Soybean cyst nematode gene Hg-tax-4 and application thereof in nematode control

Abstract

This invention relates to a soybean cyst nematode gene, Hg-tax-4, and its application in nematode control. This invention addresses the problems of environmental pollution and easy loss of resistance in existing chemical control methods for soybean cyst nematodes, particularly when combined with resistant varieties and non-host rotation methods. The nucleotide sequence of the soybean cyst nematode gene Hg-tax-4 is shown in SEQ ID NO: 1 in the sequence listing. The application of the dsRNA of the soybean cyst nematode gene Hg-tax-4 in nematode control is also discussed. The gene Hg-tax-4 is derived from the cyclic nucleotide-gated ion channel subunit of the soybean cyst nematode, and experimental results show that this gene is expressed in the cerci of second-instar larvae. The soybean cyst nematode gene Hg-tax-4 participates in regulating the infection and reproduction of the soybean cyst nematode on its host and can be used as a target gene for the development of drugs for the control of soybean cyst nematodes.

Description

Technical Field

[0001] This invention relates to a soybean cyst nematode gene and its application. Background Technology

[0002] Soybeans are an important dual-purpose crop for both grain and oilseed production. Soybean cyst nematode disease, caused by the root-settling soybean cyst nematode (SCN), is a significant soil-borne disease. It occurs in all soybean-producing areas of my country, causing annual economic losses of up to 600 million yuan. After invading the root system, SCN easily causes stunted root development and yellowing leaves, generally resulting in a 30-50% yield reduction, and in severe cases, total crop failure. Due to changes in my country's industrial structure leading to a year-on-year increase in soybean planting area, this disease has become increasingly severe. Furthermore, wounds caused by soybean cyst nematode infection can induce secondary diseases, such as soybean damping-off, soybean blight, and soybean stem rot.

[0003] While chemical control of soybean cyst nematode is effective, it is extremely destructive to the environment, ecology, and human and animal safety. Combining disease-resistant varieties with non-host rotation is also an effective control strategy, but the resistance source is singular, multiple physiological races exist in the field and are prone to mutation, leading to easy loss of resistance. Limited arable land resources restrict crop rotation.

[0004] Based on the aforementioned problems, new control strategies are urgently needed. Currently, developing novel, highly efficient, non-toxic, and broad-spectrum bio-nematicides based on the nematode-plant interaction mechanism is a top priority in nematology research. Discovering and screening new genes in soybean cyst nematodes, elucidating their functions in the infection and development of soybean cyst nematodes, and further developing novel bio-nematicides using these genes as targets has significant theoretical guidance and practical application value for the green and sustainable control of soybean cyst nematodes. Summary of the Invention

[0005] To address the environmental pollution issues associated with existing chemical control methods for soybean cyst nematodes and the easy loss of resistance due to crop rotation, this invention provides the soybean cyst nematode gene Hg-tax-4 and its application in nematode control.

[0006] The nucleotide sequence of the soybean cyst nematode gene Hg-tax-4 of this invention is shown in SEQ ID NO: 1 in the sequence listing.

[0007] Furthermore, the amino acid sequence of the protein encoded by the soybean cyst nematode gene Hg-tax-4 is shown in the sequence listing SEQ ID NO: 2.

[0008] Furthermore, the dsRNA sequence of the soybean cyst nematode gene Hg-tax-4, dsRNA-Hg-tax-4, and the nucleotide sequence of dsRNA-Hg-tax-4 are shown in SEQ ID NO: 3.

[0009] The application of the dsRNA of the soybean cyst nematode gene Hg-tax-4 described above in the control of nematodes.

[0010] Furthermore, the application method for controlling nematodes is as follows: second-instar larvae of soybean cyst nematodes are soaked in a treatment solution containing dsRNA of the soybean cyst nematode gene Hg-tax-4, and then incubated with shaking in the dark at room temperature.

[0011] The beneficial effects of this invention are:

[0012] The gene Hg-tax-4 of this invention is derived from the cyclic nucleotide-gated ion channel subunit of soybean cyst nematode, and experimental results show that this gene is expressed in the cerci of second-instar larvae.

[0013] This invention targets the base sequence of the Hg-tax-4 gene, screening for specific functional regions to synthesize dsRNA. Specifically, this invention targets the Hg-tax-4 gene of the soybean cyst nematode, screening for specific functional regions to synthesize a double-stranded RNA fragment, dsRNA-Hg-tax-4. Through in vitro interference with the soybean cyst nematode, this significantly inhibited the expression of the Hg-tax-4 gene, reducing the number of second-instar larvae in the roots by 37.2% and the number of female nematodes 35 days after infection by 27.37%. This indicates that this gene participates in regulating the infection and development of the soybean cyst nematode in its host.

