T cell targeting nanoparticle based on nucleic acid aptamer as well as preparation and application of T cell targeting nanoparticle

By targeting lipid aptamer-based T cells to self-assemble nanoparticles, the stability and immune response problems of the nanodelivery system are solved, efficient and safe drug delivery is achieved, and the preparation process is simplified.

CN120249289AActive Publication Date: 2025-07-04NAJIN BIOTECHNOLOGY (TIANJIN) CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510732705.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-04
Publication Date
2025-07-04
Estimated Expiration
2045-06-04

AI Technical Summary

Technical Problem

The existing nanodelivery system materials are easily recognized by the immune system, resulting in poor immune response, poor stability, complex preparation process and high cost, making it difficult to achieve efficient and safe targeted drug delivery.

Method used

T cells based on nucleic acid aptamers are used to target lipid aptamers, and nanoparticles are formed by self-assembly of hydrophobic molecules and nucleic acid aptamers, and gene molecules are included to achieve site-directed gene reprogramming, and drug releases using chemical bonds under reducing conditions.

Benefits of technology

It improves the efficiency of targeted drug delivery, enhances the safety and economy of the nanosystem, reduces the risk of immune response, and simplifies the preparation process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249289A_ABST
    Figure CN120249289A_ABST
Patent Text Reader

Abstract

The invention relates to T cell targeting nanoparticles based on nucleic acid aptamers and a preparation method and application thereof, in particular to a T cell targeting lipid aptamer which comprises hydrophobic molecules and nucleic acid aptamers, and the nucleic acid aptamers at least comprise one nucleic acid aptamer targeting T cell surface molecules. The molar weight ratio of the hydrophobic molecule to the nucleic acid aptamer is (5000: 1)-(1: 10). The lipid aptamer provided by the invention or the nano-particles formed by the lipid aptamer through a self-assembly technology can be used for performing fixed-point gene modification on cells, so that in-vivo gene reprogramming of the cells is realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedical nanomaterials, and particularly relates to a T cell-targeted lipid aptamer based on nucleic acid aptamer, its preparation method and application. Background Art

[0002] Nanodelivery technology plays a crucial role in the development and application of nanodrugs and gene drugs. The nanodelivery system can effectively protect genes, small molecule drugs or protein drugs from degradation by various enzymes in the body, thereby prolonging the half-life of the drugs and improving their bioavailability. In addition, the nanodelivery system can achieve sustained release of drugs and maintain the effective concentration of drugs in the body; at the same time, through targeted molecule modification, the therapeutic effect of genes or drugs can be significantly improved and side effects can be reduced. However, current nanodelivery systems are usually composed of a variety of different nanomaterials, which are easily recognized as foreign substances by the body's immune system and may trigger immune responses. In addition, the stability of existing delivery systems is generally poor, and the preparation process is complex, often requiring high-precision equipment and technology, which leads to high production costs and quality control costs, and there are certain challenges in large-scale production. To solve the above problems, simplify the preparation process, reduce costs, and improve the stability of the nanosystem, while reducing the potential safety hazards that may be brought by nanomaterials, this patent provides a cell-targeted lipid nucleic acid aptamer molecule and an efficient cell-targeted nanodelivery system with a unique 3D structure formed by self-assembly of itself. This technology can improve the targeted delivery efficiency of drugs while enhancing its safety and economy. Summary of the Invention

[0003] In view of the above technical problems to be solved, the applicant provides a T cell-targeted lipid aptamer based on nucleic acid aptamer and the nanoparticles formed by its self-assembly, including a nucleic acid aptamer molecule modified with a hydrophobic molecule that can target cell surface molecules, which can form a spherical nanovesicle-like structure under specific conditions, and various types of gene molecules can also be encapsulated inside to achieve "fixed-point" gene reprogramming of immune cells. Specifically:

[0004] The technical solution of the present application provides a T cell-targeted lipid aptamer, wherein the lipid aptamer includes a hydrophobic molecule and a nucleic acid aptamer, the nucleic acid aptamer includes at least one nucleic acid aptamer that targets a T cell surface molecule, and the molar ratio of the hydrophobic molecule to the nucleic acid aptamer is 5000:1 - 1:10.

[0005] Further, the hydrophobic molecule and the nucleic acid aptamer are connected by a chemical bond.

[0006] Further preferably, the chemical bond is selected from at least one of a disulfide bond, an amide bond, a thioester bond, an ester bond, and a phosphoramide bond.

[0007] Furthermore, the aptamers targeting T cell surface molecules include single-stranded DNA (ssDNA), RNA, XNA, TNA, or their point mutants, truncations, chemically modified derivatives, or chimeric DNA-TNA oligonucleotides targeting T cell surface molecules. Optionally, the chemically modified derivatives include derivatives with chemically modified phosphodiester backbones, nucleobases, and / or glycosyl groups. Optionally, the chemical groups are selected from amino, mercapto, DBCO, carboxyl, or hydroxyl groups.

[0008] Furthermore, the aptamers targeting T cell surface molecules are selected from LD201t1, OSJ-T3, OX40, CD28Apt7, 4-1BB, CD5, CD62L, or C2NP.

[0009] Furthermore, the aptamers also include one or more aptamers that do not target T cell surface molecules. Furthermore, the aptamers that do not target T cell surface molecules are selected from aptamers targeting tumor cells, stem cells, senescent cells, other immune cell surface molecules, or aptamers targeting cell surface specific receptors.

[0010] Furthermore, the aptamers targeting other immune cell surface molecules are selected from aptamers targeting NK cell, B cell, or tumor-associated macrophage surface molecules.

[0011] More preferably, the aptamers targeting other immune cell surface molecules are selected from CD16a, NKp46, WXY3, CD206, A2, CD11b, CD56, or MerTK.

[0012] Furthermore, the aptamers targeting tumor cell surface molecules are selected from the aptamer targeting nucleolin (AS1411), the aptamer targeting human epidermal growth factor 2 HER2 (Herceptamers), the nucleic acid aptamer targeting chemokine CXCL12 (NOX-A12), the biotinylated aptamer targeting PTK7 (Sgc8c), the aptamer targeting Mucin 1 (S1.3 / S2.2), the nucleic acid aptamer targeting prostate-specific membrane antigen PSMA (A10-3.2).

[0013] Furthermore, the aptamers targeting stem cell surface molecules are selected from the aptamers HM69 and Apt19S targeting mesenchymal stem cell surface molecules, the aptamer C24S targeting tumor stem cell surface molecule CD44, the aptamer N17 targeting hematopoietic stem cell surface molecule CD34, or the aptamer AT-1 targeting bone marrow endothelial progenitor cell surface molecule CD31.

[0014] Further, the aptamers targeting surface molecules of senescent cells are selected from the aptamer apmspdβ-gal targeting L1CAM protein and the aptamer molecule targeting NKG2DL.

[0015] Further, the aptamers non-targeting T cell surface molecules can also be selected from the aptamer targeting IL-4Ra (cl.42), the aptamer targeting IL-6R (AIR-3A), the aptamer targeting transferrin receptor (GS24), the aptamer targeting vascular endothelial growth factor VEGF (PegS1.3 / S2.2nib(PEGylated)), and the aptamer targeting integrin αvβ3 (Apt-αvβ3).

[0016] Further, the hydrophobic molecule is a hydrocarbon molecule containing an amino group, a phosphate group, a hydroxyl group or a carboxyl group.

[0017] Further, the hydrophobic molecule is selected from at least one of 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), dipalmitoyl phosphatidylcholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (sodium salt) (DOPS), dipalmitoyl phosphatidylcholine (DPPC), dimyristoyl phosphatidylcholine (DMPC), hydrogenated lecithin (HSPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-distearoyl-sn-glycero-3-phosphoserine (DSPG), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (DPPE), 1,2-dilauroyl phosphatidylethanolamine (DLPE), 1,2-dipalmitoyl-sn-glycero-3-phosphatidylglycerol (DPPG), monophosphoryl lipid A (MPLA), 1,3-dilinolenin, and polycaprolactone (PCL).

[0018] Further, the T cell-targeted lipid aptamer provided in the present application further includes a long-circulation stabilizer.

[0019] Further, the long-circulation stabilizer is selected from at least one of polyethylene glycol (PEG), polyvinylpyrrolidone (PVP), and poloxamer.

[0020] Further, in the T cell-targeted lipid aptamer, the hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), and the aptamer is OSJ-T3. Preferably, the molar ratio is 1000:1 to 100:1; or

[0021] The hydrophobic molecule is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and the aptamer is LD201tl. Preferably, the molar ratio is 1000:1 to 100:1; or

[0022] The hydrophobic molecule is 1,2-dipalmitoyl-sn-glycero-3-phosphatidylglycerol (DPPG), and the aptamer is 4-1BB. Preferably, the molar ratio is 5000:1 to 3000:1; or

[0023] The hydrophobic molecule is polycaprolactone (PCL), and the aptamer is OX40. Preferably, the molar ratio is 5000:1 to 3000:1; or

[0024] The hydrophobic molecule is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), and the aptamer is CD28; or

[0025] The hydrophobic molecule is sodium dioleoyl phosphatidylserine (DOPS), and the aptamer is C2NP; or

[0026] The hydrophobic molecule is 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (DPPE), and the aptamers are OX40 and OSJ-T3; or

[0027] The hydrophobic molecule is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), the aptamer is CD28, and the long-circulating stabilizer is poloxamer.

[0028] The hydrophobic molecule is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and the aptamers are CD28 and NKG2DL;

[0029] The hydrophobic molecule is sodium dioleoyl phosphatidylserine (DOPS), the aptamers are 4-1BB and PegS1.3 / S2.2nib (PEGylated), and the long-circulating stabilizer is PEG.

[0030] This application also provides a nanoparticle constructed from the above-mentioned T cell-targeting lipid aptamer.

[0031] Furthermore, the particle size of the nanoparticle is 80 to 1000 nm, and more preferably 110 to 300 nm.

[0032] Furthermore, the nanoparticle can encapsulate a payload.

[0033] Furthermore, the payload is a therapeutic agent.

[0034] Furthermore, the therapeutic agent is selected from at least one of polynucleotide or oligonucleotide molecules, chemotherapeutic drugs, small molecule targeted drugs, immune checkpoint inhibitors, antibody-drug conjugates or hormone drugs.

