Application of character regulation haplotype based on NY-Ys-QT12 in indica-japonica subspecies differentiation and quality heat resistance improvement

Abstract

The invention relates to an application of a character regulation haplotype (TRHs) based on an NY-Ys-QT12 molecular module in indica-japonica subspecies differentiation and quality heat resistance improvement. According to the invention, 45 TRHs are identified from common selection variation of four genetically unlinked genes of NF-Ys (NF-YA8, NF-YB9 and NF-YC10) and QT12, and universal differences of geographical location distribution, quality, yield and quality heat resistance between indica and japonica are explained. And the genetic contribution of the TRHs to the quality, yield and quality heat resistance of the rice is far higher than the respective independent contribution of the four components. The invention provides a brand new insight for the heat resistance differentiation of indica-japonica subspecies, provides a brand new concept breeding strategy to break the contradictory balance between stress and growth and between yield and quality, and provides a new universal concept for fine regulation and control, genetic diversity interpretation and genetic breeding of agricultural biological traits.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular breeding, and specifically relates to the application of trait regulating haplotypes (TRHs) based on the NY-Ys-QT12 molecular module in the differentiation of indica and japonica subspecies and the improvement of quality and heat resistance. Background Art

[0002] Asian and African countries face severe challenges in high-quality rice breeding, which directly leads to the low proportion of high-quality rice varieties in the world and their lack of market competitiveness. The reason is that most modern high-quality rice varieties have poor ability to maintain grain quality under high temperature stress and are difficult to maintain stable high-quality characteristics in high temperature environments. Since high-quality rice is difficult to obtain a high market price due to the decline in quality under high temperature conditions, farmers' enthusiasm for planting is suppressed, which in turn leads to a decline in rice production. Therefore, in order to meet this challenge, identifying germplasm resources that show stable heat resistance in a variety of natural high-temperature environments has become a key task in high-quality rice breeding. Haplotype breeding is a modern breeding strategy based on genomic haplotype information, which aims to accelerate the process of crop genetic improvement by mining and utilizing high-quality haplotype resources. With the rapid development of high-throughput sequencing technology and genomic analysis, haplotype breeding has become an important tool in the field of crop breeding. Its application background is mainly due to the limitations of traditional breeding methods, such as long cycles, low efficiency, and limited ability to improve complex traits. Haplotype breeding integrates genomics, bioinformatics and molecular marker-assisted selection technologies to accurately identify excellent haplotypes associated with target traits, and use these haplotypes for efficient gene aggregation and variety design. This method has shown significant advantages in increasing crop yield, stress resistance, quality improvement, etc., and has important application value in addressing climate change and food security challenges.

[0003] It is worth noting that due to long-term domestication and breeding selection, two major subspecies of rice, indica and japonica, have formed obvious adaptive differentiations to adapt to their respective geographical distributions and field environmental temperatures. Indica rice is mainly distributed in tropical and subtropical regions and adapts to warm or even high-temperature climate conditions, while japonica rice is mainly distributed in temperate and cool regions and shows stronger cold tolerance. This geographical and climatic adaptive differentiation makes indica rice have significant advantages in heat tolerance, while japonica rice is more prominent in cold tolerance. However, although there are significant differences in field temperature tolerance between indica and japonica rice, the underlying molecular mechanisms and genetic bases have not been fully elucidated. The differentiation of indica and japonica rice in heat tolerance may be closely related to the natural variation and expression regulation of heat tolerance-related genes in their genomes. For example, there may be some unique heat tolerance-related QTLs or genes in indica rice, which can enhance the plant's tolerance to high-temperature stress by regulating pathways such as cellular homeostasis, protein folding, and antioxidant defense under high-temperature conditions. In contrast, japonica rice may lack these heat tolerance-related genes or have weaker functions, resulting in higher sensitivity to high temperatures. In addition, differences in metabolic pathways, signal transduction networks, and epigenetic regulation between indica and japonica rice may also play important roles in their heat tolerance differentiation.

[0004] The significant differences in heat tolerance between indica and japonica rice not only reflect the results of their long-term adaptation to different climate conditions but also provide an important research model for analyzing the genetic and molecular mechanisms of rice heat tolerance. By deeply studying the potential mechanisms of heat tolerance differentiation between indica and japonica rice and combining modern molecular breeding techniques, it is expected to provide new gene resources and breeding strategies for cultivating high-quality rice varieties adapted to high-temperature environments, thus contributing to global food security and agricultural sustainable development. The present invention first proposes the concept of trait regulatory haplotypes (TRHs) composed of four heat tolerance regulatory genes, analyzes the molecular mechanisms of TRHs in indica-japonica subspecies differentiation, and the applications of TRHs in improving yield, quality, and quality heat tolerance traits. At the same time, a brand-new concept breeding strategy is provided, which can theoretically be applied to any trait of any species, providing a new general concept for the fine regulation of agricultural biological traits, the explanation of genetic diversity, and genetic breeding. Summary of the Invention

[0005] The object of the present invention is to disclose the applications of rice trait regulatory haplotypes (TRHs) in indica-japonica subspecies differentiation, quality traits, and quality heat tolerance improvement, and provide a brand-new concept breeding strategy, providing a new general concept for the fine regulation of agricultural biological traits, the explanation of genetic diversity, and genetic breeding.

[0006] To achieve the above object, the content involved in the present invention includes:

[0007] 1. The present invention provides that NF-YA8 negatively regulates the heat tolerance of rice quality by positively regulating the expression of QT12. High heat tolerance of quality is manifested as maintaining higher storage proteins, lower amylose, and low chalkiness (good appearance quality) phenotypes, while low heat tolerance of quality is manifested as decreased storage protein content, increased amylose, and increased chalkiness (poor appearance quality) phenotypes.

[0008] 2. The present invention provides that NF-YC10 genetically inhibits NF-YA8 to positively regulate the heat tolerance of rice quality. High heat tolerance of quality is manifested as maintaining higher storage proteins, lower amylose, and low chalkiness (good appearance quality) phenotypes, while low heat tolerance of quality is manifested as decreased storage protein content, increased amylose, and increased chalkiness (poor appearance quality) phenotypes.

[0009] 3. The present invention provides trait regulatory haplotypes (TRHs) formed by the co-segregation or co-selection of the G / A SNP and 6-bp InDel of QT12, the functional and non-functional haplotypes of NF-YC10, and the representative variations of NF-YA8 and NF-YB9 identified previously due to their genotype co-segregation or co-selection. The differentiation of different traits in organisms stems from the interactions between genes of related regulatory network members. The rich natural variation combinations on different genes form the diversity of species and the differences in traits. TRHs are haplotype combinations based on functional variations between trait regulatory networks and theoretically applicable to any phenotypic trait of any organism, which can provide new general concepts for the fine regulation of other agricultural biological traits, the interpretation of genetic diversity, and genetic breeding.

[0010] 4. The present invention provides that the functional variations or representative variations of four key genes regulating heat tolerance of quality co-segregate or co-select to form 45 trait regulatory haplotypes TRHs (TRH1 - TRH45), which are divided into two types of TRHs named TRH J (accounting for approximately 100% in the japonica rice subspecies) and TRH I (accounting for 100% in the indica rice subspecies), and the typing results of each haplotype are shown in Table 1. Different TRHs represent different combinations of functional variations of heat tolerance regulatory genes, and the general law of heat tolerance differences among different varieties can be explained by finely regulating the expression of QT12, thereby finely regulating the heat tolerance of quality.

[0011] 5. The present invention provides that the contribution rates of TRHs to yield (number of filled grains, number of spikelets, number of effective panicles, yield per plant, etc.), quality (chalkiness, head rice rate, protein content, etc.) and heat tolerance traits of quality are higher than the contribution rates of the above 4 quality heat tolerance-related genes (NF-YA8, NF-YB9, NF-YC10 and QT12) to different yield traits, quality traits and quality heat tolerance respectively.

