Gene GL8 for controlling grain shape, appearance quality or / and yield of rice and application of gene GL8
By discovering and utilizing genes related to rice grain type and appearance quality, and regulating rice grain type, appearance quality and yield through overexpression, the problem of regulating rice grain type and appearance quality in the prior art was solved, and the significant improvement of rice grain length and the enrichment of breeding resources were achieved.
Patent Information
- Application Number
- CN202510403885.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-01
- Publication Date
- 2025-07-04
AI Technical Summary
There is a lack of effective genetic resources and methods in the prior art to regulate rice grain shape and appearance quality, resulting in breeding difficulties.
By discovering and using the gene GL8 and its encoding protein related to rice grain type and appearance quality, the rice grain type, appearance quality and yield are regulated by overexpression, recombinant vectors are constructed and rice is transformed, and the expression of the GL8 gene is increased.
It has achieved significant improvement in rice grain length, provided new genetic resources and breeding methods, and can effectively regulate rice grain shape, appearance quality and yield, and promoted the development of rice breeding.
Smart Images

Figure CN120249307A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a gene GL8 for controlling rice grain shape, appearance quality and / or yield and its application. Background Art
[0002] Rich rice resources contain many genes affecting grain shape and appearance quality. Exploring and identifying excellent genes can broaden the gene sources for rice breeding and enrich the gene background. Exploring and utilizing the genes for rice grain shape and appearance quality is a practical problem to be solved urgently. Summary of the Invention
[0003] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a gene GL8 for controlling rice grain shape, appearance quality and / or yield and its application.
[0004] To achieve the above purpose, the technical solutions adopted by the present invention are as follows:
[0005] In the first aspect, the present invention provides a gene GL8 for controlling rice grain shape, appearance quality and / or yield, and the gene has the nucleotide sequence of (a) or (b) as follows:
[0006] (a) Composed of the nucleotide sequence shown in SEQ ID No.1;
[0007] (b) The nucleotide sequence shown in SEQ ID No.1 is generated by adding, substituting or deleting one or several bases, and encodes a nucleotide sequence of a functional protein for controlling rice grain shape, appearance quality and yield.
[0008] In the second aspect, the present invention provides the application of the GL8 gene described in the first aspect in regulating rice grain shape, appearance quality and / or yield.
[0009] As a preferred embodiment of the second aspect, the GL8 gene regulates rice grain shape, appearance quality and / or yield through overexpression.
[0010] In the third aspect, the present invention provides a protein for regulating rice grain shape, appearance quality and / or yield, and the protein is encoded by the gene described in the first aspect.
[0011] In the fourth aspect, the present invention provides the application of the protein described in the third aspect in regulating rice grain shape, appearance quality and yield.
[0012] In the fifth aspect, the present invention provides a recombinant vector containing the gene sequence described in the first aspect.
[0013] In the sixth aspect, the present invention provides a biological material containing the recombinant vector described in the fifth aspect.
[0014] As a preferred embodiment of the sixth aspect, the biomaterial is a recombinant microorganism, a transgenic plant cell line or a transgenic plant tissue; the recombinant microorganism is a bacterium, yeast, alga or fungus; the bacterium is one of Escherichia, Erwinia, Agrobacterium tumefaciens, Flavobacterium, Alcaligenes, Pseudomonas or Bacillus.
[0015] The recombinant microorganism is a bacterium, yeast, alga or fungus; the bacterium is one of the genus Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Pseudomonas or Bacillus.
[0016] In a seventh aspect, the present invention provides the use of the recombinant vector described in the fifth aspect or the recombinant microorganism described in the sixth aspect in regulating the grain shape, appearance quality and / or yield of rice.
[0017] In an eighth aspect, the present invention provides a method for cultivating transgenic long-grain rice, which uses transgenic methods to transform the nucleotide sequence encoding the GL8 gene into recipient rice, increases the expression level of the GL8 gene in the recipient rice, and obtains transgenic rice with improved grain shape, appearance quality and yield.
