the Metarhizium rileyi spores is 1.0×10 6 spores / mL - 1.0×10 8 spores / mL; the mass concentration of lecithin in the composition is 0.05 - 0.5%.

8. Use of the microbial composition according to any one of claims 5 - 7 for controlling crop pests, characterized in that, The crop pests are Spodoptera exigua and Chilo suppressalis.

Images