[0012] 6. The present invention provides two main types of TRHs, namely TRH I and TRH J and their contributions to indica-japonica differentiation, yield, quality and heat tolerance phenotypes of quality, that is, TRH I has lower grain chalky area, chalkiness degree, storage protein content, gel consistency and alkali spreading value compared with TRH J while having higher amylose content, head rice rate, fatty acid C16:0 and heat tolerance of quality.

[0013] 7. Any molecular markers (including SNPs, CAPS, KASP, etc.) designed using the main variations among TRHs and their use in molecular marker-assisted breeding or gene editing techniques to introduce / replace the main variations of the 4 genes in TRH I into the variations in TRH J to improve the heat tolerance of rice under field high temperature, that is, to better maintain the steady-state balance of storage substances such as rice storage protein and amylose, and quality traits such as low chalkiness (good appearance quality) under high temperature, while increasing yield, etc. The main variation sequences in the said TRH I are shown in Table 1.

[0014] 8. Any molecular markers (including SNPs, CAPS, KASP, etc.) designed using the main variations among TRHs and their use in molecular marker-assisted breeding or gene editing techniques to introduce / replace the main variations of the 4 genes in TRH J into the variations in TRH I to reduce the heat tolerance of rice under field high temperature, that is, to reduce rice storage protein and increase amylose content under high temperature, resulting in the breakage of the steady-state balance of storage substance content and thus showing high chalkiness (poor appearance quality), while reducing yield, etc. The main variation sequences in the said TRH I are shown in Table 1.

[0015] 9. The application of TRHs in yield, quality and heat tolerance of quality. The two main haplotypes TRH42 and TRH43 in TRH I and TRH JThe important roles of the two main haplotypes, TRH13 and TRH20, in the yield and quality heat tolerance traits of the core germplasm materials: Compared with TRH13 and TRH20, the varieties with TRH42 and TRH43 haplotypes showed lower QT12 expression levels, higher quality heat tolerance, and a phenotype of increased yield. By finely regulating the expression of QT12 through different combinations of TRHs, precise regulation of heat tolerance traits was achieved.

[0016] 10. Application of TRHs in improving rice yield, quality, and quality heat tolerance: It includes any molecular markers (including SNPs, CAPSs, and KASPs, etc.) designed using the main variations among TRHs and their use in marker-assisted breeding or gene editing techniques to introduce / replace the two main haplotypes, TRH42 and TRH43, in TRH I with the two main haplotypes, TRH13 and TRH20, in TRH J to improve the heat tolerance of rice in the field under high temperature, that is, to better maintain the steady-state balance of storage substances such as rice storage proteins and amylose, and quality traits such as low chalkiness (good appearance quality) under high temperature, while increasing the yield, etc. The main variant sequences of the four genes in the two main haplotypes, TRH42 and TRH43, in the said TRH I are shown in Table 1.

[0017] 11. Application of TRHs in reducing rice yield, quality, and quality heat tolerance: It includes any molecular markers (including SNPs, CAPSs, and KASPs, etc.) designed using the main variations among TRHs and their use in marker-assisted breeding or gene editing techniques to introduce / replace the two main haplotypes, TRH13 and TRH20, in TRH J with the two main haplotypes, TRH42 and TRH43, in TRH I to reduce the heat tolerance of rice in the field under high temperature, that is, to reduce the rice storage protein and increase the amylose content under high temperature, resulting in the breakdown of the steady-state balance of storage substances and showing high chalkiness (poor appearance quality), while reducing the yield, etc. The main variant sequences of the four genes in the two main haplotypes, TRH13 and TRH20, in the said TRH J are shown in Table 1.

[0018] Specifically, the present invention provides genes NF-YA8, NF-YB9, NF-YC10, and QT12, and the application of the proteins encoded thereby, expression cassettes, recombinant vectors, and recombinant microorganisms containing the same in regulating the heat tolerance of rice quality under high field temperature. The amino acid sequence encoded by the NF-YA8 gene is as shown in SEQ ID NO.11, the amino acid sequence encoded by the NF-YB9 gene is as shown in SEQ ID NO.12, the amino acid sequence encoded by the NF-YC10 gene is as shown in SEQ ID NO.13, and the amino acid sequence encoded by the QT12 gene is as shown in SEQ ID NO.14. Among them, NF-YA8 negatively regulates the heat tolerance of rice quality by positively regulating the expression of QT12, and NF-YB9 and / or NF-YC10 positively regulate the heat tolerance of rice quality by negatively regulating the expression of QT12.

[0019] The present invention also provides a method for regulating the heat tolerance of rice quality under high field temperature, which affects the expression level of the QT12 gene by regulating the expression of the NF-YA8, NF-YB9, and / or NF-YC10 genes, so as to achieve the purpose of regulating the heat tolerance of rice quality under high field temperature. The amino acid sequence encoded by the NF-YA8 gene is as shown in SEQ ID NO.11, the amino acid sequence encoded by the NF-YB9 gene is as shown in SEQ ID NO.12, the amino acid sequence encoded by the NF-YC10 gene is as shown in SEQ ID NO.13, and the amino acid sequence encoded by the QT12 gene is as shown in SEQ ID NO.14.

[0020] Furthermore, NF-YA8 negatively regulates the heat tolerance of rice quality by positively regulating the expression of QT12, and NF-YB9 and / or NF-YC10 positively regulate the heat tolerance of rice quality by negatively regulating the expression of QT12.

[0021] The present invention also provides a molecular marker combination for identifying or assisting in identifying indica-japonica subspecies differentiation and / or for improving the heat tolerance of rice quality. The molecular marker combination involves multiple variant sites of the QT12, NF-YA8, NF-YB9, and NF-YC10 genes, specifically the combinations shown in A1)-A4):

[0022] A1) G / A SNP and 6-bp InDel of the QT12 gene. The G / A SNP is located at position -1455 upstream of the QT12 gene promoter, i.e., the 2372nd position of the sequence shown in SEQ ID NO.1, corresponding to the 3718373rd base on chromosome 12 of rice (reference genome version MSU version 7.0), with A / G polymorphism; the 6-bp InDel refers to positions 2828 - 2833 of the sequence shown in SEQ ID NO.1, corresponding to bases 3718829 - 3718834 on chromosome 12 of rice (reference genome version MSU version 7.0), with the presence or absence of a 6-bp (CGCCGC) deletion;

[0023] A2) 10 SNP sites of the NF-YA8 gene, located at positions -1431, -159, +293, +1717, +3138, +5148, +5150, +5265, +5350, +5731 of the NF-YA8 gene respectively, i.e., the 389th, 1661st, 2113th, 3537th, 4958th, 6968th, 6970th, 7085th, 7170th, 7551st positions of the sequence shown in SEQ ID NO.2, corresponding to physical positions on chromosome 10 of rice at 13392613, 13393885, 13394337, 13395761, 13397182, 13399192, 13399194, 13399309, 13399394, 13399775 respectively (reference genome version is MSU version 7.0);

[0024] A3) 12 SNP sites of the NF-YB9 gene, located at positions -1769, -1735, -1335, -1188, -248, -166, -158, +1602, +1699, +1790, +1903, +1924 of the NF-YB9 gene respectively, i.e., the 428th, 462nd, 862nd, 1009th, 1949th, 2031st, 2039th, 3799th, 3896th, 3987th, 4100th, 4121st positions of the sequence shown in SEQ ID NO.3, corresponding to physical positions on chromosome 6 of rice at 10136067, 10136101, 10136501, 10136648, 10137588, 10137670, 10137678, 10139438, 10139535, 10139626, 10139739, 10139760 respectively (reference genome version is MSU version 7.0);