[0035] Furthermore, the polynucleotide or oligonucleotide molecule is selected from mRNA, siRNA, miRNA or DNA molecules.

[0036] More preferably, the mRNA is CAR-mRNA, LYTAC mRNA or PROTAC mRNA.

[0037] Furthermore, the chemotherapeutic drug is selected from at least one of paclitaxel, doxorubicin, capecitabine and gemcitabine.

[0038] Furthermore, the small molecule targeted drug is selected from at least one of brigatinib, HER2 inhibitor (lapatinib), BCR-ABL inhibitor (imatinib), EGFR-TKI inhibitor (osimertinib) and EGFR inhibitor (cetuximab).

[0039] Furthermore, the immune checkpoint inhibitor is selected from at least one of PD-1 / PD-L1 inhibitors, CTLA-4 inhibitors, LAG-3 inhibitors, TIM-3 inhibitors and TIGIT inhibitors.

[0040] Furthermore, the antibody-drug conjugate is selected from conjugates of an antibody with at least one of maytansine, Auristatin derivatives, Anetumab Ravtansine and auristatin.

[0041] Furthermore, the hormone drug is an agonist or inhibitor of a hormone.

[0042] Furthermore, the hormone drug includes at least one of the selective estrogen receptor modulator tamoxifen, the aromatase inhibitor anastrozole, the gonadotropin-releasing hormone analogue leuprolide, the antiandrogen drug bicalutamide and the estrogen receptor downregulator fulvestrant.

[0043] Furthermore, in the nanoparticle, the hydrophobic molecule is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), the aptamer is LD201t1, and the therapeutic agent is mRNA; or

[0044] the hydrophobic molecule is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), the aptamer is LD201t1, and the therapeutic agent is FAP CAR mRNA; or

[0045] The hydrophobic molecule is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), the aptamer is LD201t1, and the therapeutic agent is NKG2DL CAR mRNA; or

[0046] The hydrophobic molecule is dipalmitoylphosphatidylcholine (DPPC), the aptamer is 4-1BB, and the therapeutic agent is mRNA; or

[0047] The hydrophobic molecule is polycaprolactone (PCL), the aptamer is OX40, and the therapeutic agent is siRNA; or

[0048] The hydrophobic molecule is 1,2-distearoyl-sn-glycero-3-phosphoserine (DSPG), the aptamer is CD28, and the therapeutic agent is plasmid DNA; or

[0049] The hydrophobic molecule is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), the aptamer is OSJ-T3, and the therapeutic agent is CD19 CAR mRNA.

[0050] The technical solution of the present application further provides a preparation method of the above-mentioned T cell-targeted lipid aptamer or nanoparticle, which includes the following steps:

[0051] React the hydrophobic molecule with a crosslinking agent and / or a catalyst to obtain a first product;

[0052] React the first product with an aptamer molecule to obtain a lipid aptamer, and the aptamer includes at least one aptamer targeting a T cell surface molecule.

[0053] Furthermore, the preparation method further includes: encapsulating the lipid aptamer with at least one payload.

[0054] Furthermore, the mass ratio of the hydrophobic molecule to the crosslinking agent and / or the catalyst is 10 - 0.1:1.

[0055] Furthermore, the molar ratio of the reaction of the hydrophobic molecule and the aptamer molecule is ≥1:10.

[0056] Furthermore, in the step of reacting the hydrophobic molecule with a crosslinking agent and / or a catalyst to obtain a first product, the reaction temperature is 20 - 30 °C and the reaction time is 1.5 - 3 hours.

[0057] Furthermore, in the step of reacting the first product with an aptamer molecule to obtain a lipid aptamer, the reaction temperature is 0 - 30 °C and the reaction time is 18 - 24 hours.

[0058] Furthermore, in the step of encapsulating the lipid aptamer and at least one loading substance, the reaction temperature is 20-30° C. and the reaction time is 0.5-4 hours.

[0059] Furthermore, the T cell targeting lipid aptamer or nanoparticle provided in the present application is prepared by the above-mentioned preparation method.

[0060] The technical solution of the present application also provides the use of the above-mentioned T cell-targeted lipid aptamers or nanoparticles in the preparation of nanomedicines for disease treatment.

[0061] Furthermore, the disease is tissue fibrosis, anti-aging, autoimmune disease, or tumor disease.

[0062] Further preferably, the tumor diseases include gastric cancer, pancreatic cancer, prostate cancer, lung cancer, ovarian cancer, nasopharyngeal carcinoma, breast cancer, lymphoma and leukemia.

[0063] Furthermore, the drug is a nano drug or a nano vaccine.

[0064] Advantages of the Invention

[0065] The technical solution provided in this application relates to the preparation and use of a T cell targeting lipid aptamer, which is prepared by modifying a nucleic acid aptamer with a hydrophobic molecule, and the nucleic acid aptamer has T cell targeting properties. The lipid aptamer itself or with other hydrophobic molecules can be constructed into spherical nucleic acid aptamer nanoparticles with a unique 3D structure through molecular self-assembly technology, which can be modified according to different application scenarios, supplemented with an appropriate amount of long-circulation stabilizer to make a long-circulation nanodrug or use a bispecific nucleic acid aptamer to prepare a dual-targeted spherical nucleotide nanoparticle.

[0066] Among them, hydrophobic molecules and nucleic acid aptamers targeting T cells can be self-assembled to form nanoparticles, which can be directly used for targeted killing of T cell-mediated diseases. They can also be prepared into spherical nanovesicles and encapsulate various types of mRNA, siRNA, DNA and other gene molecules. After intravenous injection into the body, the nanopreparation can specifically target the target cells, break the chemical bonds under reducing conditions in the cells to release mRNA, siRNA or DNA, and can "fix" the genes of the cells to achieve in vivo gene reprogramming of the cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 This is a transmission electron microscopy image of DOPE-LD201t1 nanoparticles in the examples of this application.

[0068] Figure 2Schematic diagram of the cytotoxicity of DOPE-LD201t1-encapsulated mRNA nanoparticles on HUVEC cells in the embodiments of the present application.

[0069] Figure 3 Schematic diagram of the uptake of DOPE-LD201t-encapsulated mRNA nanoparticles on T cells in the embodiments of the present application.

[0070] Figure 4 Schematic diagram of the in vivo biodistribution of DOPE-LD201t1 nanoparticles in the embodiments of the present application.

[0071] Figure 5 Schematic diagram of the effect of DOPE-LD201t1-encapsulated mRNA nanoparticles on the body weight of idiopathic pulmonary fibrosis mice in the embodiments of the present application.

[0072] Figure 6 Particle size distribution diagram of DOPE-LD201t1-encapsulated FAP CARmRNA nanoparticles in the embodiments of the present application.

[0073] Figure 7 Schematic diagram of the particle size stability of DOPE-LD201t1-encapsulated FAP CAR mRNA nanoparticles in the embodiments of the present application.

[0074] Figure 8 In the embodiments of the present application, DPPC-4-1BB nanoparticles encapsulate mRNA EGFP Schematic diagram of the expression of fluorescent protein EGFP.

[0075] Figure 9 Schematic diagram of the encapsulation efficiency of PCL-OX40-encapsulated siRNA in the embodiments of the present application.

[0076] Figure 10 Schematic diagram of the particle size distribution of DSPG-CD28-encapsulated plasmid DNA nanoparticles in the embodiments of the present application.

[0077] Figure 11 Schematic diagram of the effect of DOPS-C2NP nanoparticles on the survival period of T lymphoma mice in the embodiments of the present application.

[0078] Figure 12 Agarose gel electrophoresis diagram of DOPE-OSJ-T3 lipid aptamer molecules in the embodiments of the present application.

[0079] Figure 13 Schematic diagram of the killing effect of DOPE-OSJ-T3-encapsulated CD19 CAR mRNA nanoparticles on tumor cells in vitro in the embodiments of the present application.

[0080] Figure 14 Schematic diagram of the particle size distribution of DSPC-CD28 / poloxamer nanoparticles in the embodiments of the present application.

[0081] Figure 15 Schematic diagram of the particle size distribution of DPPE -OX40-OSJ-T3 nanoparticles in the embodiments of the present application.

[0082] Figure 16 Schematic diagram of the effect of DOPE-LD201tl-loaded NKG2DL CAR mRNA nanoparticles on the plasma glucose level of senescent mice in the embodiments of the present application. Detailed implementation manners

[0083] The following elaborates and illustrates the implementation manners of the present invention through specific examples. However, the following content should not be construed as any limitation to the present invention. The technical terms mentioned in this specification have the same meanings as those commonly understood by those skilled in the art. In case of conflict, the definitions in this specification shall prevail. Under the inspiration of this application, those of ordinary skill in the art can also make many forms without departing from the purpose of the present invention and the scope protected by the claims. These all fall within the protection scope of the present invention.

[0084] Secondly, the so-called "embodiment" or "specific implementation manner" hereinafter refers to specific features, structures or characteristics that can be included in at least one implementation manner of this application. The phrase "in one embodiment" appearing in different places in this specification does not necessarily refer to the same embodiment, nor is it an independent or alternative embodiment that is mutually exclusive with other embodiments. The subsequent description in the specification is a preferred implementation manner for implementing this application. However, the description is for the purpose of the general principles of the specification and is not used to limit the scope of this application. The protection scope of this application shall be determined by what is defined in the appended claims.

[0085] This application relates to a T cell-targeted lipid aptamer, which includes a hydrophobic molecule and a nucleic acid aptamer, and the nucleic acid aptamer includes at least one nucleic acid aptamer targeting a T cell surface molecule.

[0086] In the implementation manner of this application, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer in the T cell-targeted lipid aptamer is 5000:1 - 1:10.

[0087] In some specific implementation manners, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer can be 5000:1, 4500:1, 4000:1, 3500:1, 3000:1, 2500:1, 2000:1, 1500:1, 1000:1, 500:1, 250:1, 100:1, 1:1, 1:2, 1:4, 1:8, 1:10.

[0088] In a specific embodiment, the hydrophobic molecule and the nucleic acid aptamer are connected by a chemical bond.

[0089] In some specific embodiments, the chemical bond is selected from at least one of a disulfide bond, an amide bond, a thioester bond, an ester bond, and a phosphoamide bond.