[0014] The soybean cyst nematode gene Hg-tax-4 of this invention participates in regulating the infection and reproduction of soybean cyst nematodes on the host and can be used as a target gene for the development of drugs to control soybean cyst nematodes.

[0015] This invention is the first to report the cloning and functional analysis of a gene encoding a cyclic nucleotide-gated ion channel in plant parasitic nematodes. This invention has significant application value for the study of the pathogenic mechanism of soybean cyst nematode and for nematode control. Attached Figure Description

[0016] Figure 1 This is a partial fragment of the Hg-tax-4 gene from soybean cyst nematode cloned by RT-PCR in Example 1;

[0017] Figure 2 In Example 2, the in situ hybridization localization gene Hg-tax-4 was expressed in the caudal sensilla cells of the second instar larvae of soybean cyst nematode.

[0018] Figure 3 Fluorescence micrograph of second-instar larvae in group 1 of the treatment solution in Example 3;

[0019] Figure 4 The effect of exogenous dsRNA treatment on Hg-tax-4 expression in second-instar larvae in Example 3;

[0020] Figure 5 The number of J2 larvae in soybean roots 48 hours after infection with the second instar larvae J2 in the treatment group (dsRNA-Hg-tax-4) and the control group (dsRNA-GFP) in Example 3;

[0021] Figure 6 The number of female root larvae J2 in the treatment group (dsRNA-Hg-tax-4) and the control group (dsRNA-GFP) after 35 days of inoculation with soybean. Detailed Implementation

[0022] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0023] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.

[0024] Specific Implementation Method 1: The nucleotide sequence of the soybean cyst nematode gene Hg-tax-4 in this implementation method is shown as SEQ ID NO: 1 in the sequence listing.

[0025] Specific Implementation Method 2: The amino acid sequence of the protein encoded by the soybean cyst nematode gene Hg-tax-4 in this implementation method is shown in the sequence listing SEQ ID NO: 2.

[0026] Specific implementation method three: The dsRNA sequence of the soybean cyst nematode gene Hg-tax-4 in this implementation method is dsRNA-Hg-tax-4, and the nucleotide sequence of dsRNA-Hg-tax-4 is shown in SEQ ID NO: 3.

[0027] Specific Implementation Method Four: Application of the dsRNA of the soybean cyst nematode gene Hg-tax-4 described in Specific Implementation Method One in the control of nematodes.

[0028] Specific Implementation Method 5: This implementation method differs from Specific Implementation Method 4 in that the application method for controlling nematodes is as follows: Soak second-instar larvae of soybean cyst nematodes in a treatment solution containing dsRNA of the soybean cyst nematode gene Hg-tax-4, and incubate them in the dark at room temperature with shaking.

[0029] Specific Implementation Method Six: This implementation method differs from Specific Implementation Method Four in that it involves shaking and incubating in the dark at room temperature for 40–50 hours. Everything else is the same as in Specific Implementation Method Four.

[0030] Example 1: Cloning of the Hg-tax-4 gene, a cyclic nucleotide-gated ion channel from soybean cyst nematode.

[0031] 1. Collect freshly hatched second-instar soybean cyst nematode larvae, place them in a cryogenic grinder, add an appropriate amount of liquid nitrogen and grind them quickly. After grinding, transfer the nematode powder to a 1.5 mL centrifuge tube, add 1 mL of Trizol, vortex to mix and extract the total RNA of the nematodes.

[0032] 2. Using the total RNA from step 1 as a template, use The One-Step gDNA Removal and cDNA Synthesis SuperMix kit synthesizes nematode cDNA, which is then stored at -80°C for later use.

[0033] 3. Using the cDNA synthesized in step 2 as a template, the gene Hg-tax-4 was amplified by PCR using upstream and downstream primers.

[0034] The upstream and downstream primers for the Hg-tax-4 gene are as follows:

[0035] Hg-tax-4-F: 5'-TGGCACTTTGGCACATTGGGC-3'

[0036] Hg-tax-4-R: 5'-CCTGAAAAGTCGGACTTTGCG-3'

[0037] Amplification reaction system: 2×Phanta Master Mix, 5μL, cDNA template, 0.2μL, upstream primer, 0.4μL, downstream primer, 0.4μL, RNase-free water, 4μL, total reaction system 10μL.

[0038] Reaction conditions: 95℃ denaturation for 3 min, 95℃ for 15 s, 50-65℃ for 15 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 5 min, storage at 4℃. PCR products were separated and identified by 1% agarose gel electrophoresis. Results are as follows: Figure 1 As shown ( Figure 1 (This is a partial fragment of the Hg-tax-4 gene from the soybean cyst nematode cloned by RT-PCR).