[0025] A4) There are 7 different types of functional variations in the CDS region of the NF-YC10 gene. Among them, 4 Indels lead to frameshift mutations, and 3 SNPs lead to premature termination, all of which will cause NF-YC10 to lose its function. The original sites or functional sites of the 7 frameshift mutations or premature termination variations are at positions 2164-2168 (CATAG), 2377 (C), 2473 (T), 3003 (T), 3190 (C), 3249 (T), 3422-3423 (CA) of the sequence shown in SEQ ID NO:4, and the physical positions are at positions 13788488-13788492, 13788701, 13788797, 13789327, 13789514, 13789573, 13789746-13789747 on chromosome 1 of rice (reference genome version is MSU version 7.0). The 7 frameshift mutations or premature termination variations are mutated to C, T, TCTTATGA, TCGCAAGGGGACATATCC / TCGCAAGGGGACATA TCCA / TCGCAAGGGGACATATCCG / TCGCAAGGGACATATCCGGTGAAATGAGCTAA, T, A, C at the corresponding positions respectively, thus resulting in non-functional nf-yc10 (the sequence of the CDS region is shown in any of SEQ ID NO.5-10). Other genotypes that do not affect the overall function of NF-YC10 are named NF-YC10, and the functional wild-type NF-YC10 gene sequence is shown in SEQ ID NO.4.

[0026] Furthermore, according to multiple variation sites of the QT12, NF-YA8, NF-YB9, and NF-YC10 genes, rice is divided into different haplotype combinations, TRH1-TRH45 and / or haplotype TRH I / TRH J , as specifically shown in Table 1 of Example 6, where "-" indicates a 6bp base deletion, N indicates any unknown base (such as A or T or C or G), and D indicates a base deletion.

[0027] Furthermore, according to the haplotype results, TRH I is identified as indica rice, and TRH J is identified as japonica rice.

[0028] Furthermore, compared with TRH13 and TRH20, the grain quality heat damage index and the chalkiness degree of grains at high temperature of TRH42 and TRH43 are both lower, and the grain yield is higher while having a lower QT12 expression level.

[0029] The present invention also provides the application of the above molecular marker combination or the substance for detecting the molecular marker combination in any of the following

[0030] B1) Identifying or assisting in the identification of the indica-japonica subspecies differentiation of rice;

[0031] B2) Preparing products for identifying or assisting in the identification of the indica-japonica subspecies differentiation of rice;

[0032] B3) Identifying or assisting in the identification of the heat tolerance of the quality of rice germplasm;

[0033] B4) Preparing products for identifying or assisting in the identification of the heat tolerance of the quality of rice germplasm;

[0034] B5) Cultivating heat-tolerant rice germplasm with good quality;

[0035] B6) Preparing products for cultivating heat-tolerant rice germplasm with good quality;

[0036] B7) Improving the heat tolerance of the quality of rice germplasm;

[0037] B8) Preparing products for improving the heat tolerance of the quality of rice germplasm.

[0038] Furthermore, by detecting the above-mentioned molecular marker combination in rice, according to the detected haplotype results: C1) Identifying TRH I as indica rice and TRH J as japonica rice, or C2) Compared with TRH13 and TRH20, the heat damage index of grain quality and the chalkiness degree of grains at high temperature of TRH42 and TRH43 are both lower, and the grain yield is higher and the expression level of QT12 is lower at the same time, that is, selecting rice with haplotype results of TRH42 and TRH43 for variety improvement or cultivation.

[0039] The present invention also provides a method for identifying the indica-japonica rice differentiation and / or improving the heat tolerance of the quality of rice germplasm, including detecting the above-mentioned molecular marker combination in rice,

[0040] C1) When the detected haplotype result is TRH I , it is identified as indica rice, and when the detected haplotype result is TRH J , it is identified as japonica rice; or, C2) Compared with TRH13 and TRH20, the heat damage index of grain quality and the chalkiness degree of grains at high temperature of TRH42 and TRH43 are both lower, and the grain yield is higher and the expression level of QT12 is lower at the same time, that is, preferably selecting rice with haplotype results of TRH42 and TRH43 for variety improvement or cultivation.

[0041] The present invention also provides a method for improving the heat tolerance of rice quality, including: D1) Introducing or replacing the variation of the above-mentioned haplotype TRH I into or with the haplotype TRH Jthe mutations in [it]; and / or, D2) introducing or replacing the mutations in TRH13 or TRH20 with the mutations of the above haplotype TRH42 or TRH43.

[0042] Beneficial effects: Compared with the prior art, the present invention firstly proposes the concept of trait regulatory haplotypes (TRHs) in rice, discloses the contributions of TRHs to the differentiation of indica and japonica subspecies, yield traits, quality traits and quality heat tolerance, analyzes the genetic and molecular mechanism of the difference in quality heat tolerance between indica and japonica subspecies, provides new gene resources for high-quality and high-yield breeding of rice under high temperature, and provides a brand-new concept breeding strategy, providing a new general concept for the fine regulation of agricultural biological traits, the explanation of genetic diversity, and genetic breeding. Brief Description of the Drawings

[0043] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention, and thus should not be regarded as limiting the scope. For those of ordinary skill in the art, other related drawings can be obtained based on these drawings without creative efforts.

[0044] Figure 1 is the interaction among NF-YA8, NF-YB9 and NF-YC10. a, The Split-LUC experiment verifies the interaction among NF-YA8, NF-YB9 and NF-YC10. GUS-nLUC and cLUC-GUS are used as negative controls. "C-8", "N-9", "N10" and "C-10" represent cLuc-NF-YA8, nLuc-NF-YB9, nLuc-NaF-YC10 and cLuc-NF-YC10 respectively. b, The Pull-down experiment verifies the interaction among NF-YA8, NF-YB9 and NF-YC10. c, The Co-IP experiment of the interaction between NF-YA8 and NF-YB9 and NF-YC10 is carried out using the nuclear protein of 5-DAF endosperm. The separated and purified nuclear protein is confirmed by immunoblotting using anti-Actin and anti-H3.1 antibodies.

[0045] Figure 2Expression of QT12 in NF-YA8, NF-YB9, and NF-YC10 genetic materials. a, Expression levels of QT12 in the developing endosperm of NF-YA8 overexpression lines and mutant lines at 5 DAF under different temperature conditions. b and c, Expression levels of QT12 and NF-YA8 in the leaves of different NF-YA8 overexpression lines. r is the correlation coefficient between the relative expression levels of NF-YA8 and QT12. d, Expression levels of QT12 in the developing endosperm of NF-YB9 knockout lines and overexpression lines at 5 DAF. e, Expression levels of QT12 in the endosperm of NF-YC10 overexpression and mutant lines at 5 DAF and 10 DAF.

[0046] Figure 3 In vitro EMSA binding assay of NF-YA8 protein to DNA fragments containing CCAAT elements or variant elements on the QT12 promoter, where 250×, 500×, and 750× represent the concentration multiples of the competing probes added.

[0047] Figure 4 In vivo and in vitro experiments were conducted to verify the effects of NF-YB9 and NF-YC10 on the binding of NF-YA8 to QT12. a, In vitro EMSA binding assay of NF-YA8, NF-YB9, and NF-YC10 proteins to DNA fragments containing CCAAT elements or variant elements on the QT12 promoter. 1× and 2× represent the concentration multiples of the corresponding proteins added. b, The ability of NF-YA8 to bind to the QT12 CCAAT-box in the 5-DAF endosperm of different overexpression materials was detected by ChIP-qPCR. NF-YA8 / YB9-OE is a transgenic line that overexpresses NF-YA8-Flag and NF-YB9-Myc simultaneously. NF-YA8 / YC10-OE is a transgenic line that overexpresses NF-YA8-Myc and NF-YC10-Flag simultaneously. NF-YA8 / YB9 / YC10-OE is a triple-overexpression line generated by crossing the NF-YA8 / YB9-OE and NF-YC10-OE lines. No antibody and the P2 fragment in the intron region of QT12 were used as negative controls for the experiment.