[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0019] The present invention has discovered the coding gene GL8 related to rice grain shape, appearance quality and / or yield. Experiments have shown that under the conditions of enhanced function or increased expression level of the coding gene GL8 related to rice grain shape, appearance quality and / or yield, long-grain rice can be obtained, thus proving that the rice-related coding gene GL8 or its protein plays an important role in controlling rice grain shape, appearance quality and / or yield. The present invention not only provides a basis for further elucidating the molecular mechanism of rice grain shape, appearance quality and / or yield, but also provides new gene resources and breeding resources for rice breeding. The GL8 gene-enhanced transgenic rice obtained in the present invention, as a new rice germplasm material, can be used to study the mechanism of rice grain shape, appearance quality and / or yield and discover more genes that regulate rice grain shape, appearance quality and yield, and has important application value for effectively regulating rice grain shape by genetic breeding and genetic engineering methods using this gene resource. Description of the Drawings
[0020] Figure 1 (Schematic diagram of the overexpression levels of GL8-OE1, GL8-OE2, and GL8-OE3 plants and the parental rice Nipponbare);
[0021] Figure 2 Schematic diagram of grain length comparison of transgenic rice with overexpression of the coding gene GL8 related to rice grain shape, appearance quality or / and yield. Detailed implementation manners
[0022] To better illustrate the purpose, technical solution and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.
[0023] Example 1
[0024] Construction of overexpression vector for genes related to rice grain shape, appearance quality or / and yield:
[0025] 1. Construction of overexpression vector
[0026] 1.1 Obtaining of GL8 gene
[0027] Using the DNA of common wild rice Y12 (Oryza rufipogon Griff.) as a template, the target gene was obtained by PCR amplification with the following primers primer1 and primer2:
[0028] primer1: 5'-ATGGCCGGCGTGGGCGTGGTAGTAG-3' (SEQ ID No.2);
[0029] primer2: 5'-TTACAAATCCGTTTGAGATGAGACG-3' (SEQ ID No.3).
[0030] After recovering and purifying the PCR product, it was ligated into a Zero sequencing vector (purchased from TransGen Biotech Co., Ltd., Beijing), transformed into DH5α competent cells, and after selecting positive clones, sequencing was performed.
[0031] The sequencing results showed that the sequence of the PCR product was as shown in SEQ ID No.1, with a length of 1347bp, and it was named GL8 gene.
[0032] ATGGCCGGCGTGGGCGTGGTAGTAGATCCGGAGGCGGTGGGCGGCGGTGGAGATGGGCGGATGAAGGAAGGGTTGGCGCGGCGGGCGGTGGAAAACCTGAGGTTCCGGTCGGTGTGGGGCGAGGTGAACGGCGCCATGGGCGACCTCGGGACGTACATCCCCATCGTGCTGTCGCTGGCGCTGTCCCGGCAGCTGGACCTCGGCACCACCCTCGTCTTCACCGGCATCTACAACGCCATCACCGGCCTCCTCTACGGCGTCCCCATGCCCGTCCAGCCCATGAAGTCCATCGCCGCCGCCGCCCTCGCC.ACCCCTCCTTCGCCATCCC.GGAGATCATGGCCGCCGGC ATCCTCACCG.CCGCCTTCGTCCTCTTCCTCGGCCTCACCCGCCTCATGGAC CTCGTCTACCGCTTCGTCCCGCTCTCCGTCGTGCGTGGCATCCAGCTCGCCCAGGGCCTCAACTTCGCCATGGCCGCCGTCAAGTACATACGCTACGAGCAGGACTTGGGCAAGGGCAAGTCCCTCGGGCGGCGCCCCTGGGTGGGCCTCGACGGCCTCGTGCTCGCCATCGCGGCGGTCTGCTTCATCGTGCTCGTCAACGGGGCCGGAGAAGAGCAGGAGCAGCGTCAGCAGCAGCAACAGTGGTGGCGTCGTCGGTTGGGTTCCGTTCCTTCGGCTGTGGTGGTGTTCGTGGTGGGCGTTGCGTTCGCGGTGGCGCGTCACCCAGCGGCGGTGAGGGAGCTGCGCGCTGGGCCGTCGCGGATGCGGGTGGTGCACATCTCTCGGGAGGCGTGGAAGCAAGGGTTCATCAAGGGCGCGCTGCCGCAGATCCCGCTGTCGGTGCTCAACTCGGTGGTGGCGGTGTGCAAGCTGACGCGCGACCTGTTCCCGGAGCGGAAGGAGTCGCCGACGTCGGTGTCGGTGACGATGGGAGCCATGAACCTGGTGGGGTGCTGGTTCGGCGCCATGCCGTGCTGCCACGGCGCGGGAGGGCTGGCGGGGCAGTACAAGTTCGGGGGGAGGAGCGGCGGGTGCGTGGCGGCGCTGGGCGTGCTGAAGCTGGCGCTGGGCCTGCTGCTGGGCGGCTCCATGCTGCGTGTCCTCGTCCAGTTCCCCGTCGGTCTTCTCGGCGCGCTGCTGCTGTTCGCCGGAGTGGAGCTCGCGGCGGCGGCGAGGGACATGTCCACGAGGGCGGAGGCGTTCGTGATGCTGCTGTGCACGGCGGTGTCGCTGGTGGGCTCCAGCGCCGCGCTCGGCTTCCTCTGCGGGATGCTCGCCCACGCCCTTCTCTACCTCAGGGC.CTGCGCGCTCAGGGAACGCATCGTCTCATCTCAAACGGATTTGTAA(SEQ ID No.1).