[0090] The hydrophobic molecule in the present application refers to a molecule that has a mutually repulsive property with water molecules and is generally non-polar. In a specific embodiment, the hydrophobic molecule is a molecule containing an amino group, a phosphate group, a hydroxyl group, or a carboxyl group.

[0091] In some specific embodiments, the hydrophobic molecule is selected from at least one of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), dipalmitoylphosphatidylcholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (sodium salt) (DOPS), dipalmitoylphosphatidylcholine (DPPC), dimyristoylphosphatidylcholine (DMPC), hydrogenated lecithin (HSPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-distearoyl-sn-glycero-3-phosphoserine (DSPG), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (DPPE), 1,2-dilauroylphosphatidylethanolamine (DLPE), 1,2-dipalmitoyl-sn-glycero-3-phosphatidylglycerol (DPPG), monophosphoryl lipid A (MPLA), 1,3-dilinolenin, and polycaprolactone (PCL).

[0092] The term "nucleic acid aptamer" in the present application encompasses single-stranded DNA (ssDNA), RNA, or synthetic DNA analogs (such as xeno-nucleic acid (XNA) aptamers, threose nucleic acid (TNA) aptamers) screened from a randomly synthesized oligonucleotide sequence library in vitro by the systematic evolution of ligands by exponential enrichment (SELEX), as well as their derivatives, such as their site-directed mutants, truncated forms, and chemically modified nucleic acid derivatives.

[0093] In 1990, Ellington and Tuerk published their research results in Nature and Science respectively and named the nucleic acid aptamer. Since then, researchers have continuously discovered new aptamers. So far, more than 2,000 aptamers have been reported. Aptamers are also known as "chemical antibodies". They can specifically bind to target molecules (metal ions, drugs, small organic compounds, metabolites, proteins, viruses, bacteria, living cells, etc.) by forming secondary and / or tertiary structures. At the same time, compared with antibodies, aptamers have the advantages of being easy to prepare, label and modify, good stability, and low price.

[0094] The screening and optimization of nucleic acid aptamers. The screening technology of aptamers is called SELEX. The process of classical SELEX usually includes library construction and synthesis (usually the library capacity is between 10 10 to 10 15 ), binding to the target ligand, washing the unbound nucleic acid, eluting the bound nucleic acid, and amplifying the target library. The whole screening process needs to be repeated for multiple rounds. After several cycles, aptamers with high affinity and high specificity for the target ligand are finally obtained. Many new SELEX technologies have been developed, including changing the binding conditions and screening platforms, target types, library designs, and immobilization matrices, such as graphene oxide (GO)-SELEX, capillary electrophoresis (CE)-SELEX, cell-SELEX, Photo-SELEX, and fluorescence-activated cell sorting-SELEX. The aptamers obtained by screening can form the following common structures: 1. Stem-loop structure (a complementary base sequence forms the stem, and the single-stranded regions at both ends of the stem form the loop); 2. Hairpin structure (complementary base pairing forms the stem, and the single-stranded region forms the loop of the hairpin); 3. G-quadruplex structure (multiple guanine bases form a planar tetramer through hydrogen bonds). These secondary structures can undergo conformational matching and multiple non-covalent interactions (hydrogen bonds, van der Waals forces, electrostatic interactions, etc.) with specific parts of the receptor to achieve specific binding. When the length of the screened aptamer is long or the affinity / specificity is not strong, a series of methods can also be considered to optimize the aptamer. Commonly used means include truncation (retaining important stem-loop structures), site-directed mutagenesis, chemical modification (such as 2'-O-methyl can improve the affinity of the aptamer), and multivalent aptamers.

[0095] XNA is an artificially synthesized genetic polymer, usually obtained by modifying the sugar moiety to achieve enhanced biological stability, rich chemical diversity, and additional functions. Multiple types of XNA have been synthesized, capable of storing, retrieving, and encoding information, and exchanging information with natural nucleic acids. Threose nucleic acid (also known as trifuorouridyl nucleic acid, TNA) is a special type of XNA, which is considered a potential primordial genetic polymer due to the simplicity of its chemical structure and has excellent biological stability.

[0096] It has been reported that various modified nucleic acids and artificial nucleic acid polymers constructed entirely from unnatural building blocks have emerged, including modifications to the phosphodiester backbone, sugar moiety, and nucleobase. These modifications affect the biological stability, chemical diversity, immunogenicity of nucleic acids, and their ability to hybridize with complementary DNA and RNA. Notably, the increased nuclease stability and the diversity of nucleobase chemical composition are crucial for the selection and evolution of nuclease-resistant and high-affinity aptamers as diagnostic and therapeutic tools.

[0097] Among the glycosyl-modified nucleic acids, TNA has been extensively studied, with particular attention paid to additional modifications to its structure, including alterations to the phosphodiester backbone or nucleobase. TNA was first proposed by Eschenmoser as an ancestor of RNA. TNA has a 4-carbon threose and a 3'-2' linked phosphodiester backbone, and has higher biological stability than DNA and RNA under simulated physiological conditions. Despite the obvious structural differences from DNA and RNA, TNA can still form stable antiparallel Watson-Crick double strands with classical nucleic acids.

[0098] In the embodiments of the present application, the nucleic acid aptamers targeting T cell surface molecules include single-stranded DNA (ssDNA), RNA, XNA, TNA, or their point mutants, truncations, chemically modified derivatives, or chimeric DNA-TNA oligonucleotides targeting T cell surface molecules. In some specific embodiments, the chemically modified derivatives include derivatives in which the phosphodiester backbone, nucleobase, and / or sugar moiety are modified with chemical groups, optionally, the chemical groups are selected from amino, mercapto, DBCO, carboxyl, or hydroxyl.

[0099] In a specific embodiment, the nucleic acid aptamers targeting T cell surface molecules can be selected from LD201t1, OSJ-T3, OX40, CD28Apt7, 4-1BB, CD5, CD62L, or C2NP.

[0100] In the present application, the nucleotide sequences of some nucleic acid aptamers targeting T cell surface molecules are respectively:

[0101] 1) LD201t1 (SEQ ID NO.1): TAGCCAAGGTAACCAGTACAAGGTGCTAAACGTAATGGCTTCGGCTTAC;

[0102] 2) OSJ-T3 (SEQ ID NO.2): GCCGCGGGGTGGGTCTAGTGTGGATGTTTAGGGGGCGGC;

[0103] 3) OX40 (SEQ ID NO.3): GGGATGCGGAAAAAAGAACACTTCCGATTAGGGCCCACCCTAACGGCCGCAGAC;

[0104] 4) CD28 (SEQ ID NO.4): GATTAGACCATAGGCTCCCAACCCCTCTGAGGTGCTCCTGCTTTGGAACTCAAGACCGTTATGTCGTGTGTACTT;

[0105] 5) 4-1BB (SEQ ID NO.5): GGGAGAGAGGAAGAGGGATGGGCGACCGAACGTGCCCTTCAAAGCCGTTCACTAACCAGTGGCATAACCCAGAGGTCGATAGTACTGGTACCCCCC.

[0106] In some embodiments of the present application, the hydrophobic molecule and the nucleic acid aptamer targeting the T cell surface molecule form a lipid aptamer nanoparticle preparation with a unique 3D structure through molecular self-assembly technology under specific conditions, which can directly kill immune cells mediating diseases, and can achieve precise targeted killing for related diseases such as T cell lymphoma, effectively solving problems such as chemotherapy drug resistance.

[0107] In other embodiments of the present application, the T cell-targeted lipid aptamer nanoparticle is composed of two hydrophobically modified nucleic acid aptamer molecules through self-assembly to form a 3D spherical lipid aptamer nanoparticle structure. In some specific embodiments, both of the two nucleic acid aptamers can be nucleic acid aptamers targeting the T cell surface molecule. In other specific embodiments, one of the nucleic acid aptamers is a nucleic acid aptamer targeting the T cell surface molecule, and the other is a nucleic acid aptamer not targeting the T cell surface molecule.

[0108] In a specific embodiment, the nucleic acid aptamer not targeting the T cell surface molecule can be selected from at least one of nucleic acid aptamers targeting tumor cells, stem cells, senescent cells, other immune cell surface molecules or nucleic acid aptamers targeting cell surface specific receptors.

[0109] In a specific embodiment, the other immune cells may include immune cells such as NK cells, B cells, or tumor-associated macrophages other than T cells.

[0110] In some specific embodiments, the NK cell surface molecules may be CD16, NKp46, or CD56.

[0111] In some specific embodiments, the tumor-associated macrophage surface molecules may be WXY3, CD206, CD11b, MerTK, or A2.

[0112] In a specific embodiment, the nucleic acid aptamers targeting tumor cell surface molecules may be selected from aptamers targeting nucleolin (AS1411), aptamers targeting human epidermal growth factor 2 HER2 (Herceptamers), nucleic acid aptamers targeting chemokine CXCL12 (NOX-A12), biotinylated aptamers targeting PTK7 (Sgc8c), and aptamers targeting Mucin1 (S1.3 / S2.2), nucleic acid aptamers targeting prostate-specific membrane antigen PSMA (A10-3.2), or one or more of them.

[0113] In a specific embodiment, the nucleic acid aptamers targeting stem cell surface molecules may be selected from nucleic acid aptamers HM69 and Apt19S targeting mesenchymal stem cell surface molecules, nucleic acid aptamer C24S targeting tumor stem cell surface molecule CD44, nucleic acid aptamer N17 targeting hematopoietic stem cell surface molecule CD34, nucleic acid aptamer AT-1 targeting bone marrow endothelial progenitor cell surface molecule CD31, or the like.

[0114] In a specific embodiment, the nucleic acid aptamers targeting senescent cell surface molecules may be selected from nucleic acid aptamer apmspdβ-gal targeting L1CAM protein and nucleic acid aptamer molecules targeting NKG2DL.

[0115] In the above embodiments, the lipid aptamer nanoparticles have precise killing ability, and after entering the body, they recruit immune cells to kill tumor cells / stem cells, enhancing the anti-tumor effect.