[0048] Figure 5 Luc-Ren experiment was conducted to verify the inhibitory effect of NF-YB9 and NF-YC10 on the transcriptional activation activity of NF-YA8 on QT12.

[0049] Figure 6To enhance the binding activity of NF-YA8 to QT12 at high temperature. a, EMSA binding assays of NF-YA8, NF-YB9, and NF-YC10 with a DNA fragment containing the CCAAT element at different temperatures. b and c, Repeated EMSA experiments at two temperatures. The numbers below the binding probes are the sample numbers for each. d, EMSA binding assays of NF-YA8 with DNA fragments containing the CCAA T motif (Probe-G) and the mutant motif (Probe-A) at different temperatures. The numbers below the binding probes are the treatment temperatures.

[0050] Figure 7 To enhance the in vivo binding and transcriptional activities of NF-YA8 to QT12 at high temperature. a, ChIP-qPCR in vivo binding assays of NF-YA8 to the CCAAT-box of QT12 in the endosperm of NF-YA8-Flag overexpressing plants at 5 DAF under different natural temperatures. b, Transient dual-luciferase assays at different temperatures.

[0051] Figure 8 To inhibit the interaction between NF-YA8 and NF-YB9 / NF-YC10 at high temperature. a, Split-LUC interaction assays of NF-YA8, NF-YB9, and NF-YC10 under different temperature treatments. b, Fluorescence quantification analysis of Splic-LUC using ImageJ software. c, Co-IP interaction assays between NF-YA8 and NF-YB9 / NF-YC10 at different field temperatures. Samples of the endosperm of ZH11, NF-YB9-OE(FLAG), and NF-YC10-OE(FLAG) at 5 DAF were taken at high and normal field temperatures. d, Pull-down experiments were used to verify the interaction between NF-YA8 and NF-YB9 and NF-YC10 at different laboratory temperatures. Proteins were detected by immunoblotting using specific antibodies against GST and MBP.

[0052] Figure 9 NF-YA8 genetically acts upstream of QT12. a, The chalkiness degree, storage protein content, amylose content, and the ratio of protein to amylose after overexpressing QT12 in the NF-YA8 mutant background under natural high temperature conditions. b, Heat damage indices of grain quality for micro-core germplasms with different expression levels of QT12 and NF-YA8. The first two sets of data to the left of the dashed line are based on germplasms with extreme expression levels of QT12 and NF-YA8 among 120 micro-core germplasms; the last two sets of data to the right of the dashed line are obtained by dividing the 120 germplasms into two categories of low and high expression levels of QT12, and analyzing the relationship between the extreme expression levels of NF-YA8 and the heat tolerance phenotype in the backgrounds of high and low expression germplasms of QT12, respectively.

[0053] Figure 10 NF-YC10 genetically inhibits NF-YA8. Grain chalkiness degree, storage protein content, amylose content, and the ratio of protein to amylose in NF-YA8 and NF-YC10 single overexpression and double overexpression families under natural high temperature.

[0054] Figure 11 Genetic interaction analysis between NF-YC10 and QT12. a, Epistatic effects of NF-YC10 and QT12 in 533 accessions of the mini-core collection under normal and high temperatures. b, Chalky rice rate of four different haplotype combinations of NF-YC10 and QT12 under normal and high temperatures. 'A-yc10', 'A-YC10', 'G-yc10', and 'G-YC10' are genotypes of QT12 A with nf-yc10, QT12 A with NF-YC10, QT12 G with nf-yc10 and QT12 G and genotype combinations of NF-YC10.

[0055] Figure 12 Two major trait-regulating haplotypes (TRHs) contribute greatly to indica-japonica differentiation. a, Phylogenetic analysis and distribution of 45 TRHs. The two pie charts below show the frequency distributions of indica and japonica in two TRH groups (TRH I and TRH J ). Composite haplotypes formed by natural variations co-selected by NF-YA8, NF-YB9, NF-YC10, and QT12 are called TRHs. b, Expression levels of QT12 between TRH I and TRH J in 5-DAF endosperm of 120 accessions. c, Distributions of TRH I and TRH J in the top 250 accessions with the highest latitude and the top 250 accessions with the lowest latitude. d, Latitude and longitude distributions of TRH I and TRH J accessions.

[0056] Figure 13 Haplotype analysis of four major TRHs. Heat tolerance, grain chalkiness degree, yield per plant, and QT12 expression levels of four major TRH accessions with the same QT12 G genotype in 533 accessions of the mini-core collection in 2013 (high temperature) and 2014 (normal temperature).

[0057] Figure 14 Contributions of TRHs to quality and yield. a, TRH I and TRH JGrain quality traits. b, Genetic contributions of QT12, NF-YA8, NF-YB9, NF-YC10, and TRHs to rice quality and yield traits among 533 rice mini-core germplasms. Three types of grain chalkiness phenotypes were from the high-temperature environment in Wuhan in 2013. The phenotypic contribution rate (PVE) was determined by one-way ANOVA.

[0058] Figure 15 Haplotype analysis of QT12.

[0059] Figure 16 Haplotype analysis of NF-YA8.

[0060] Figure 17 Haplotype analysis of NF-YB9.

[0061] Figure 18 Functional and non-functional natural variation types of NF-YC10, where nf-yc10 is a non-functional natural variation. Specific implementation manners

[0062] The following examples are only used to illustrate the technical solutions of the present invention more clearly, so they are only examples and cannot be used to limit the protection scope of the present invention. It should be noted that unless otherwise specified, the technical terms or scientific terms used in this application should be the ordinary meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field. Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0063] Example 1: Field natural high-temperature treatment during the rice filling stage

[0064] To subject each rice genetic material to natural high temperature and normal temperature treatments during the filling period, we planted each genetic material in batches according to the sowing time, adjusted the planting time for each material according to the length of its heading period, generally sowing once every half month or so, and tried to ensure that the heading and early filling stages were during the high temperature period in the Wuhan fields. For materials with a longer heading period (>95 days), they were usually sown in the middle or late April; for materials with a shorter heading period (<80 days), they were sown around mid-May. Different sowing dates enabled genetic materials with different growth periods to start heading and filling in the middle or late July or early August. During this period, extreme high temperature weather exceeding 35°C often occurred in Wuhan, and this record has lasted for more than 60 years. For the normal temperature treatment experiment, all materials were sown in mid-June or at the end of June. In this way, short-heading materials usually started heading and filling in the first or second ten days of September, while long-growth period materials started heading and filling in the middle or late September. During this period, the average temperature in Wuhan was relatively low and normal (about 30°C). The dynamic air temperature data were automatically recorded every 5 minutes using a USB temperature and humidity recorder (USB-TH) in Huazhong Agricultural University from June to October and in the field of the Nanshan Base in Lingshui from February to May. The early filling stage is the most sensitive period for rice endosperm. Therefore, the daily average temperature during the 6 - 12 days after flowering in the early filling stage of each material was statistically analyzed, from 9 am to 7 pm. When the chalkiness rate of sensitive materials such as ZH11 increased significantly, it indicated that these materials had undergone high temperature treatment during the filling period. On the contrary, when sensitive wild-type materials still maintained a low grain chalkiness rate, it indicated that they filled under normal temperature.