[0033] 1.2 Construction of the overexpression vector (i.e., recombinant expression vector PMDC32 - OE - GL8) of the gene GL8 related to the grain type of common wild rice:
[0034] 1) Amplify the cDNA of wild rice using primer1 and primer2 to obtain the sequence of the GL8 gene, and ligate it to the vector Zero to obtain a positive clone of recombinant Zero - GL8. Digest the recombinant vector Zero - GL8 with restriction enzymes KpnI and PacI to obtain the OE - GL8 fragment;
[0035] 2) Digest the expression vector PMDC32 with restriction enzymes Kpn I and PacI to obtain the linear expression vector PMDC32, and recover this linear fragment; Integrate the fragment OE - GL8 obtained in step 1) into the linear expression vector PMDC32 by the method of homologous recombination directional cloning (for the specific method, refer to the PMDC32 instruction manual) to obtain the homologous recombination product 1 (i.e., PMDC32 - OE - GL8, the overexpression vector of the gene GL8 described in the present invention). Then transfer the homologous recombination product 1 into DH5α competent cells and culture overnight at 37°C;
[0036] 3) Sequence the recombinant vector PMDC32 - OE - GL8 obtained in step 2). The results show that this recombinant vector has inserted the nucleotide sequence shown in SEQ ID No.1 in the forward direction at the Kpn I restriction enzyme digestion site of the expression vector PMDC32, that is, the DNA sequence between the Kpn I and PacI recognition sites (recognition sequences) of PMDC32 has been successfully replaced with the DNA sequence shown in SEQ ID No.1.
[0037] 1.3 Transformation
[0038] Transform Escherichia coli by heat shock method: Take 5 μL of the recombinant vector PMDC32 - OE - GL8 and transform Escherichia coli by heat shock method. The specific steps refer to the Tiangen transformation kit.
[0039] 1.6 Verification by colony PCR
[0040] Pick single colonies in the ultra - clean workbench as templates for PCR amplification, and use the Taq DNA polymerase PCR amplification system and program.
[0041] 1.7 Plasmid extraction: Extract the plasmid and detect the concentration according to the instruction manual of the Tiangen plasmid mini - extraction kit to obtain the recombinant expression vector PMDC32 - OE - GL8.