[0116] In the embodiments of the present application, the nucleic acid aptamers that do not target T cell surface molecules may also be selected from nucleic acid aptamers targeting cell surface specific receptors. In a specific embodiment, the nucleic acid aptamers targeting cell surface specific receptors may be selected from nucleic acid aptamer (cl.42) targeting IL-4Ra, nucleic acid aptamer (AIR-3A) targeting IL-6R, and nucleic acid aptamer (GS24) targeting transferrin receptor, or one of them.

[0117] In a specific embodiment, the aptamer of the non-targeted T cell surface molecule can also be selected from aptamers targeting specific cell surface targets, such as aptamer targeting prostate specific membrane antigen PSMA (A10-3.2), aptamer targeting vascular endothelial growth factor VEGF (PegS1.3 / S2.2nib (PEGylated)), and aptamer targeting integrin αvβ3 (Apt-αvβ3), etc., one or more of them.

[0118] In the above embodiment, the aptamer can target a certain target of the cell or different targets of the same cell, and the nanodelivery system can enhance the delivery efficiency of specific cells.

[0119] In some specific embodiments, the T cell-targeted lipid aptamer nanoparticle is a degradable nanoparticle, which can mediate the degradation of cell surface membrane proteins through the endocytosis-lysosome pathway after entering the body.

[0120] In another embodiment of the present application, the cell-targeted lipid aptamer nanoparticle is self-assembled by two parts: a hydrophobic molecule-modified aptamer and a long-circulating stabilizer. The nanoparticle can achieve long circulation of the drug in the blood and extend the half-life while having targeted delivery or killing ability.

[0121] In the embodiment of the present application, the long-circulating stabilizer can be selected from one of polyethylene glycol (PEG), polyvinylpyrrolidone (PVP), poloxamer, etc.

[0122] The present application also provides a nanoparticle constructed by the T cell-targeted lipid aptamer.

[0123] In the present application, the particle size of the nanoparticle can be 80-1000 nm. For example, it can be 80 nm, 90 nm, 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, 200 nm, 220nm, 250nm, 280nm, 300nm, 500nm, 600nm, 800nm, 1000nm, etc.

[0124] In a specific embodiment, the cell-targeted lipid aptamer constructs the nanoparticle through a self-assembly technique.

[0125] In some specific embodiments of the present application, the nanoparticle constructed by the cell-targeted lipid aptamer encapsulates a payload.

[0126] In some specific embodiments, the hydrophobic molecule and the nucleic acid aptamer form spherical nanovesicles or lipid aptamer nanoparticles with a unique 3D structure through self-assembly technology.

[0127] In some specific embodiments of the present application, the payload of the nanoparticles is a therapeutic agent.

[0128] In some specific embodiments, the therapeutic agent is selected from at least one of polynucleotide or oligonucleotide molecules, chemotherapeutic drugs, small molecule targeted drugs, immune checkpoint inhibitors, antibody-drug conjugates or hormone drugs.

[0129] In some specific embodiments, the hydrophobic molecule and the nucleic acid aptamer are connected by a disulfide bond, and the chemical bond can be broken when encountering a reducing microenvironment after being taken up by target cells, releasing the payload.

[0130] In some specific embodiments, the hydrophobic molecule and the nucleic acid aptamer targeting the surface molecule of immune cells form a spherical nanovesicle-like structure through molecular self-assembly technology under specific conditions, and one or more polynucleotide or oligonucleotide molecules are encapsulated therein, which can achieve "site-specific" gene reprogramming of immune cells. In a specific embodiment, various types of mRNA (such as CAR-mRNA), siRNA or DNA and other gene molecules can be encapsulated inside the cell-targeted nanoparticles.

[0131] In some specific embodiments, the hydrophobic molecule and the nucleic acid aptamer form a spherical vesicle-like nanostructure. One or more therapeutic agents such as various types of chemotherapeutic drugs, small molecule targeted drugs, immune checkpoint inhibitors, antibody-drug conjugates or hormone drugs can be encapsulated inside the nanoparticles.

[0132] In some specific embodiments, the hydrophobic molecule and the nucleic acid aptamer form a spherical nanovesicle-like structure through molecular self-assembly technology under specific conditions, and one or more of mRNA (such as PROTAC mRNA), siRNA, miRNA or chemotherapeutic drugs are encapsulated therein.

[0133] In the embodiments of the present application, the chemotherapeutic drugs may be selected from paclitaxel, doxorubicin, capecitabine, gemcitabine, etc.; the small molecule targeted drugs may be selected from brigatinib, HER2 inhibitor (lapatinib), BCR-ABL inhibitor (imatinib), EGFR-TKI inhibitor (osimertinib), EGFR inhibitor (cetuximab), etc.; the immune checkpoint inhibitors may be selected from PD-1 / PD-L1 inhibitors, CTLA-4 inhibitors, LAG-3 inhibitors, TIM-3 inhibitors, TIGIT inhibitors, etc.; the antibody-drug conjugates may be selected from maytansine, Auristatin derivatives, Anetumab Ravtansine, auristatin, etc.; the hormonal drugs may be selected from selective estrogen receptor modulator tamoxifen, aromatase inhibitor anastrozole, gonadotropin-releasing hormone analogue leuprolide, antiandrogen bicalutamide, estrogen receptor downregulator fulvestrant, etc.

[0134] The molecular self-assembly technology described in the present application refers to a method of spontaneously forming an ordered structure through intermolecular interactions (such as hydrophobic-hydrophilic interactions, hydrogen bonds, van der Waals forces, etc.).

[0135] In specific embodiments, the self-assembly technology can be implemented by methods such as microfluidic devices, ultrasound method, stirring method, copolymer self-assembly, etc.

[0136] In some specific embodiments, molecular self-assembly is achieved through a microfluidic device. For example, in a specific embodiment of the present application:

[0137] A hydrophobic molecule DOPE and a nucleic acid aptamer molecule LD201t1 are connected through a disulfide bond to obtain a DOPE-LD201t1 lipid aptamer molecule, and then the DOPE-LD201t1 lipid aptamer and the payload FAPCAR mRNA are self-assembled through a microfluidic device to obtain nanoparticles with DOPE-LD201t1 encapsulating FAP CAR mRNA.

[0138] In some specific embodiments, molecular self-assembly is achieved through the ultrasound method. For example, in a specific embodiment of the present application:

[0139] A hydrophobic molecule PCL and a nucleic acid aptamer molecule OX40 are made into a PCL-OX40 lipid aptamer molecule by click reaction, and then the PCL-OX40 lipid aptamer and the payload siRNA are self-assembled through the ultrasound method to obtain nanoparticles with PCL-OX40 encapsulating siRNA.

[0140] In some specific embodiments, molecular self-assembly is achieved through the stirring method. For example, in a specific embodiment of the present application:

[0141] The hydrophobic molecule DOPS and the nucleic acid aptamer C2NP are linked by an amide bond to obtain the DOPS-C2NP lipid aptamer molecule, and then the DOPS-C2NP nanoparticles are self-assembled by the stirring method.

[0142] In some specific embodiments, molecular self-assembly is achieved by the copolymer self-assembly method. For example, in a specific embodiment of the present application:

[0143] The hydrophobic molecule DOPS and the hydrophilic nucleic acid aptamer molecules 4-1BB and PegS1.3 / S2.2nib (PEGylated) are linked by an amide bond to obtain the DOPS-4-1BB and DOPS-PegS1.3 / S2.2nib (PEGylated) lipid aptamer molecules. Then, the hydrophilic DOPS-4-1BB and DOPS-PegS1.3 / S2.2nib (PEGylated) lipid aptamer molecules are self-assembled with the lipophilic hydrophobic molecule PEG by copolymer to obtain the DOPS-4-1BB / DOPS-PegS1.3 / S2.2nib (PEGylated) / PEG long-circulating dual-target lipid aptamer nanoparticles.

[0144] The following are some specific T cell-targeted lipid aptamers provided by the present application or nanoparticles constructed from T cell-targeted lipid aptamers:

[0145] In a T cell-targeted lipid aptamer provided by the present application, the hydrophobic molecule is selected from 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and the nucleic acid aptamer is selected from the aptamer OSJ-T3 targeting T cell surface molecules. In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer in the reaction is 1000:1 to 100:1.

[0146] In a T cell-targeted lipid aptamer provided by the present application, the hydrophobic molecule is selected from 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and the nucleic acid aptamer is selected from LD201tl. In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer in the reaction is 1000:1 to 100:1.

[0147] In a T cell-targeted lipid aptamer provided by the present application, the hydrophobic molecule is selected from 1,2-dipalmitoyl-sn-glycero-3-phosphatidylglycerol (DPPG), and the nucleic acid aptamer is selected from 4-1BB. In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer in the reaction is 5000:1 to 3000:1.

[0148] In a T cell-targeted lipid aptamer provided by the present application, the hydrophobic molecule is selected from polycaprolactone (PCL), and the nucleic acid aptamer is selected from OX40. In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer in the reaction is 5000:1 to 3000:1.

[0149] In a T cell-targeted lipid aptamer provided by the present application, the hydrophobic molecule is selected from distearoyl phosphatidylcholine (DSPC), and the nucleic acid aptamer is selected from the aptamer CD28 targeting T cell surface molecules. In a preferred embodiment, the lipid aptamer further includes the long-circulating stabilizer poloxamer. In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer in the reaction is 5000:1 to 1:10.

[0150] In a T cell-targeted lipid aptamer provided by the present application, the hydrophobic molecule is selected from sodium dioleoyl phosphatidylserine (DOPS), and the nucleic acid aptamer is selected from C2NP.

[0151] In a T cell-targeted lipid aptamer provided by the present application, the hydrophobic molecule is selected from sodium dioleoyl phosphatidylserine (DOPS). One of the nucleic acid aptamers is the aptamer 4-1BB of T cell surface molecules, and the other is the nucleic acid aptamer PegS1.3 / S2.2nib (PEGylated) targeting vascular endothelial growth factor VEGF. The long-circulating stabilizer is selected from PEG. In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer in the reaction is 5000:1 to 1:10.

[0152] In a T cell-targeted lipid aptamer provided by the present application, the hydrophobic molecule is selected from 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (DPPE), and the nucleic acid aptamers are the aptamer OX40 and OSJ-T3 (bispecific aptamer targeting the same immune cell) of T cell surface molecules. In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer in the reaction is 5000:1 to 1:10.