[0065] Example 2: Quality Identification of Rice in the Field under Natural Temperature

[0066] Before examining appearance quality traits such as rice chalkiness, the harvested mature seeds were fully dried or sun-dried and stored at room temperature for at least three months. Rice chalkiness, including belly white, heart white, and back white, was generally detected by visual inspection. The mature and dry seeds were threshed and husked into brown rice. 100 intact rice grains were randomly selected, and the percentage of rice grains with chalkiness was counted and expressed as the grain chalkiness rate (GCR). The rice grains with chalkiness were laid flat and the percentage of the projected area of the chalky part in the projected area of the whole rice grain was visually inspected and expressed as the rice chalkiness area (GCA). The chalkiness degree (GCD) is the product of the grain chalkiness rate and the chalkiness area. All chalkiness traits were expressed as percentages. Chalkiness in rice would reduce the appearance, milling, cooking, and eating quality of rice as well as the head rice yield. Therefore, the increase in chalkiness is the most direct indicator of rice quality, and high temperature is extremely likely to cause sensitive changes in chalkiness. Therefore, lower rice chalkiness under high temperature indicates stronger high temperature tolerance of rice quality. The total protein content of brown rice grains and the amylose content of polished rice flour were measured using an XDS near-infrared rapid content analyzer (FOSS) and near-infrared reflectance spectroscopy.

[0067] Example 3: NF-YA8, NF-YB9 and NF-YC10 interact and regulate the expression of QT12 in different directions

[0068] Previously, it was found that NF-YA8 and QT12 negatively regulate the heat tolerance of rice quality, while NF-YB9 and NF-YC10 positively regulate the heat tolerance of rice quality, and their cooperative regulation mechanism is not yet clear. On this basis, the present invention further analyzes the molecular mechanism of these four genes:

[0069] (1) NF-YA8, NF-YB9 and NF-YC10 interact to form an NF-Y complex

[0070] The luciferase complementation assay (Split-LUC) showed that strong luciferase signals were generated when any two combinations of the three proteins NF-YA8, NF-YB9 and NF-YC10 were co-expressed in tobacco leaves, indicating that they can all interact in tobacco plants ( Figure 1 a). To further confirm their interactions, we expressed and purified fusion proteins with MBP and GST tags respectively in vitro, and found that NF-YA8, NF-YB9 and NF-YC10 can all interact in vitro using the GST pull-down assay ( Figure 1 b). At the same time, to determine the localization and interaction of these three proteins in the nucleus, we isolated and purified nuclear proteins from the 5-DAF endosperm tissues of wild-type ZH11, NF-YB9 overexpression lines and NF-YC10 overexpression lines respectively ( Figure 1 c). Using the Co-IP assay of endosperm nuclear proteins, we demonstrated that NF-YA8 can interact with NF-YB9 or NF-YC10 in the nucleus ( Figure 1 c), which is consistent with their protein localization characteristics as transcription factors. These results suggest that NF-YA8, NF-YB9 and NF-YC10 may form a complex to regulate the expression of downstream genes.

[0071] (2) NF-YA8 and NF-YB9 / NF-YC10 regulate the expression of QT12 in opposite ways

[0072] The expression level of QT12 in the 5-DAF endosperm of the NF-YA8-OE lines was significantly higher than that of wild-type ZH11, while it was significantly lower than that of ZH11 in the NF-YA8-CR lines ( Figure 2 a). Notably, compared with normal temperature, QT12 was up-regulated by high temperature induction in ZH11, but there was no significant change in the NF-YA8-CR lines, indicating that NF-YA8 is necessary for the up-regulation of QT12 expression by high temperature ( Figure 2a). Meanwhile, we also found that there was a highly positive correlation between the expression levels of NF-YA8 and QT12 in the leaves of the NF-YA8-OE family ([ Figure 2 b, c). These results indicate that NF-YA8 positively regulates the expression of QT12. When NF-YB9 was overexpressed, the expression level of QT12 decreased significantly, but it increased significantly in the NF-YB9-CR family ([ Figure 2 d), suggesting that NF-YB9 can negatively regulate the expression of QT12. In addition, RT-PCR results showed that the expression level of QT12 in the endosperm of the NF-YC10-OE family at 5-DAF and 10-DAF was significantly lower than that of the wild type ZH11, but showed the opposite trend in the NF-YC10-CR family ([ Figure 2 e), indicating that NF-YC10 negatively regulates the expression of QT12 in rice. Generally speaking, combined with the heat tolerance phenotypes of the genetic materials of these four genes in the early stage, we believe that NF-YA8 may negatively regulate the heat tolerance of rice quality by positively regulating the expression of QT12, while NF-YB9 or NF-YC10 positively regulates the heat tolerance of rice quality in the opposite way. Example 4: High temperature enhances the transcriptional activation of NF-YA8 on QT12 by releasing the inhibition of NF-YB9 and NF-YC10 on NF-YA8

[0073] (1) NF-YB9 and NF-YC10 can inhibit the transcriptional activation of NF-YA8 on QT12

[0074] In the NF-Y complex, the NF-YA subunit generally plays a role in directly binding to the cis-regulatory elements of downstream genes. Therefore, in order to verify whether NF-YA8, as the direct binding downstream subunit of this NF-Y complex, can bind to the CCAAT-box element at the functional G / A variation site of QT12 and differentially regulate its transcriptional process, we synthesized two 44-bp biotin-labeled probes and mutant probes respectively for in vitro gel shift assay (EMSA) ( Figure 3 ). These two probes respectively contain the CCAAT and TCAAT sequences of OM1723 and Chenghui448, and are named Probe-G and Probe-A, and the fusion proteins of NF-YA8, NF-YB9 and NF-YC10 were purified in vitro. When the MBP-NF-YA8 protein was incubated with the probe Probe-G with the complete CCAAT sequence, obvious migration binding bands could be detected, and when 250-fold, 500-fold and 750-fold excess unlabeled competitive probes were added respectively, the migration bands gradually weakened ([ Figure 3), indicating that NF-YA8 can directly bind to the CCAAT-box element on the QT12 promoter. In contrast, when the labeled probe Probe-A with a mutant sequence was used, only very weak migration bands were detected ( Figure 3 ). These results demonstrate that NF-YA8 can specifically recognize and bind to the CCAAT-box element on the QT12 promoter.

[0075] To investigate the effects of NF-YB9 and NF-YC10 on the binding activity of NF-YA8, we designed EMSA experiments in different combinations. When the NF-YC10 and NF-YB9 fusion proteins were added alone, they did not bind to the probe Probe-G by themselves. However, when NF-YC10 or NF-YB9 was added respectively after adding NF-YA8, the binding activity of NF-YA8 to QT12 was significantly weakened, and with the increase in the concentration of NF-YC10, the binding activity of NF-YA8 also gradually decreased ( Figure 4 a). This experiment shows that NF-YC10 and NF-YB9 do not have the binding ability by themselves, but can inhibit the binding activity of NF-YA8 to the QT12 promoter in vitro. To further verify this conclusion in vivo, we constructed double-overexpression materials and triple-overexpression materials with different combinations of NF-YA8, NF-YB9, and NF-YC10 for in vivo ChIP-qPCR experiments and obtained the same conclusion as the in vitro EMSA experiment ( Figure 4 b).

[0076] In addition, we constructed an in vivo dual-luciferase assay (Luc-Ren) vector system, using the QT12 promoter sequence of OM1723 as the target fragment and introducing a single-base variation of G–A to study the effect of the single-base variation on the CCAAT-box on its promoter activity ( Figure 5 ). The Luc-Ren experiment showed that there was no significant difference between the promoter activities of the complete CCAAT sequence QT12 G and the mutant sequence QT12 A . When NF-YA8 was co-expressed, the promoter activity of QT12 G with the complete CCAAT sequence increased significantly, while the promoter activity of QT12 A with the mutant sequence did not change significantly ( Figure 5 ). In addition, compared with the activity of the QT12 G promoter when only NF-YA8 was co-expressed, the relative activity of the QT12 G promoter decreased significantly after adding NF-YB9, NF-YC10, or both. However, single NF-YB9 or NF-YC10 had no obvious effect on the relative activities of the two promoters in the absence of NF-YA8.Figure 5 )。 These results are consistent with the previous results of EMSA and ChIP-qPCR, indicating that NF-YB9 and NF-YC10 can inhibit the binding ability and transcriptional activity of NF-YA8 on the QT12 promoter both in vivo and in vitro.