[0039] 4. Sequencing the PCR amplification products from step 3. Sequencing results showed that the amplification products contained the gene fragment shown in SEQ ID NO: 1 of the sequence listing, and the coding sequence contained the protein shown in SEQ ID NO: 2 of the sequence listing. The protein containing the amino acid sequence shown in SEQ ID NO: 2 of the sequence listing was named protein Hg-TAX-4, and the coding gene was named Hg-tax-4.

[0040] Example 2: Tissue localization analysis of gene Hg-tax-4

[0041] Gene tissue localization analysis of second-instar larvae of soybean cyst nematode was performed using the DIG High Prime DNA Labeling and Detection Starter Kit 1 method.

[0042] 1. Based on the Hg-tax-4 gene sequence cloned in Example 1, digoxigenin (DIG) labeled sense and antisense probes were synthesized by asymmetric PCR.

[0043] Using the gene fragment recovered in step 1 of this embodiment as a template to label DIG, a 436bp sense strand probe and an antisense strand probe were obtained.

[0044] 2. Perform in situ hybridization.

[0045] The results of in situ hybridization are shown in Figure 2 ( Figure 2 (This refers to the in situ hybridization mapping of the gene Hg-tax-4 expression in the caudal sensilla cells of second-instar soybean cyst nematode larvae). Figure 2 The results showed that treatment with Hg-tax-4 labeled with the antisense probe elicited a colorimetric reaction in the nematode cerci tissue cells. This indicates that Hg-tax-4 is mainly expressed in the cerci tissue of second-instar larvae of soybean cyst nematodes, and the cerci are important organs for the regulation of allelopathic responses in nematodes.

[0046] Example 3: In vitro RNAi interference assay to verify Hg-tax-4 function

[0047] 1. Synthesis of dsRNA: Based on the Hg-tax-4 gene fragment cloned in Example 1, specific primers were designed:

[0048] Hg-tax-4-si-T7F:

[0049] 5'-TAATACGACTCACTATAGGGAGTGGCACTTTGGCACATTGGGC-3'

[0050] Hg-tax-4-si-R:

[0051] 5'-CCTGAAAAAGTCGGACTTTGCG-3'

[0052] Hg-tax-4-si-F:

[0053] 5'-TGGCACTTTGGCACATTGGGC-3'

[0054] Hg-tax-4-si-T7R:

[0055] 5'-TAATACGACTCACTATAGGGAGCCTGAAAAAGTCGGACTTTGCG-3'

[0056] The T7 promoter sequence TAATACGACTCACTATAGGGAG was introduced into the 5' end of a specific primer. Using the Hg-tax-4 gene fragment as a template, the required gene fragment template was synthesized by PCR amplification of dsRNA, purified, and used in the next step of the experiment.

[0057] 2. According to MEGAscript TM The RNAi Kit instructions describe the synthesis of dsRNA-Hg-tax-4.

[0058] Reaction system: 1 μg of recovered gene fragment template, 2 μL of 10×T7 reaction buffer, 2 μL of ATP, 2 μL of CTP, 2 μL of GTP, 2 μL of UTP, 2 μL of T7 Enzyme Mix, and nuclease-free water to a final volume of 20 μL. Incubate at 37°C in the dark for 4 h, then incubate overnight at -20°C. The product was identified by 1% agarose gel electrophoresis, and the concentration of dsRNA-Hg-tax-4 was detected at 260 nm. The synthesized dsRNA-Hg-tax-4 was stored at -80°C. The sequence of dsRNA-Hg-tax-4 is shown in SEQ ID NO: 3.

[0059] 3. Collect freshly hatched second-instar soybean cyst nematode larvae, wash them three times with 1 / 4 M9 buffer, and set aside for later use.

[0060] 4. In vitro RNAi interference of second-instar larvae of soybean cyst nematode was performed according to the method described in the article (Urwin PE, Lilley CJ, Atkinson HJ. Molecular Plant-Microbe Interactions, 2002, 15:747-752.). 500 second-instar larvae collected in step 3 of this embodiment were taken and immersed in treatment solution 1, treatment solution 2, and treatment solution 3, respectively, 500 larvae / sample, with each treatment repeated three times. The larvae were incubated at room temperature in the dark with shaking for 48 hours.

[0061] Treatment solution 1 contains 50 mM octopamine, 3 mM spermidine, 0.05% gelatin, 1.5 mg / mL dsRNA and 0.1 mg / mL FITC.

[0062] Treatment solution 2 (control group) contained 50 mM octopamine, 3 mM spermidine, 0.05% gelatin and 1.5 mg / mL dsRNA-GFP (sequence shown in SEQ ID NO: 4).

[0063] Treatment solution 3 (treatment group) contained 50 mM octopamine, 3 mM spermidine, 0.05% gelatin and 1.5 mg / mL dsRNA-Hg-tax-4.