[0153] In a T cell-targeted lipid aptamer provided by the present application, the hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), and the nucleic acid aptamers are CD28 and NKG2DL (one nucleic acid aptamer targeting immune cells and the other targeting senescent cells). In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer in the reaction is 5000:1 to 1:10.

[0154] In a kind of nanoparticle provided by the present application, the hydrophobic molecule is selected from 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), the nucleic acid aptamer is selected from the aptamer LD201t1 targeting T cell surface molecules, and the therapeutic agent mRNA is encapsulated inside.

[0155] In a kind of nanoparticle provided by the present application, the hydrophobic molecule is selected from 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), the nucleic acid aptamer is selected from the aptamer LD201t1 targeting T cell surface molecules, and the FAP CAR mRNA related to idiopathic pulmonary fibrosis is encapsulated inside. In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer in the reaction is 3000:1 to 100:1. In some preferred embodiments, the mass ratio of DOPE-LD201t1 lipid aptamer to mRNA is 4:1, 2:1, 1:1, 1:2 or 1:4.

[0156] In a kind of nanoparticle provided by the present application, the hydrophobic molecule is selected from dipalmitoylphosphatidylcholine (DPPC), the nucleic acid aptamer is selected from 4-1BB, and the therapeutic agent mRNA is encapsulated inside.

[0157] In a kind of nanoparticle provided by the present application, the hydrophobic molecule is selected from polycaprolactone (PCL), the nucleic acid aptamer is selected from OX40, and siRNA is encapsulated inside.

[0158] In a kind of nanoparticle provided by the present application, the hydrophobic molecule is selected from 1,2-distearoyl-sn-glycero-3-phosphoserine (DSPG), the nucleic acid aptamer is selected from CD28, and the therapeutic agent plasmid DNA is encapsulated inside.

[0159] In a kind of nanoparticle provided by the present application, the hydrophobic molecule is selected from 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), the nucleic acid aptamer is selected from OSJ-T3, and the therapeutic agent CD19 CAR mRNA is encapsulated inside.

[0160] In a kind of nanoparticle provided by the present application, the hydrophobic molecule is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), the nucleic acid aptamer is LD201t1, and the therapeutic agent is NKG2DL CAR mRNA.

[0161] The present application also provides a preparation method of the T cell-targeted lipid aptamer or nanoparticle, which specifically includes the following steps:

[0162] React the hydrophobic molecule with a crosslinking agent and / or a catalyst to obtain a first product;

[0163] React the first product with a nucleic acid aptamer molecule to obtain a lipid aptamer, wherein the nucleic acid aptamer comprises at least one nucleic acid aptamer targeting a T cell surface molecule.

[0164] In a specific embodiment, the preparation method further comprises the following steps:

[0165] Encapsulate the lipid aptamer with at least one payload.

[0166] In a specific embodiment, the payload is selected from gene molecules, chemotherapeutic drugs, small molecule targeting drugs, immune checkpoint inhibitors, antibody-drug conjugates, and hormone drugs.

[0167] In some specific embodiments, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer in the reaction can be ≥1:10, for example, it can be 5000:1, 4000:1, 3000:1, 2000:1, 1000:1, 500:1, 250:1, 100:1, 1:1, 1:2, 1:4, 1:8, 1:10.

[0168] In some specific embodiments, the mass ratio of the hydrophobic molecule to the crosslinking agent and / or catalyst is 10 - 0.1:1.

[0169] In some specific embodiments, the crosslinking agent is selected from one or more of N-succinimidyl-3-(2-pyridyldithio)-propionate (SPDP), N,N′-carbonyldiimidazole (CDI).

[0170] In some specific embodiments, the catalyst is selected from one or more of triethylamine (TEA), sodium azide (NaN3).

[0171] In some specific embodiments, the first product reacts with at least one nucleic acid aptamer molecule in a reaction buffer to obtain the lipid aptamer.

[0172] In some specific embodiments, the reaction buffer comprises one or more of CH2Cl2, DMSO, DMF, thionyl chloride, absolute ethanol, and 0.1 M HEPES buffer, etc.

[0173] In a specific embodiment, the preparation method described in this application comprises the following steps:

[0174] 1-a. React a hydrophobic molecule (containing an amino group) with a crosslinking agent (SPDP) and a catalyst (TEA) to obtain a first product.

[0175] 1-b. React the first product obtained in the previous step with a thiol-modified nucleic acid aptamer molecule to obtain a lipid aptamer.

[0176] 1-c. Encapsulate the above-mentioned lipid aptamer with one or more of various types of mRNA, siRNA, or plasmid DNA.

[0177] In a specific embodiment, step 1-a is carried out with stirring at 20°C to 30°C, and the reaction time is 1.5 hours to 3 hours; step 1-b is carried out with stirring at 20°C to 30°C, and the reaction time is 18 hours to 24 hours; step 1-c is carried out with stirring at 20°C to 30°C, and the reaction time is 0.5 hours to 2 hours.

[0178] In a specific embodiment, the preparation method described in this application includes the following steps:

[0179] 2-a. React a hydrophobic molecule (containing a phosphate group) with thionyl chloride to obtain a first product.

[0180] 2-b. React the first product obtained in the previous step with an amino-modified nucleic acid aptamer molecule to obtain a lipid aptamer.

[0181] 2-c. Encapsulate the above-mentioned lipid aptamer with one or more of various types of mRNA, siRNA, or plasmid DNA.

[0182] In a specific embodiment, step 2-a is carried out with stirring at 20°C to 30°C, and the reaction time is 1.5 hours to 3 hours; step 2-b is carried out with stirring at 0°C to 4°C, and the reaction time is 18 hours to 24 hours. Step 2-c is carried out with stirring at 20°C to 30°C, and the reaction time is 0.5 hours to 2 hours.

[0183] In a specific embodiment, the preparation method described in this application includes the following steps:

[0184] 3-a. React a hydrophobic molecule (containing a hydroxyl group) with a cross-linking agent (CDI) to obtain a first product.

[0185] 3-b. React the first product obtained in the previous step with an amino-modified nucleic acid aptamer molecule to obtain a lipid aptamer.

[0186] 3-c. Encapsulate the above-mentioned lipid aptamer with one or more of various types of mRNA, siRNA, or plasmid DNA.

[0187] In a specific embodiment, step 3-a is carried out with stirring at 20°C to 30°C, and the reaction time is 1.5 hours to 3 hours; step 3-b is carried out with stirring at 20 °C to 30 °C, and the reaction time is 10 hours to 12 hours; step 3-c is carried out with stirring at 20°C to 30°C, and the reaction time is 0.5 hours to 2 hours.

[0188] In a specific embodiment, the preparation method of the present application comprises the following steps:

[0189] 4-a. React a hydrophobic molecule (containing a carbonyl group) with p-toluenesulfonyl chloride (PTSC) to obtain a first product.

[0190] 4-b. React the first product obtained in the previous step with a catalyst sodium azide (NaN3) to obtain a second product.

[0191] 4-c. React the second product obtained above with a DBCO-modified nucleic acid aptamer molecule to obtain a lipid aptamer.

[0192] In a specific embodiment, the above step 4-a is carried out with stirring at 20 °C to 30 °C, and the reaction time is 4 hours to 6 hours; step 4-b is carried out with stirring at 20 °C to 30 °C, and the reaction time is 4 hours to 6 hours; step 4-c is carried out with stirring at 20 °C to 30 °C, and the reaction time is 2 hours to 4 hours.

[0193] In a specific embodiment, the preparation method of the present application comprises the following steps:

[0194] 5-a. React a hydrophobic molecule (containing a carboxyl group) with an activator EDC and N-hydroxysulfosuccinimide (Sulfo-NHS) to obtain a first product.

[0195] 5-b. React the first product obtained in the previous step with a nucleic acid aptamer modified with a primary amino group to obtain a lipid aptamer.

[0196] 5-c. React the first product obtained in the previous step with a nucleic acid aptamer modified with a thiol group to obtain a lipid aptamer.

[0197] In a specific embodiment, the above step 5-a is carried out with stirring at 20 °C to 30 °C, and the reaction time is 4 hours to 12 hours; step 5-b is carried out with stirring at 20 °C to 30 °C, and the reaction time is 18 hours to 24 hours; step 5-b is carried out with stirring at 20 °C to 30 °C, and the reaction time is 18 hours to 24 hours.

[0198] In a specific embodiment, the preparation method of the present application comprises the following steps:

[0199] 6-a. React a hydrophobic molecule (containing an amino group) with a crosslinking agent (SPDP) and a basic catalyst (TEA) to obtain a first product.

[0200] 6-b. React the first product obtained in the previous step with a nucleic acid aptamer molecule modified with a thiol group to obtain a lipid aptamer.

[0201] In a specific embodiment, the above step 6-a is carried out with stirring at 20°C to 30°C, and the reaction time is 1.5 hours to 3 hours; step 6-b is carried out with stirring at 20°C to 30°C, and the reaction time is 20 hours to 24 hours.

[0202] This application relates to the construction and use of a T cell-targeted lipid aptamer and its nanoparticles based on nucleic acid aptamers. The nanoparticles are constructed by molecular self-assembly technology using hydrophobic molecules modified nucleic acid aptamers as building blocks. A lipid aptamer nanopreparation prepared only with hydrophobic molecules and nucleic acid aptamers with T cell-targeting properties can specifically target and mediate immune cells of diseases after intravenous injection into the body. For T cell-related diseases such as T cell lymphoma, precise targeted killing can be achieved.

[0203] Furthermore, the lipid aptamer can be modified according to different application scenarios. For example, spherical nanoparticles prepared with two nucleic acid aptamers targeting the same immune cell can carry one or more genes or therapeutic drugs for different purposes. Using bispecific nucleic acid aptamers, dual-targeted spherical nucleotide nanodrugs can be prepared. After entering the body, the nanopreparation can significantly improve the efficiency of cell gene modification or immune killing. Or, spherical nanovesicles prepared with hydrophobic molecules and nucleic acid aptamers targeting T cells can encapsulate various types of gene molecules such as mRNA, siRNA, and DNA. After intravenous injection into the body, the nanopreparation can specifically target the target cells, and the disulfide bond breaks under intracellular reducing conditions to release mRNA, siRNA, or DNA, enabling "site-directed" gene modification of cells and achieving in vivo gene reprogramming of cells. Or, a long-circulating nanodrug prepared with an appropriate amount of long-circulating stabilizer can significantly improve the in vivo half-life of the material, reduce immunogenicity, and extend the in vivo circulation time.