[0077] (2) High temperature enhances the activation of NF-YA8 on QT12 by inhibiting the interaction between NF-YA8 and NF-YB9 / NF-YC10

[0078] To study the effect of the three NF-Y subunits on the transcriptional regulation of QT12 under high temperature, we first performed EMSA experiments under different temperature conditions to verify whether the binding affinity of NF-YA8 to the QT12 promoter changed ( Figure 6 ). Multiple repeated EMSA experiments showed that as the temperature increased, the activity of the CCAAT-box element bound by NF-YA8 on the QT12 G promoter gradually increased, but it showed very weak binding activity to the probe of the mutant type QT12 A and did not increase with the increase of temperature ( Figure 6 ). After adding NF-YB9 or NF-YC10, the binding ability of NF-YA8 decreased significantly at different temperatures, but the level of decrease gradually weakened with the increase of temperature ( Figure 6 ), and these results are consistent with the previous inhibitory effect of NF-YB9 or NF-YC10 on the binding ability of NF-YA8 to the QT12 promoter.

[0079] ChIP-qPCR experiments on the endosperm of NF-YA8-OE overexpression lines at 5-DAF under different field temperatures proved that NF-YA8 can bind to the complete CCAAT sequence on the QT12 promoter in vivo, and its binding ability is further enhanced under high temperature conditions ( Figure 7 a). EMSA and ChIP-qPCR experiments confirmed in vivo and in vitro respectively that the ability of NF-YA8 to bind to the QT12 promoter was significantly enhanced under high temperature. Further Luc-Ren experiments showed that the promoter activity of OM1723 itself was not induced by high temperature, but when this promoter was co-transformed with NF-YA8, the promoter activity increased significantly, and this increase was further enhanced after high temperature treatment ( Figure 7 b). After adding NF-YB9 or NF-YC10, the activity of the OM1723 promoter decreased significantly, but the promoter activity under each combination increased significantly after high temperature treatment ( Figure 7 b). These results all indicate that NF-YB9 and NF-YC10 can inhibit the activation of NF-YA8 on QT12 G , while high temperature enhances the activation of NF-YA8 on QT12G Binding and transcriptional activities.

[0080] Since NF-YB9 and NF-YC10 can inhibit the binding activity of NF-YA8 to the QT12 promoter, and high temperature can enhance the binding and transcriptional ability of NF-YA8, it was further speculated whether high temperature could affect the interaction of these three transcription factors and thus regulate the transcriptional regulation ability of NF-YA8. Therefore, we used different experimental techniques to study whether their interaction was affected by high temperature ( Figure 8 ). First, multiple sets of repeated Split-LUC experiments showed that when NF-YA8 was co-expressed with NF-YB9, NF-YA8 was co-expressed with NF-YC10, and NF-YB9 was co-expressed with NF-YC10 in tobacco leaves respectively, the fluorescence intensity of the three combinations was significantly weakened under high temperature conditions, indicating that the interaction among the three was significantly weakened under high temperature conditions ( Figure 8 a, b). Subsequently, in vivo Co-IP experiments ( Figure 8 c) and in vitro pull-down experiments ( Figure 8 d) further confirmed this conclusion, that is, high temperature can inhibit the interaction between NF-YA8 and NF-YB9 or NF-YC10 in vivo and in vitro.

[0081] Example 5: Genetic relationship between NF-YA8, NF-YB9, NF-YC10 and QT12

[0082] To confirm the genetic upstream and downstream relationship between QT12 and NF-YA8, we constructed a QT12 overexpression material under the background of NF-YA8 knockout mutants and planted it under the natural high temperature conditions in Wuhan in 2023. Phenotypic investigation found that overexpression of QT12 under the background of NF-YA8-CR mutants led to a significant increase in grain chalkiness, and at the same time, the ratio of storage protein to amylose content decreased significantly, almost restoring the lower chalkiness phenotype after NF-YA8 mutation and reaching the high chalkiness phenotype level of ZH11 ( Figure 9 a), indicating that NF-YA8 acts upstream of QT12 genetically. Further analysis using 533 micro-core germplasms showed that germplasms with low expression levels of QT12 or NF-YA8 had lower grain quality heat injury indices and higher heat tolerance ( Figure 9 b). To study the role of QT12 in the heat tolerance function of NF-YA8, we divided the germplasms into two types with high and low expression levels of QT12. Among the germplasms with relatively low expression levels of QT12, no significant difference in heat tolerance was observed among germplasms with different expression levels of NF-YA8 ( Figure 9 b). However, among the varieties with relatively high expression levels of QT12, germplasms with low expression levels of NF-YA8 showed higher heat tolerance ( Figure 9b). These results indicate that NF-YA8 is important for the regulation of heat tolerance, but it depends on the strength of the QT12 function, suggesting that QT12 is at least a major downstream target gene of NF-YA8.

[0083] Meanwhile, we also constructed the double overexpression materials of NF-YA8 and NF-YC10. Compared with the NF-YA8 overexpression lines under high temperature, when NF-YC10 and NF-YA8 were overexpressed simultaneously, it was able to better maintain the balance of grain storage substances, significantly inhibited the formation of extreme high chalkiness caused by the overexpression of NF-YA8, and thus showed a lower chalkiness phenotype ( Figure 10 ), genetically proving the inhibitory ability of NF-YC10 on NF-YA8. These results together indicate that high temperature weakens the interaction between NF-YA8 and NF-YB9 or NF-YC10, releases the binding and transcriptional activation of NF-YA8 to QT12 G . Eventually, it leads to the disruption of the storage substance homeostasis and poor quality during endosperm development. To further study the genetic relationship between NF-YC10 and QT12, we performed phenotypic analysis on four haplotypes formed by combining two functional and non-functional haplotypes of NF-YC10 with two G / A haplotypes of QT12 in the micro-core germplasm ( Figure 11 ). Under normal temperature conditions in 2014, there was no significant difference in the chalkiness rate of grains between functional NF-YC10 and non-functional nf-yc10 regardless of whether QT12 was the A or G haplotype. However, under the natural high temperature conditions in Wuhan in 2013, only when QT12 was the G haplotype with a complete CCAAT-box binding site, the chalkiness rate of functional NF-YC10 was significantly lower than that of non-functional nf-yc10, indicating a significant epistatic interaction between these two genes ( Figure 11 ). These results suggest that NF-YC10 may negatively regulate the expression of QT12 through the complete CCAAT-box cis-element on the QT12 promoter, thereby inhibiting the formation of rice chalkiness under high temperature and endowing rice quality with heat tolerance.

[0084] Example 6: Discovery and identification of trait-regulating haplotypes (TRHs) of the combination of QT12, NF-YA8, NF-YB9, and NF-YC10

[0085] Since we previously found that QT12, NF-YA8, NF-YB9, and NF-YC10 are all involved in the thermotolerance differentiation of indica and japonica rice, and NF-Ys affect rice thermotolerance by regulating QT12. Considering the practical advantages of functional variations in breeding applications, we therefore used the G / A SNP and 6-bp InDel of QT12 in 4726 germplasms, the functional and non-functional haplotypes of NF-YC10, and the representative variations of NF-YA8 and NF-YB9 to perform combined haplotype analysis on these genes ( Figures 15 - 18 ).