[0042] Example 2
[0043] Overexpression Vector Transgenic Plants of Coding Gene GL8 Related to the Growth and Development of Rice Grain Shape and Identification of Transgenic Plants
[0044] I. Cultivation of GL8 Gene Overexpression Transgenic Plants
[0045] The recombinant vector PMDC32 - OE - GL8 was transformed into Nipponbare japonica rice mediated by Agrobacterium tumefaciens EHA105, and the specific method is as follows:
[0046] 1. Plasmid Transformation:
[0047] The recombinant vector PMDC32 - OE - GL8 obtained in Example 1 was introduced into Agrobacterium tumefaciens EHA105 by heat shock method to obtain recombinant Agrobacterium tumefaciens EHA105 containing the recombinant vector PMDC32 - OE - GL8; the recombinant Agrobacterium tumefaciens EHA105 containing the recombinant vector PMDC32 - OE - GL8 was cultured at 28 °C for 16 h, and the bacterial cells were collected; the bacterial cells were diluted with N6 liquid medium (Sigma, product catalog number C1416) containing 100 μM acetosyringone to obtain a diluted bacterial solution, and the OD600 of the diluted bacterial solution was approximately 0.5;
[0048] 2. Infection:
[0049] The mature embryo embryogenic callus of Nipponbare japonica rice cultured for one month was mixed with the diluted bacterial solution obtained in Step 1 and infected for 30 min. After sucking dry the bacterial solution with filter paper, it was transferred to N6 solid co - culture medium and co - cultured at 24 °C for 3 d to obtain the callus after co - culture treatment;
[0050] 3. Screening:
[0051] 3.1 The callus after co - culture treatment in Step 2 was inoculated on N6 solid screening medium containing 150 mg / L hygromycin (hygromycin was added to N6 solid medium to obtain N6 solid screening medium, and the mass concentration of hygromycin in N6 solid screening medium was 150 mg / L) for the first screening;
[0052] 3.2 On the 16th day from the start of the first screening, healthy callus was picked and transferred to N6 solid screening medium containing 200 mg / L hygromycin (hygromycin was added to N6 solid medium to obtain N6 solid screening medium, and the mass concentration of hygromycin in N6 solid screening medium was 200 mg / L) for the second screening, and sub - cultured every 15 days for a total of 1 sub - culture to obtain resistant callus;
[0053] 4. Differentiation Culture to Obtain Overexpression Positive Plants:
[0054] Transfer the resistant callus obtained in step 3 to a differentiation medium containing 150 mg / L hygromycin (differentiation medium: 2 mg of 6-BA, 0.2 mg of NAA, 4 g of N6, 1 g of casein hydrolysate, 0.1 g of inositol, 25 g of sucrose, 2.4 g of sorbitol, 7 g of agar powder, 1 L of deionized water) for differentiation. Incubate at 24 °C for 45 days (at this time, the height of the above-ground part of the plant is about 15 cm). Open the bottle mouth to acclimatize the seedlings for 3 days, and then transplant them to the greenhouse for cultivation, which is the transgenic PMDC32-OE-GL8 plant (denoted as the T0 generation). Name different transformation events (transformed into different calli) as N-OE1, N-OE2, and N-OE3, respectively, representing overexpressed positive plants transformed with the recombinant vector PMDC32-OE-GL8. Name the obtained plants as GL8-OE1, GL8-OE2, and GL8-OE3 plants.
[0055] II. PCR identification of GL8 transgenic plants:
[0056] Extract the genomic DNA of the T0 generation seedlings of the above-mentioned GL8-OE1, GL8-OE2, and GL8-OE3 plants and the receptor parent rice Nipponbare plant seedlings, and perform PCR molecular detection using primers primer1 and primer2 to identify positive seedlings. After verification by fluorescence quantitative PCR, the homozygous plants with increased expression levels of the sequence are the above-mentioned GL8-OE1, GL8-OE2, and GL8-OE3.
[0057] primer1: 5'-ATGGCCGGCGTGGGCGTGGTAGTAG-3' (SEQ ID No.2)
[0058] primer2: 5'-TTACAAATCCGTTTGAGATGAGACG-3' (SEQ ID No.3)
[0059] PCR system:
[0060] 5 μl of PCR SuperMix (+dye), 1 μl of primer3 at 100 ng / ml, 1 μl of primer4, 1 μl of DNA, 2 μl of ddH2O Amplification program:
[0061] 94 °C for 2 min;
[0062] ↓
[0063] 98 °C for 10 sec;
[0064] 55 °C for 30 sec;
[0065] 68℃ for 1 min / kb, 25 - 40 cycles.
[0066] III. Identification of the GL8 gene expression level in GL8 transgenic plants:
[0067] Extract the RNA from the leaves of the T0 generation seedlings of the above GL8-OE1, GL8-OE2, and GL8-OE3 plants and the receptor parent rice Nipponbare plant (abbreviated as Nip in the attached figure). Set the internal reference as Actin, and use the internal reference primers Actin-F and Actin-R, as well as the GL8 gene-specific quantitative primers GL8-qRT-F and GL8-qRT-R to perform fluorescence quantitative PCR reactions to detect the changes in the GL8 gene expression levels of different transgenic plants.