[0204] Example

[0205] This application generally and / or specifically describes the materials and test methods used in the experiments. In the following examples, if there is no other special description, % represents wt%, that is, weight percentage. Reagents or instruments without indicating the manufacturer can be obtained as conventional reagent products through commercial purchase.

[0206] Example 1 Preparation and performance study of DOPE-LD201t1-encapsulated mRNA nanoparticles

[0207] 1. Preparation of DOPE-LD201t1-encapsulated mRNA nanoparticles

[0208] The specific preparation method is as follows:

[0209] Mix 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) with the cross-linking agent N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP) at a mass ratio of 1.5:1, add an appropriate amount of the catalyst triethylamine (TEA), shake and react at room temperature for 2 h, dialyze using a dialysis bag, and freeze-dry to obtain activated DOPE;

[0210] React the activated DOPE with the aptamer LD201t1 at a molar ratio of 250:1, stir and react at room temperature for 24 h, dialyze using a dialysis bag to obtain the DOPE-LD201t1 hybrid molecule. This molecule can form DOPE-LD201tl lipid aptamer nanoparticles (DL NPs) through molecular self-assembly.

[0211] Mix the DOPE-LD201t1 molecule with the mRNA molecule at a concentration ratio of 1:2, and obtain nanoparticles encapsulating mRNA through molecular self-assembly technology. Under a transmission electron microscope, the DOPE-LD201t1 mRNA nanoparticles exhibit a uniform spherical nanovesicle-like structure (as Figure 1 shown).

[0212] 2. Cytotoxicity experiment

[0213] Seed human umbilical vein endothelial cells (HUVEC) in a 96-well plate, 10 4 cells per well. After overnight incubation, add the nanoparticles encapsulating mRNA with DOPE-LD201t1 and naked mRNA (where the mRNA concentration is 0.25, 0.5, 1, 2, 4, 8, 16, 32 μg / mL) to each well respectively, continue culturing for 24 hours, add 10 μL of CCK-8 detection solution to each well, continue culturing in an incubator for 1 - 4 h, and measure the absorbance at 450 nm using a multifunctional full-wavelength microplate reader (Thermo Varioskan Flash3001). The results are as Figure 2 shown. The nanoparticles encapsulating mRNA with DOPE-LD201t1 have no obvious toxic side effects on HUVEC cells and have relatively high biosafety.

[0214] 3. Cellular uptake experiment

[0215] Label the mRNA with the Cy5 fluorescent dye using the Label IT Nucleic Acid Labeling kit to prepare Cy5-mRNA, and encapsulate it into DL NPs to prepare Cy5-mCAR NPs. After co-incubating Cy5-mCAR NPs and naked Cy5-mRNA with T cells for 24 h respectively, observe the uptake of T cells through a laser confocal microscope. The results are as Figure 3As shown, DL NPs nanoparticles can precisely target T cells, effectively protect mRNA from degradation by RNase enzymes in the environment, improve the ability of mRNA to enter T cells, and lay a good foundation for its translation into proteins within T cells.

[0216] 4. In vivo biodistribution

[0217] Mix the fluorescent dye Cy7 and DOPE-LD201t1 molecules in a certain ratio, and construct DL NPs nanoparticles encapsulating the fluorescent dye Cy7 through molecular self-assembly, with free Cy7 fluorescent dye as the control group. At different time points after administration, use a small animal in vivo imager to detect the fluorescent signals in the mice and observe the distribution of DL NPs nanoparticles in vivo. The results are as Figure 4 shown. After intravenous injection, the free Cy7 fluorescent signal rapidly accumulates in the liver and gradually disappears after 12 h. In contrast, within 3 h after administration, NPs-Cy7 is significantly enriched in the lungs, which may be related to the massive aggregation of T cells in the presence of lung inflammation. A certain degree of fluorescent signal can still be observed in the lungs of the mice 48 h after administration, indicating that DL NPs nanoparticles can precisely target T cells and maintain a high concentration in the lungs for at least 48 h.

[0218] 5. Body weight monitoring

[0219] Use male C57BL / 6 mice aged 6 - 8 weeks to construct a bleomycin-induced pulmonary fibrosis model. The specific operation is as follows: Anesthetize the mice with isoflurane gas, quickly inject an appropriate amount of bleomycin solution (administration concentration is 3 mg / kg) at the glottis of the mice, and then gently shake the mouse body to evenly distribute the drug solution in its lungs. Continuously monitor the body weight of the idiopathic pulmonary fibrosis mice throughout the experimental period. The results are as Figure 5 shown. The body weights of all the modeled mice significantly decreased within 7 days after bleomycin infusion. Subsequently, after treatment with each group of drug preparations, the body weights of the mice in the PBS and naked mRNA treatment groups significantly decreased. In contrast, the body weights of the mice in the group of nanoparticles encapsulating mRNA with DOPE-LD201t1 slowly increased with the extension of the treatment time and showed a significant increase at the end point of the treatment, indicating that the nanoparticles encapsulating mRNA with DOPE-LD201t1 have good therapeutic functions and can significantly improve the health status of the mice.

[0220] Example 2 Preparation of DOPE-LD201t1 Encapsulating FAP CAR mRNA Nanoparticles

[0221] Prepare DOPE-LD201tl lipid aptamer nanoparticles (DL NPs) by the method of Example 1, and mix DL NPs with FAP CAR mRNA through molecular self-assembly technology to obtain mCAR NPs. As Figure 6 shown, the particle size of DL NPs is 165.7 ± 3.4 nm, and the particle size of mCAR NPs is 180.3 ± 6.3 nm.

[0222] As Figure 7 shown, the particle size of mCAR NPs remains basically unchanged in aqueous solution and PBS solution, and it can stably exist for more than 30 days.

[0223] Example 3 Preparation of nanoparticles loaded with EGFP mRNA by DPPC-4-1BB and testing of green fluorescent protein expression

[0224] Prepare DPPC-4-1BB lipid aptamer molecules through acyl chloride nucleophilic addition reaction, and use self-assembly technology to encapsulate a certain amount of EGFP mRNA. Add it to T cells and culture for different times, and observe the expression of green fluorescent protein EGFP by laser confocal microscopy.

[0225] The results are as Figure 8 shown, naked mRNA without loaded nanoshell DPPC-4-1BB hardly expresses green fluorescence, while nanoparticles loaded with EGFP mRNA by DPPC-4-1BB can be completely transfected into T cells and express green fluorescent protein, and with the extension of incubation time, the intensity of green fluorescent protein is also getting stronger and stronger.

[0226] Example 4 Preparation of nanoparticles loaded with siRNA by PCL-OX40 and testing of encapsulation efficiency

[0227] Dissolve PCL in an appropriate amount of absolute ethanol for later use. Then dissolve p-toluenesulfonyl chloride in absolute ethanol and add it to the PCL solution, and react at room temperature with shaking for 6 h;

[0228] Take a small amount of NaN3, dissolve it with DEPC water, add it to the above reaction solution and continue to react for 6 h, then add an appropriate amount of freshly dissolved DBCO-modified nucleic acid aptamer OX40, and prepare PCL-OX40 lipid aptamer molecules by click reaction

[0229] Use molecular self-assembly technology to encapsulate siRNA according to different mass ratios (PCL-OX40:siRNA = 10:1, 5:1, 1:1, 1:5, 1:10). Use the Quant-iT RiboGreen RNA detection kit to measure the content of siRNA in the solution before and after the nanoparticles are lysed. The difference between the two is the amount of siRNA encapsulated by the nanoparticles, and then the encapsulation efficiency is obtained.

[0230] The results are as Figure 9 shown. When PCL - OX40:siRNA = 5:1, the encapsulation efficiency is 55.7%.

[0231] Example 5 Particle size distribution of DSPG - CD28 - loaded plasmid DNA nanoparticles

[0232] Use amide bonds to prepare DSPG - CD28 lipid aptamer molecules. The specific operation steps are as follows:

[0233] React DSPG with the cross - linker CDI at a mass ratio of 2:1 by shaking at room temperature for 2 h to combine the hydroxyl oxygen atom in DSPG with the carbonyl carbon atom of CDI, generating an imide intermediate;

[0234] Add amino - modified nucleic acid aptamer CD28 according to the molar ratio (DSPG:nucleic acid aptamer = 2:1), shake and react at room temperature for 10 h, and dialyze with a dialysis bag of 2000 DW, then collect to obtain DSPG - CD28 lipid aptamer;

[0235] Add a certain amount of plasmid DNA according to the drug - loading amount, and shake at room temperature for 1 h to obtain DSPG - CD28 - pDNA NPs.

[0236] Use a Malvern particle size analyzer to detect the particle size and zeta potential value of the nanoparticles. The particle size is 173.4 ± 3.72 nm, and the dispersity PDI is 0.18 ± 0.05. The results are as Figure 10 shown.

[0237] Example 6 Preparation of DOPS - C2NP nanoparticles and test of their effect on the survival time of T - lymphoma mice

[0238] Use an amide reaction to generate DOPS - C2NP NPs. The specific operation steps are as follows:

[0239] Dissolve DOPS in dimethylformamide (DMF) solution, add an excessive amount of the activator EDC and N - hydroxysulfosuccinimide (Sulfo - NHS) to activate the carboxyl group, forming a stable NHS - ester intermediate;

[0240] Add the primary - amino - modified nucleic acid aptamer C2NP, shake and react at room temperature. Add an appropriate amount of Tris buffer at the end of the coupling reaction to terminate the reaction, and obtain DOPS - C2NP NPs after dialysis and through molecular self - assembly.

[0241] Prepare a T - lymphoma mouse model: Select C57BL / 6 mice as the research object, and inject mouse T - lymphoma cells EL4 (1×10 6cells / mouse), and randomly divided into a PBS group, a brentuximab vedotin combined with CHP group, a Free C2NP group, and a DOPS-C2NP NPs group. After tail vein injection, the survival curves of the mice were recorded and plotted, and the results are as Figure 11 shown. DOPS-C2NP NPs can effectively inhibit the growth of tumor volume and significantly prolong the survival period of tumor-bearing mice.