[0086] Specifically, the G / A SNP of QT12 is located at position -1455 upstream of the QT12 gene promoter (corresponding to the 3718373rd base on chromosome 12 of rice, with the reference genome version being MSU version 7.0), showing A / G polymorphism, that is, there is an A / G variation at the 2372nd position of the sequence shown in SEQ ID NO.1; the 6-bp InDel refers to the presence or absence of a 6-bp (CGCCGC) deletion at positions 2828-2833 of the sequence shown in SEQ ID NO.1 (corresponding to the 3718829-3718834th bases on chromosome 12 of rice, with the reference genome version being MSU version 7.0).

[0087] The representative variations of NF-YA8 (LOC_Os10g25850) are a total of 10 SNP sites, located at positions -1431, -159, +293, +1717, +3138, +5148, +5150, +5265, +5350, +5731 of the NF-YA8 gene (where the first A of the promoter ATG is defined as +0), that is, the 389th, 1661st, 2113th, 3537th, 4958th, 6968th, 6970th, 7085th, 7170th, 7551st positions of the sequence shown in SEQ ID NO.2, and the physical positions are the 13392613th, 13393885th, 13394337th, 13395761st, 13397182nd, 13399192nd, 13399194th, 13399309th, 13399394th, 13399775th positions on chromosome 10 of rice, with the reference genome version being MSU version 7.0.

[0088] A total of 12 SNP sites are representative mutations of NF-YB9 (LOC_Os06g17480), which are located at positions -1769, -1735, -1335, -1188, -248, -166, -158, +1602, +1699, +1790, +1903, and +1924 of the NF-YB9 gene, that is, at positions 428, 462, 862, 1009, 1949, 2031, 2039, 3799, 3896, 3987, 4100, and 4121 of the sequence shown in SEQ ID NO.3. The physical positions are at positions 10136067, 10136101, 10136501, 10136648, 10137588, 10137670, 10137678, 10139438, 10139535, 10139626, 10139739, and 10139760 on chromosome 6 of rice, and the reference genome version is MSU version 7.0.

[0089] There are 7 different types of functional mutations in the CDS region of the NF-YC10 (LOC_Os01g24460) gene. Among them, 4 Indels lead to frameshift mutations, and 3 SNPs lead to premature termination, all of which will cause NF-YC10 to lose its function. The CDS sequences of the non-functional NF-YC10 gene caused by the above 7 frameshift mutations or premature termination mutations are shown in SEQ ID NO.5-10. The genotypes of these 7 types of mutations are named nf-yc10, and other genotypes that do not affect the overall function of NF-YC10 are named NF-YC10. The wild-type NF-YC10 gene sequence with function is shown in SEQ ID NO.4. Further, the original sites or functional sites of the above 7 frameshift mutations or premature termination mutations are at positions 2164-2168 (CATA G), 2377 (C), 2473 (T), 3003 (T), 3190 (C), 3249 (T), 3422-3423 (CA) of the sequence shown in SEQ ID NO.4. The physical positions are at positions 13788488-13788492, 13788701, 13788797, 13789327, 13789514, 13789573, 13789746-13789747 on chromosome 1 of rice, and the reference genome version is MSU version 7.0. The above 7 frameshift mutations or premature termination mutations are mutated to C, T, TCTTATGA, TCGCAAGGGGACATATCC / TCGC AAGGGGACATATCCA / TCGCAAGGGGACATATCCG / TCGCAAGGGACATATCCGGTGAA ATGAGCTAA, T, A, C at the corresponding positions respectively, thus resulting in non-functional nf-yc10.

[0090] Natural variations of these four genes that are genetically unlinked and located on different chromosomes are co-selected or co-segregated with each other in different varieties. These co-selected variations together form multiple haplotype combinations, called trait regulatory haplotypes (TRHs) (Table 1), which theoretically can effectively and diversely fine-tune the phenotypes of different traits and contribute to the formation or explanation of the genetic diversity of biological traits in nature.

[0091] Table 1: Haplotype combinations and subgroup distributions of 45 trait regulatory haplotypes (TRHs) composed of QT12, NF-YA8, NF-YB9, and NF-YC10 in 4726 rice germplasms worldwide

[0092]

[0093]

[0094]

[0095] Note: In this table, the haplotype sequences of NF-YA8 and NF-YB9 are combinations of the corresponding 10 and 12 representative variations respectively. Among them, - indicates a 6bp base deletion, N indicates any unknown base (such as A or T or C or G), and D indicates a base deletion.

[0096] Example 7: Trait regulatory haplotypes (TRHs) explain the general indica-japonica differentiation and geographical distribution

[0097] These co-selected variations divided the 4726 germplasms into 45 TRHs (TRH1–TRH45). Using MEGA11 for phylogenetic clustering analysis and the Neighbor-joining method with 1000 bootstrap replicates, these TRHs can be divided into two main TRH types, TRH J (18 TRHs) and TRH I (27 TRHs) ( Figure 12 a). In TRH J , the ratio of indica rice to japonica rice is 1:1279, where japonica rice accounts for approximately 100%, while TRH I is all indica rice ( Figure 12 a), which indicates that TRH I and TRH J can well represent the distributions of indica rice and japonica rice respectively. Using the 5-DAF endosperm expression data of 120 materials, we found that the expression of QT12 in TRH J (japonica rice) materials is much higher than that in TRH I(Indica rice) materials ( Figure 12 b). Subsequently, to study TRH J and TRH I characteristics in geographical distribution, we selected the top 250 varieties with the highest latitudes and the top 250 varieties with the lowest latitudes from the core germplasm for analysis, and found that TRH I accounted for 77.2% of the low-latitude germplasm, while TRH J accounted for 64.4% of the high-latitude germplasm ( Figure 12 c). Further analysis of the geographical distribution of 1073 germplasms showed that TRH I was mainly enriched in the low-latitude regions with higher temperatures, while TRH J was mainly distributed in the high-latitude regions with lower temperatures, and there was no significant difference in longitude ( Figure 12 d, e). These data indicate that the two main TRHs are highly differentiated between rice subspecies, which can explain the general differences in QT12 expression and geographical distribution between indica and japonica rice, and can effectively explain the genetic diversity of rice biological traits.

[0098] Example 8: TRHs explain the differentiation of heat tolerance in indica and japonica qualities

[0099] To verify whether TRH can be applied to heat tolerance improvement, we identified four main TRHs with the same QT12 G genotype: TRH J TRH13 and TRH20 containing the most germplasms, and TRH I TRH42 and TRH43 with the most germplasms, to evaluate their potential breeding value, especially in heat tolerance improvement ( Figure 13 ). The results showed that compared with japonica rice TRH13 and TRH20, the heat damage index of grain quality and the chalkiness degree of grains at high temperature of indica rice TRH42 and TRH43 were lower, but the grain yield was higher, and at the same time, there was a lower QT12 expression level ( Figure 13 ). These results indicate that TRHs with the same QT12 G genotype but different NF-YA8, NF-YB9 and NF-YC10 haplotypes can lead to different heat tolerances by regulating the QT12 expression level. In addition, this highlights the important role of NF-YA8, NF-YB9 and NF-YC10 in the fine regulation of the QT12 expression level in the NF-Ys-QT12 heat tolerance module, and also provides a new general concept for the fine design breeding of trait regulation in genetic breeding.