[0064] 5. Using a pipette, aspirate several second-instar larvae from one group of treated nematodes. Detect the presence of green fluorescence within the nematodes using a fluorescence microscope at a wavelength of 488-525 nm. Figure 3 Fluorescence micrographs of second-instar larvae in group 1 of the treatment solution, from... Figure 3 It can be seen that the dsRNA was successfully ingested by the second-instar larvae, silencing the expression of the target gene Hg-tax-4, and ultimately inhibiting the nematode's infectivity and reproductive capacity.

[0065] 6. Total RNA was extracted from soybean cyst nematodes soaked in treatment solutions 2 and 3 and reverse transcribed into cDNA. Since the nematodes do not contain the GFP gene sequence, under normal conditions, dsRNA-GFP treatment (sequence shown in SEQ ID NO: 4) does not affect the expression level of the target gene Hg-tax-4, thus demonstrating that dsRNA-Hg-tax-4 has specificity for silencing Hg-tax-4. Using the dsRNA-GFP treatment group as a control, the expression level of the gene Hg-tax-4 was detected by real-time PCR (with actin gene as an internal reference). The results are as follows. Figure 4 ( Figure 4 (The effect of exogenous dsRNA treatment on Hg-tax-4 expression in second-instar larvae) After treatment with dsRNA-Hg-tax-4, the expression level of Hg-tax-4 in soybean cyst nematodes was significantly reduced.

[0066] Primers for real-time PCR detection:

[0067] Hg-tax-4F:5'-GCATCGGTCGGTCGGTAAAA-3'

[0068] Hg-tax-4R: 5'-CGCAGCGTCTCAAAATGCAC-3'

[0069] Hg-actin F: 5'-GCGTGGTTACTCCTTCGTG-3'

[0070] Hg-actin R: 5'-CGGGCAGTTCGTAGCTCTTC-3'

[0071] Twenty-fivety second-instar larvae treated with treatment solutions 2 and 3 were inoculated into soybean seedlings and cultured in the dark for 24 hours. The infection rate was then assessed using the fuchsin method. The above-ground parts of the soybean were removed, and the soybean roots were rinsed thoroughly with water and then soaked in a 1.5% sodium hypochlorite solution for 3 minutes. The soybean roots were then removed, thoroughly rinsed with sterile water to remove the sodium hypochlorite, and then soaked in a fuchsin solution, heated to boiling. After boiling for 30 seconds, the solution was left to cool to room temperature. A soybean root was taken, the surface fuchs were washed off with water, and a slide was prepared. The number of nematodes invading the root was counted under a stereomicroscope. Figure 5 The number of J2 larvae in soybean roots 48 hours after infection with the second instar larvae J2 in the treatment group (dsRNA-Hg-tax-4) and the control group (dsRNA-GFP); Figure 6 The number of female root-surface larvae J2 in the treatment group (dsRNA-Hg-tax-4) and the control group (dsRNA-GFP) 35 days after inoculation with soybean was determined. Figure 5 and Figure 6 As can be seen, treatment with the double-stranded RNA fragment dsRNA-Hg-tax-4 significantly inhibited the expression of the soybean cyst nematode gene Hg-tax-4. The number of second-instar larvae infected into the roots and the number of female nematodes 35 days after infection decreased by 37.2% and 27.37%, respectively. The results indicate that dsRNA can interfere with the expression of Hg-tax-4, and silencing Hg-tax-4 affects nematode infection and development, making it a potential target gene for nematicides in nematode control.

Claims

1. Soybean cyst nematode gene Hg-tax-4 The application of dsRNA in the control of nematodes is characterized by, The method for controlling nematodes is as follows: using a product containing the gene of soybean cyst nematode. Hg-tax-4 Soybean cyst nematode second-instar larvae were soaked in a solution containing dsRNA and incubated with shaking in the dark at room temperature; the soybean cyst nematode gene was present. Hg-tax-4 dsRNA sequence dsRNA- Hg- tax-4 dsRNA- Hg-tax-4 The nucleotide sequence is shown in SEQ ID NO:

3.

2. The soybean cyst nematode gene according to claim 1 Hg-tax-4 The application of dsRNA in the control of nematodes is characterized by, Soybean cyst nematode gene Hg-tax-4 The nucleotide sequence is shown in SEQ ID NO:

1.

3. The soybean cyst nematode gene according to claim 1 Hg-tax-4 The application of dsRNA in the control of nematodes, characterized in that, Soybean cyst nematode gene Hg-tax-4 The amino acid sequence encoding the protein is shown in SEQ ID NO:

2.

4. The soybean cyst nematode gene according to claim 1 Hg-tax-4 The application of dsRNA in the control of nematodes is characterized by, The incubation time in the dark at room temperature with shaking is 40-50 h.

Images