[0242] Example 7 Preparation and Characterization of DOPE-OSJ-T3 Lipid Aptamer Molecules

[0243] The DOPE-OSJ-T3 lipid aptamer molecules were prepared by reacting with a disulfide bond in a molar ratio of 500:1. The specific operation steps are as follows:

[0244] Phospholipid DOPE and crosslinker SPDP were mixed at a mass ratio of 1.5:1, an appropriate amount of catalyst triethylamine (TEA) was added, and the reaction was shaken at room temperature for 2 h. Dialysis was carried out using a 500 DW dialysis bag, and after lyophilization, it was the activated DOPE;

[0245] The activated DOPE and nucleic acid aptamer OSJ-T3 were reacted in a molar ratio of 500:1, and the reaction was carried out at room temperature for 24 h. Dialysis was carried out using a 2000 DW dialysis bag to obtain DOPE-OSJ-T3 lipid aptamer molecules.

[0246] The results of agarose gel electrophoresis showed ( Figure 12 ), the coupling of the DOPE-OSJ-T3 lipid aptamer molecules was successful.

[0247] Example 8 Killing Effect of DOPE-OSJ-T3 Encapsulating CD19 CAR mRNA Nanoparticles on Tumor Cells In Vitro

[0248] Phospholipid DOPE and crosslinker SPDP were mixed at a mass ratio of 1.5:1, an appropriate amount of catalyst triethylamine (TEA) was added, and the reaction was shaken at room temperature for 2 h to cause a nucleophilic addition reaction between the amino group in DOPE and the NHS ester group in SPDP to form an amide bond; then it was reacted with the thiol-modified nucleic acid aptamer OSJ-T3 at room temperature for 24 h to obtain DOPE-OSJ-T3 lipid aptamer molecules.

[0249] DOR NPs were prepared by encapsulating mRNA according to the mass ratio (DOPE-OSJ-T3:CD19 CAR mRNA = 2:1) using molecular self-assembly technology. After transfecting T cells, they were co-incubated with tumor cells. The LDH cytotoxicity detection kit was used to evaluate the killing effect of nanoparticles loaded with CD19 CAR mRNA by DOPE-OSJ-T3 on tumor cells in vitro. Four groups were set up in the experiment: PBS control group (untreated T cells), DO NPs group (nanoparticles without loaded mRNA), Naked mRNA group (free CD19-CARmRNA), and DOR NPs group. The tumor cells were cultured to the logarithmic growth phase, adjusted to a density of 6×10 4 / mL and then seeded into 96-well plates. They were co-cultured at effector-to-target ratios (E:T, CAR-T cells:tumor cells) of 1:1, 1:2, 1:4, 1:8, and 0:1 (only tumor cells). After the incubation, the killing efficiency was evaluated by detecting the LDH release amount.

[0250] It can be seen from Figure 13 that, compared with the other three groups, the DOR NPs group could significantly kill tumor cells.

[0251] Example 9 Preparation of DSPC-CD28 / poloxamer nanoparticles

[0252] First, DSPC was reacted with the cross-linking agent SPDP and the catalyst triethylamine at room temperature for 2 h, and then reacted with the thiol-modified nucleic acid aptamer CD28. After dialysis, the DSPC-CD28 lipid aptamer molecule was obtained. Then, poloxamer was mixed with the DSPC-CD28 lipid aptamer molecule for self-assembly to obtain DSPC-CD28 / poloxamer nanoparticles.

[0253] The particle size of the nanoparticles was measured by a Malvern particle size analyzer. The results were as Figure 14 shown, and its particle size was 127.9 ± 2.99 nm.

[0254] Example 10 Preparation of DOPS-4-1BB / DOPS-PegS1.3 / S2.2nib (PEGylated) / PEG long-circulating dual-target lipid aptamer nanoparticles

[0255] DOPS was dissolved in dimethylformamide (DMF) solution, and an excessive amount of the activator EDC and N-hydroxysulfosuccinimide (Sulfo-NHS) were added to activate the carboxyl group to form a stable NHS ester intermediate;

[0256] Then, they were respectively subjected to a shaking reaction with amino-modified nucleic acid aptamer m4-1BB and PegS1.3 / S2.2nib (PEGylated) at room temperature. At the end of the coupling reaction, an appropriate amount of Tris buffer was added to terminate the reaction. After dialysis, DOPS-m4-1BB and DOPS-PegS1.3 / S2.2nib (PEGylated) lipid aptamer molecules were obtained. Then, DOPS-m4-1BB and DOPS-PegS1.3 / S2.2nib (PEGylated) lipid aptamer molecules were mixed at a molar ratio of 3:2 and an appropriate amount of long-circulating stabilizer PEG was incorporated. After molecular self-assembly, DOPS-m4-1BB-PegS1.3 / S2.2nib / PEG long-circulating dual-target nanoparticles were obtained.

[0257] The results of transmission electron microscopy showed that the nanoparticles presented a spherical vesicular structure with uniform size and uniform dispersion.

[0258] Example 11 Preparation of DPPE -OX40 / DPPE-OSJ-T3 Dual-Target Lipid Aptamer Nanoparticles

[0259] The phosphate group of DPPE was converted into an acyl chloride group using thionyl chloride, and then it was respectively subjected to a shaking reaction with amino-modified nucleic acid aptamers OX40 and OSJ-T3 at room temperature for 24 h. After dialysis, DPPE -OX40 and DPPE-OSJ-T3 lipid aptamer molecules were obtained.

[0260] Then, DPPE-OX40 and DPPE-OSJ-T3 lipid aptamer molecules were self-assembled at a molar ratio of 1:1 to form DPPE -OX40 / DPPE-OSJ-T3 nanoparticles. The particle size was measured to be 162.8 ± 1.67 nm and the dispersity was 0.12 ± 0.02 by a Malvern particle size analyzer (as Figure 15 shown).

[0261] Example 12 Effect of DOPE-LD201tl Nanoparticles Encapsulating NKG2DL CAR mRNA on Plasma Glucose Levels in Aged Mice

[0262] DOPE-LD201tl lipid aptamer nanoparticles (DL NPs) were prepared by the method of Example 1, and DL NPs were mixed with NKG2DL CAR mRNA through molecular self-assembly technology to obtain NKG2DL mCAR NPs.

[0263] Construction of a natural aging mouse model: Select naturally aging mice (such as C57BL / 6 mice at 18 - 24 months old) as the research subjects and randomly divide them into 4 groups: the PBS group and the NKG2DL mCAR NPs group. The dosage range of mRNA is 20 μg / mouse. Figure 16 The results showed that 3 days after injecting the nanoparticles into the aging mice, insulin (0.5 units / kg / mouse) was infused. Compared with before infusion, the mice in the NKG2DL mCAR NPs group showed significantly lower plasma glucose levels within 1 hour than the control group.

[0264] Example 13 Preparation of dual - target lipid aptamer nanoparticles of DOPE - CD28 / DOPE - NKG2DL

[0265] Phospholipid DOPE and cross - linker SPDP were mixed at a mass ratio of 1.5:1, and an appropriate amount of catalyst triethylamine (TEA) was added. The reaction was shaken at room temperature for 2 h to allow a nucleophilic addition reaction between the amino group in DOPE and the NHS ester group in SPDP to form an amide bond. Then, it was reacted with thiol - modified nucleic acid aptamers CD28 and NKG2DL at room temperature for 24 h to obtain DOPE - CD28 and DOPE - NKG2DL lipid aptamer molecules.

[0266] Then, DOPE - CD28 and DOPE - NKG2DL lipid aptamer molecules were self - assembled at a molar ratio of 1:1 to form DOPE - CD28 / DOPE - NKG2DL nanoparticles. The particle size measured by a Malvern particle size analyzer was 146.2 ± 2.74 nm, and the dispersity was 0.09 ± 0.08.

[0267] Example 14 Influence of hydrophobic molecule DOPE on the particle size of DOPE - LD201t1 nanoparticles

[0268] DOPE - LD201t1 and DOPE molecules were mixed and self - assembled at molar ratios of 10:1, 5:1, and 1:1 respectively. The particle sizes of the resulting nanoparticles were 174.7 ± 2.5 nm, 183.3 ± 4.8 nm, and 204.6 ± 7.3 nm respectively.

[0269] Example 15 Test on the influence of preparation parameters of nano - lipid aptamers on performance

[0270] Experiment 1. Influence of the reaction molar ratio of hydrophobic molecule DOPE to nucleic acid aptamer OSJ - T3 on the particle size and dispersity of nanoparticles

[0271] Prepare DOPE-OSJ-T3 nanoparticles by the method of Example 7. Among them, the molar amount of the reaction between the hydrophobic molecule DOPE and the aptamer OSJ-T3, as well as other preparation parameters, are selected according to Table 1. The test results such as the particle size and dispersion degree of the obtained nanoparticles are shown in Table 1.

[0272] Table 1

[0273]

[0274] Remarks: The apt concentration is 1 μg / ml, and the relative molecular mass is 12460 g / mol.

[0275] Experiment 2. Influence of the mass ratio of DOPE-OSJ-T3 nanovesicles to mRNA on the particle size and zeta potential of nanoparticles

[0276] Prepare nanoparticles encapsulating CD19 CAR mRNA with DOPE-OSJ-T3 by the method of Example 8. Among them, the mass ratio of the DOPE-OSJ-T3 nanoparticles (DO NPs) prepared by selecting DOPE:OSJ-T3 = 500:1 to mRNA is selected according to Table 2. The test results such as the particle size and zeta potential of the obtained nanoparticles are shown in Table 2.

[0277] Table 2

[0278]

[0279] Remarks: The relative molecular mass of OSJ-T3 is 12460 g / mol

[0280] Experiment 3. Influence of the preparation parameters of DOPE-LD201tl nanoparticles on their performance

[0281] Prepare DOPE-LD201t1 nanoparticles targeting T cells by using disulfide bonds. The specific operation steps are as follows:

[0282] React phospholipid DOPE with crosslinker SPDP and catalyst triethylamine (TEA) at room temperature for 2 h, and then react with thiol-modified aptamer LD201tl according to the molar amounts in Table 3. Stir and react at room temperature for 24 h. After dialysis, self-assemble to form DOPE-LD201tl nanoparticles.

[0283] The test results such as the particle size and dispersion degree of the obtained nanoparticles are shown in Table 3.