[0100] Example 9: TRHs coordinately regulate rice grain quality and yield traits

[0101] To study TRH J and TRHI Regarding the genetic contributions to rice quality and yield traits, we conducted phenotypic statistical analysis and calculation of genetic contribution rates using the main rice quality and yield traits of 533 micro-core germplasm materials ( Figure 14 ). For the traditional chalkiness quality traits, compared with TRH J , the TRH I germplasm has lower grain chalky area (GCA) and chalkiness degree (GCD). At the same time, the quality heat injury index of TRH I is significantly lower than that of TRH J , indicating that the TRH I variety has higher high-temperature tolerance compared to TRH J ( Figure 14 a), which explains the genetic basis of the heat tolerance difference between indica and japonica rice. In addition, compared with TRH J , the rice of the TRH I variety has lower protein content, gel consistency, and alkali spreading value, while having higher amylose content, head rice rate, and fatty acid C16:0, indicating that TRH J and TRH I have universal applicability to the contributions of main rice qualities ( Figure 14 a). To further analyze the phenotypic contribution rates of these four genes and TRH, we respectively selected two main indica-japonica haplotypes of these four genes and TRH, Indica-QT12 G and Japonica-QT12 G of QT12, Hap1 and Hap3 of NF-YA8, Hap5 and Hap7 of NF-YB9, the functional and non-functional haplotypes of NF-YC10, and TRH13 and TRH43 of TRHs, and conducted variance analysis on their genetic contributions to study the contribution rates of each gene and TRHs to indica-japonica qualities and yield traits ( Figure 14 b). The analysis found that the genetic contributions of TRHs to rice quality, heat tolerance, and yield traits are all significantly higher than any single gene in the NF-Ys-QT12 transcriptional regulation pathway ( Figure 14 b). These results further indicate that TRHs synergistically promote the changes in rice grain quality and yield traits, providing a new universal concept for the fine regulation of agricultural biological traits and genetic breeding.

[0102] The above specific implementation manners have described the implementation of the present invention in detail. However, the present invention is not limited to the specific details in the above implementation manners. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solutions of the present invention, and these simple variations all belong to the protection scope of the present invention.

Claims

1. Applications of genes NF-YA8, NF-YB9, NF-YC10 and QT12, their encoded proteins or expression cassettes, recombinant vectors, and recombinant microorganisms containing the same in regulating the heat tolerance of rice quality under field high temperature, characterized in that, The amino acid sequence encoded by the NF-YA8 gene is shown in SEQ ID NO.11, the amino acid sequence encoded by the NF-YB9 gene is shown in SEQ ID NO.12, the amino acid sequence encoded by the NF-YC10 gene is shown in SEQ ID NO.13, and the amino acid sequence encoded by the QT12 gene is shown in SEQ ID NO.

14. Among them, NF-YA8 negatively regulates the heat tolerance of rice quality by positively regulating the expression of QT12, and NF-YB9 and / or NF-YC10 positively regulate the heat tolerance of rice quality by negatively regulating the expression of QT12.

2. A method for regulating the heat tolerance of rice quality under high temperature in the field, characterized in that, By regulating the expression of the NF-YA8, NF-YB9 and / or NF-YC10 genes to further affect the expression level of the QT12 gene, the purpose of regulating the heat tolerance of rice quality under high field temperature is achieved. The amino acid sequence encoded by the NF-YA8 gene is shown in SEQ ID NO.11, the amino acid sequence encoded by the NF-YB9 gene is shown in SEQ ID NO.12, the amino acid sequence encoded by the NF-YC10 gene is shown in SEQ ID NO.13, and the amino acid sequence encoded by the QT12 gene is shown in SEQ ID NO.

14.

3. A molecular marker combination for identifying or assisting in the identification of indica-japonica subspecies differentiation and / or for improving the heat tolerance of rice quality, characterized in that, The molecular marker combination involves multiple variant sites of the QT12, NF-YA8, NF-YB9 and NF-YC10 genes, specifically the combinations shown in A1)-A4): A1) The G / A SNP and 6-bp InDel of the QT12 gene. The G / A SNP is located at position -1455 upstream of the QT12 gene promoter, and there is an A / G polymorphism at position 2372 of the sequence shown in SEQ ID NO.1; the 6-bp InDel refers to the presence or absence of a 6-bp deletion at positions 2828-2833 of the sequence shown in SEQ ID NO.

1. A2) 10 SNP sites of the NF-YA8 gene, located at positions -1431, -159, +293, +1717, +3138, +5148, +5150, +5265, +5350, +5731 of the NF-YA8 gene, corresponding to positions 389, 1661, 2113, 3537, 4958, 6968, 6970, 7085, 7170, 7551 of the sequence shown in SEQ ID NO.

2. A3) 12 SNP sites of the NF-YB9 gene, located at positions -1769, -1735, -1335, -1188, -248, -166, -158, +1602, +1699, +1790, +1903, +1924 of the NF-YB9 gene, corresponding to positions 428, 462, 862, 1009, 1949, 2031, 2039, 3799, 3896, 3987, 4100, 4121 of the sequence shown in SEQ ID NO.

3. A4) Functional variation in the CDS region of the NF-YC10 gene results in the loss of function of NF-YC10. When the sequence of its CDS region is as shown in SEQ ID NO.4, it shows the functional genotype NF-YC10. When the sequence of its CDS region is any one of SEQ ID NO.5-10, it shows the non-functional genotype nf-yc10.

4. The molecular marker combination according to claim 3, characterized in that, Rice is divided into haplotypes TRH1 - TRH45 and / or haplotype TRH / TRH according to multiple variant sites of genes QT12, NF - YA8, NF - YB9, and NF - YC10, as follows: I / TRH J , as shown below: Among them, - indicates a 6bp base deletion, N indicates any base, and D indicates a base deletion.

5. The molecular marker combination according to any one of claims 3-4, characterized in that Based on the haplotype results, TRH I was identified as indica rice, and TRH J was identified as japonica rice.

6. The molecular marker combination according to claim 4, wherein Compared with the haplotypes TRH13 and TRH20, the grain quality heat damage index and the chalkiness degree of grains at high temperature of the haplotypes TRH42 and TRH43 are both lower, and the grain yield is higher and the QT12 expression level is lower.

7. Use of the molecular marker combination according to any one of claims 3-6 or a substance for detecting the molecular marker combination according to any one of claims 3-6 in any of the following: B1) Identifying or assisting in identifying the differentiation of indica and japonica subspecies of rice; B2) Preparing a product for identifying or assisting in identifying the differentiation of indica and japonica subspecies of rice; B3) Identifying or assisting in identifying the heat tolerance of rice germplasm quality; B4) Preparing a product for identifying or assisting in identifying the heat tolerance of rice germplasm quality; B5) Cultivating heat-tolerant rice germplasm with good quality; B6) Preparing a product for cultivating heat-tolerant rice germplasm with good quality; B7) Improving the heat tolerance of rice germplasm quality; B8) Preparing a product for improving the heat tolerance of rice germplasm quality.

8. The application according to claim 7, wherein Detecting the molecular marker combination according to any one of claims 3-6 in rice, and according to the detected haplotype results: C1) Identify TRH I as indica rice, and identify TRH J as japonica rice; and / or, C2) Selecting rice with haplotype results of TRH42 and / or TRH43 for variety improvement or cultivation.

9. A method for identifying indica-japonica rice differentiation and / or improving the heat tolerance of rice germplasm quality, characterized in that, The method includes: detecting the molecular marker combination according to any one of claims 3-6 in rice, C1) When the detected haplotype result is TRH I it is identified as indica rice, and when the detected haplotype result is TRH J it is identified as japonica rice; and / or, C2) Selecting rice with haplotype results of TRH42 and / or TRH43 for variety improvement or cultivation.

10. A method for improving the heat resistance of rice quality, characterized in that, Including: D1) Introduce or replace the mutation in haplotype TRH described in claim 4 I with the mutation in; and / or, J haplotype TRH D2) Introducing or replacing the variation in TRH13 or TRH20 with the variation of the haplotype TRH42 or TRH43 described in claim 4.

Images