[0068] The results showed ( Figure 1 ), in the positive plants transfected with the recombinant vector PMDC32-OE-GL8, the expression levels of the GL8 gene were all significantly increased compared with those of the control plants (Nip). The above primers are as follows:
[0069] GL8-qRT-F: 5’-GCGTGGTAGTAGATCCGGAG-3’ (SEQ ID No.4)
[0070] GL8-qRT-R: 5’-CGGTGATGGCGTTGTAGATG-3’ (SEQ ID No.5)
[0071] Actin-F: 5’-ATTTGGCACCACACATTCTAC-3’ (SEQ ID No.6)
[0072] Actin-R: 5’-ATAACCTTCGTAGATTGGGACT-3’ (SEQ ID No.7)
[0073] IV. Phenotypic identification of GL8 transgenic plants
[0074] Plant the GL8-OE1, GL8-OE2, and GL8-OE3 plants and Nipponbare (abbreviated as Nip) in the Hainan experimental base respectively, and observe the phenotypic differences in the grain shape of the GL8-OE1, GL8-OE2, and GL8-OE3 plants and Nipponbare during the whole growth period.
[0075] The measurement and observation results are shown in Table 1. Figure 2As shown, compared with the Nipponbare plants (NiP), the PMDC32-OE-GL8 plants (GL8-OE1, GL8-OE2, GL8-OE3) all showed a phenotype of significantly longer rice grain length than the control group (NiP) (P < 0.05), thus proving that the GL8 gene is involved in controlling the grain shape, appearance quality, and / or yield of rice, that is, the GL8 gene is a gene related to rice grain shape, appearance quality, and / or yield, and overexpression of the GL8 gene can significantly increase the grain length of rice.
[0076] Table 1: Grain length performance of overexpressing plants of the coding gene GL8 related to rice grain shape growth and development
[0077] Number Grain length (mm) Standard error of grain length (mm) Nipponbare 7.47 0.07 GL8-OE1 7.72 0.10 GL8-OE2 7.65 0.05 GL8-OE3 7.74 0.08
[0078] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. A gene GL8 for controlling rice grain shape, appearance quality or / and yield, characterized in that, The gene has a nucleotide sequence as follows (a) or (b): (a) Composed of the nucleotide sequence shown in SEQ ID No:1; (b) A nucleotide sequence generated by adding, substituting or deleting one or several bases to the nucleotide sequence shown in SEQ ID No:1 and encoding a functional protein for rice grain shape, appearance quality and yield.
2. Use of the GL8 gene according to claim 1 in regulating rice grain shape, appearance quality or / and yield.
3. The application according to claim 2, wherein The GL8 gene controls rice grain shape, appearance quality or / and yield by overexpression.
4. A protein for controlling rice grain shape, appearance quality and / or yield, characterized in that, The protein is encoded by the gene according to claim 1.
5. Use of the protein according to claim 4 in regulating rice grain shape, appearance quality or / and yield.
6. A recombinant vector, characterized in that, Containing the gene according to claim 1.
7. A biological material, characterized in that, Containing the recombinant vector according to claim 6.
8. The biomaterial according to claim 7, characterized in that, The biological material is a recombinant microorganism, a transgenic plant cell line or a transgenic plant tissue; the recombinant microorganism is a bacterium, yeast, alga or fungus; the bacterium is one of Escherichia, Erwinia, Agrobacterium tumefaciens, Flavobacterium, Alcaligenes, Pseudomonas or Bacillus.
9. Use of the recombinant vector according to claim 6 or the recombinant microorganism according to claim 7 in regulating rice grain shape, appearance quality or / and yield.
10. A method for cultivating long-grain transgenic rice, characterized in that, The method uses a transgenic method to transform the nucleotide sequence encoding the GL8 gene into the recipient rice, increases the expression level of the GL8 gene in the recipient rice, and obtains transgenic rice with long grain shape, appearance quality and yield.
Citation Information
Cited By
Gene for controlling grain length of rice and breeding method for increasing grain length of rice
CN120796315A
A gene for controlling grain length of rice and a breeding method for increasing grain length of rice
CN120796315B