[0284] Table 3

[0285]

[0286] Experiment 4. Influence of Preparation Parameters of DPPG-4-1BB Nanoparticles on Performance

[0287] DPPG-4-1BB nanoparticles were prepared using amide bonds. The specific operation steps are as follows:

[0288] DPPG and the crosslinking agent CDI were reacted by shaking at room temperature for 2 h at a mass ratio of 2:1. Amino-modified aptamer 4-1BB was added according to the molar ratio (DPPG:aptamer = 5000:1 to 1:10, as specifically shown in Table 4), and the reaction was shaken at room temperature for 18 h. DPPG-41-BB lipid aptamer molecules were synthesized using amide bonds, and DPPG-4-1BB NPs were obtained by self-assembly.

[0289] The test results such as the particle size and dispersion degree of the obtained nanoparticles are shown in Table 4.

[0290] Table 4

[0291]

[0292] It can be seen from the above experimental results that: in the preparation of nano-lipid aptamers, a molar ratio of hydrophobic molecules reacting with aptamers using disulfide bond reactions ≥ 1:1 has a better effect. A molar ratio of hydrophobic molecules reacting with aptamers using acyl chloride reactions between 100:1 and 1:4 has a better effect. A molar ratio of hydrophobic molecules reacting with aptamers using click reactions of 500:1 has a better effect.

[0293] The above are only the preferred embodiments of the present application and do not limit the present application in any form. Any person skilled in the art may use the disclosed technical content to make changes or modifications into equivalent embodiments with equivalent changes. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present application without departing from the technical solution content of the present application still fall within the protection scope of the technical solution of the present application.

Claims

1. A T cell-targeting lipid aptamer, characterized in that, The lipid aptamer includes a hydrophobic molecule and a nucleic acid aptamer, and the nucleic acid aptamer includes at least one nucleic acid aptamer targeting a T cell surface molecule. Among them, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer is 5000:1 - 1:

10.

2. The T cell-targeting lipid aptamer according to claim 1, wherein The hydrophobic molecule and the nucleic acid aptamer are connected by a chemical bond.

3. The T cell-targeting lipid aptamer according to claim 1, characterized in that, The nucleic acid aptamer targeting a T cell surface molecule includes single-stranded DNA (ssDNA), RNA, XNA, TNA, or a point mutant, truncated form, chemically modified derivative, or chimeric DNA-TNA oligonucleotide targeting a T cell surface molecule.

4. The T cell-targeting lipid aptamer according to claim 1, wherein The nucleic acid aptamer targeting a T cell surface molecule is selected from LD201t1, OSJ-T3, OX40, CD28Apt7, 4-1BB, CD5, CD62L, or C2NP.

5. The T cell-targeting lipid aptamer according to claim 1, wherein The nucleic acid aptamer further includes one or more nucleic acid aptamers that do not target T cell surface molecules, and the nucleic acid aptamers that do not target T cell surface molecules are selected from nucleic acid aptamers targeting tumor cells, stem cells, senescent cells, other immune cell surface molecules, or nucleic acid aptamers targeting cell surface specific receptors.

6. The T cell-targeting lipid aptamer according to claim 1, wherein The hydrophobic molecule is a hydrocarbon molecule containing an amino group, a phosphate group, a hydroxyl group, or a carboxyl group.

7. The T cell-targeting lipid aptamer according to claim 6, characterized in that, The hydrophobic molecule is selected from at least one of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), dipalmitoyl phosphatidylcholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (sodium salt) (DOPS), dipalmitoyl phosphatidylcholine (DPPC), dimyristoyl phosphatidylcholine (DMPC), hydrogenated lecithin (HSPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-distearoyl-sn-glycero-3-phosphoserine (DSPG), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (DPPE), 1,2-dilauroyl phosphatidylethanolamine (DLPE), 1,2-dipalmitoyl-sn-glycero-3-phosphatidylglycerol (DPPG), monophosphoryl lipid A (MPLA), 1,3-dilinolenin, and polycaprolactone (PCL).

8. The T cell-targeting lipid aptamer according to claim 1, wherein The T cell-targeted lipid aptamer further includes a long-circulation stabilizer.

9. The T cell-targeted lipid aptamer according to claim 8, wherein the hydrophobic molecule is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and the nucleic acid aptamer is OSJ-T3; or the hydrophobic molecule is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and the nucleic acid aptamer is LD201tl; or the hydrophobic molecule is 1,2-dipalmitoyl-sn-glycero-3-phosphatidylglycerol (DPPG), and the nucleic acid aptamer is 4-1BB; or The hydrophobic molecule is polycaprolactone (PCL), and the aptamer is OX40; or The hydrophobic molecule is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), and the aptamer is CD28; or The hydrophobic molecule is sodium dioleoyl phosphatidylserine (DOPS), and the aptamer is C2NP; or The hydrophobic molecule is 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (DPPE), and the aptamers are OX40 and OSJ-T3; or The hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), and the aptamers are CD28 and NKG2DL; or The hydrophobic molecule is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), the aptamer is CD28, and the long-circulating stabilizer is poloxamer; or The hydrophobic molecule is sodium dioleoyl phosphatidylserine (DOPS), the aptamers are 4-1BB and PegS1.3 / S2.2nib (PEGylated), and the long-circulating stabilizer is PEG.

10. A nanoparticle constructed from the T cell-targeting lipid aptamer according to any one of claims 1-9.

11. The nanoparticle according to claim 10, characterized in that, The particle size of the nanoparticle is 80-1000 nm.

12. The nanoparticle according to claim 11, wherein The nanoparticle may encapsulate a payload, and the payload is a therapeutic agent.

13. The nanoparticle according to claim 12, characterized in that, The therapeutic agent is selected from at least one of polynucleotide or oligonucleotide molecules, chemotherapeutic drugs, small molecule targeted drugs, immune checkpoint inhibitors, antibody-drug conjugates or hormone drugs.

14. The nanoparticle according to claim 13, wherein The polynucleotide or oligonucleotide molecule is selected from at least one of mRNA, siRNA, miRNA, hnRNA or DNA molecules.

15. The nanoparticle according to claim 13, characterized in that, The chemotherapeutic drug is selected from at least one of paclitaxel, doxorubicin, capecitabine and gemcitabine.

16. The nanoparticle according to claim 13, wherein The small molecule targeted drug is selected from at least one of buritinib, HER2 inhibitor (lapatinib), BCR-ABL inhibitor (imatinib), EGFR-TKI inhibitor (osimertinib) and EGFR inhibitor (cetuximab).

17. The nanoparticle according to claim 13, characterized in that, The immune checkpoint inhibitor is selected from at least one of PD-1 / PD-L1 inhibitors, CTLA-4 inhibitors, LAG-3 inhibitors, TIM-3 inhibitors and TIGIT inhibitors.

18. The nanoparticle according to claim 13, wherein The antibody-drug conjugate is selected from conjugates of an antibody and at least one of maytansine, Auristatin derivatives, Anetumab Ravtansine and auristatin.

19. The nanoparticle according to claim 13, characterized in that, The hormone drug is an agonist or inhibitor of a hormone.

20. The nanoparticle according to claim 12, wherein The hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the aptamer is LD201t1, and the therapeutic agent is mRNA; or The hydrophobic molecule is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), the aptamer is LD201t1, and the therapeutic agent is FAP CAR mRNA; or The hydrophobic molecule is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), the aptamer is LD201t1, and the therapeutic agent is NKG2DL CAR mRNA; or The hydrophobic molecule is dipalmitoylphosphatidylcholine (DPPC), the aptamer is 4-1BB, and the therapeutic agent is mRNA; or The hydrophobic molecule is polycaprolactone (PCL), the aptamer is OX40, and the therapeutic agent is siRNA; or The hydrophobic molecule is 1,2-distearoyl-sn-glycero-3-phosphoserine (DSPG), the aptamer is CD28, and the therapeutic agent is plasmid DNA; or The hydrophobic molecule is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), the aptamer is OSJ-T3, and the therapeutic agent is CD19 CAR mRNA.

21. A method for preparing the T cell-targeting lipid aptamer according to any one of claims 1-9 or the nanoparticle according to any one of claims 10-20, characterized in that, The preparation method comprises the following steps: Reacting the hydrophobic molecule with a crosslinking agent and / or a catalyst to obtain a first product; and Reacting the first product with an aptamer molecule to obtain a lipid aptamer, wherein the aptamer comprises at least one aptamer targeting a T cell surface molecule.

22. The preparation method according to claim 21, wherein, The preparation method further comprises: Encapsulating the lipid aptamer with at least one payload.

23. The preparation method according to claim 21, characterized in that, The mass ratio of the hydrophobic molecule to the crosslinking agent and / or the catalyst is 10 - 0.1:

1.

24. The preparation method according to claim 21, wherein The molar ratio of the hydrophobic molecule to the aptamer molecule is ≥1:

10.

25. The preparation method according to claim 21, characterized in that, In the step of reacting the hydrophobic molecule with a crosslinking agent and / or a catalyst to obtain a first product, the reaction temperature is 20 - 30°C and the reaction time is 1.5 - 3 hours.

26. The preparation method according to claim 21, wherein In the step of reacting the first product with an aptamer molecule to obtain a lipid aptamer, the reaction temperature is 0 - 30°C and the reaction time is 18 - 24 hours.

27. The preparation method according to claim 22, characterized in that, In the step of encapsulating the lipid aptamer with at least one payload, the reaction temperature is 20 - 30°C and the reaction time is 0.5 - 4 hours.

28. Use of the T cell-targeted lipid aptamer according to any one of claims 1 to 9 or the nanoparticle according to any one of claims 10 to 20 in the preparation of a nanomedicine for the treatment of diseases.

Citation Information

Patent Citations

  • Nucleic acid aptamer-based mRNA targeted delivery system for spleen and subcells thereof

    CN118217417A

  • High Affinity Nucleic Acid Ligands To Lectins

    US20090118481A1

  • Surface functionalization of liposomes and liposomal spherical nucleic acids (SNAS)

    US20200297867A1

  • Liposome fusion and delivery vehicle

    US6372720B1

  • Lipid-charged molecule conjugate, inhalable lipid nanoparticle, preparation method therefor, and use thereof

    WO2024099391A1