Application of RcNES gene in regulating and controlling nerolidol synthesis of tobacco

By overexpressing the rose RcNES gene in tobacco, constructing overexpression vectors, and cultivating transgenic tobacco that can synthesize neroli tertiary alcohol, the problem of low synthesis efficiency of neroli tertiary alcohol in the prior art is solved and the potential for efficient industrial application is achieved.

CN120249332APending Publication Date: 2025-07-04TOBACCO RESEARCH INSTITUTE OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES (QINGZHOU TOBACCO RESEARCH INSTITUTE OF CHINA NATIONAL TOBACCO COMPANY)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510455377.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-11
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

In the prior art, the microbial synthesis method of tertiary neroli is characterized by low yield, slow production speed, difficulty in cost control, insufficient optimization of metabolic pathways, which limits its application in industrial production, while heterologous and efficient synthesis in plants has not been reported.

Method used

The RcNES gene was derived from roses, and it was integrated into the tobacco genome through transgenic technology, overexpressing the RcNES gene, constructing an overexpression vector, and cultivating new tobacco materials that can produce neroli tertiary alcohol.

Benefits of technology

Heterologous synthesis of high-value nerolithol compounds has been achieved in tobacco, which significantly exceeds the existing technology level and has broad industrial practical prospects and potential for large-scale development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249332A_ABST
    Figure CN120249332A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of plant molecular biology and plant genetic engineering, and particularly relates to application of an RcNES gene in regulating and controlling nerolidol synthesis of tobacco. The nucleotide sequence of the RcNES gene is as shown in SEQ ID NO. 1. Through a transgenic technology, an over-expression vector containing the RcNES gene is constructed, tobacco is converted, RcNES gene mRNA and protein are expressed and synthesized in the tobacco, and nerolidol is synthesized. The heterologous synthesis of the high-value nerolidol compound in the tobacco is realized, the level of the heterologous synthesis is obviously higher than that of the prior art, and the heterologous synthesis method has a wide industrial practical prospect and a large-scale development potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical fields of plant molecular biology and plant genetic engineering, and particularly relates to RcNES the application of a gene in regulating the synthesis of nerolidol in tobacco. Background Art

[0002] Nerolidol is a naturally occurring sesquiterpene alcohol with the chemical formula C 15 H 26 O, and there are two isomers, cis- and trans-. Nerolidol is a colorless or light yellow liquid with a mild aroma similar to floral and woody scents and good persistence. Therefore, it is used in the preparation of rose-type, lilac-type and other fragrances, and has certain coordination properties and fixative effects.

[0003] Nerolidol has a variety of physiological functions and biological activities, including: (1) antibacterial: it has inhibitory effects on a variety of bacteria and fungi and can be used to treat skin infections and fungal infections; (2) anti-inflammatory: it inhibits the generation of inflammatory mediators, reduces the inflammatory response, and is suitable for treating inflammatory diseases; (3) antioxidant: it can scavenge free radicals, protect cells from oxidative damage, delay aging, and prevent chronic diseases; (4) sedative and anti-anxiety: it has a sedative effect, can relieve anxiety and stress, and is commonly used in aromatherapy and relaxation products; (5) promoting skin penetration: it can enhance the skin permeability of other active ingredients and is commonly used in cosmetics and topical drug preparations; (6) insect repellent: it has a repellent effect on certain insects and can be used to develop natural insect repellents; (7) anti-cancer: it has the potential to inhibit the growth of cancer cells and induce apoptosis of cancer cells. Due to the important physiological functions and good aroma characteristics of nerolidol, it is widely used in the fields of medicine, cosmetics, food industry and aromatherapy, such as for the development of antibacterial, anti-inflammatory, antioxidant and anti-cancer drugs, for the production of skin care products, perfumes and personal care products, as a natural additive to enhance aroma and flavor, and for the production of essential oils and aromatherapy products, etc., and has important economic value.

[0004] Nerolidol is widely distributed in the leaves, flowers, fruits, seeds and woods of various plants, and nerolidol exists in plants such as orange (Citrus aurantium), ginger (Zingiber officinale), sandalwood (Santalum album), tea tree (Melaleuca alternifolia), lavender (Lavandula angustifolia), jasmine (Jasminum officinale) and their essential oils. At present, natural nerolidol is mainly produced by methods such as steam distillation, solvent extraction, supercritical fluid extraction, vacuum fractionation, etc. using plant materials or essential oils such as neroli oil and balsam of Peru. Nerolidol can also be produced by chemical synthesis methods: a mixture of (E)- / (Z)-geranylacetone is obtained through the Carroll reaction using linalool as a substrate, then (E)- / (Z)-dehydronerolidol is obtained through an acetylene addition reaction, and then it is selectively hydrogenated to a mixture of (cis)- / (trans)-nerolidol isomers using a Lindlar catalyst.

[0005] The biosynthetic pathway of nerolidol has been basically clarified. IPP and DMAPP produced by the mevalonic acid pathway (MVA pathway) in the plant cytoplasm are synthesized into the common precursor FPP of sesquiterpenoids under the catalysis of FPS, and then nerolidol is synthesized under the catalysis of Nerolidol synthase (NES). In recent years, attempts have been made to produce nerolidol using yeast and Escherichia coli through synthetic biology methods. Nerolidol has been successfully synthesized in Escherichia coli, and the production of nerolidol in yeast has been improved by overexpressing HMGR and knocking out the squalene synthase gene (ERG9) to enhance the supply of precursors. However, there are still some problems in the existing microbial synthesis methods, such as low yield, slow production speed, difficult cost control, insufficient optimization of metabolic pathways, etc., which limit their application in industrial production. And there is no report on the heterologous and efficient synthesis of nerolidol in plants. Summary of the Invention

[0006] The technical problem to be solved by the present invention is how to synthesize nerolidol in tobacco.

[0007] To solve the above technical problems, the present invention adopts the following technical solutions: In the first aspect, the present invention provides RcNES the application of a gene in regulating the synthesis of nerolidol in tobacco, and the RcNES gene is derived from Rosa chinensis, and its nucleotide sequence is shown in SEQ ID NO.1.

[0008] Synthetic biology is based on the understanding of the operating laws of biological systems and the principles of engineering, designing and transforming existing life systems in nature, or constructing artificial life devices or systems that do not exist in nature from scratch, opening up a new and efficient way for the research and development of plant natural products and the sustainable use and development of plant resources. Tobacco ( Nicotiana tabacum ) is an important economic crop, with rapid growth, large biomass, vigorous secondary metabolism, and rich glandular hairs on the leaves and stems, which synthesize, store and secrete a large number of terpenes, alkaloids and glycolipids. Therefore, it is an ideal plant bioreactor. Rosa chinensis ) genes were re-optimized and integrated into the tobacco genome to cultivate new tobacco materials that can produce nerolidol, which has important biological and industrial significance.

[0009] Furthermore, by overexpression RcNES Gene, producing tobacco that can synthesize nerolidol.

[0010] Furthermore, compared with wild-type tobacco, overexpression RcNES The tissues of the transgenic tobacco or its progeny contain nerolidol.

[0011] Furthermore, the tissue is a leaf.

[0012] Furthermore, the tobacco is K326.

[0013] In a second aspect, the present invention provides RcNES The invention relates to an application of the gene in improving tobacco germplasm resources, wherein the improved germplasm resources is to produce tobacco capable of synthesizing nerolidol.

[0014] Furthermore, through transgenic technology, RcNES The overexpression vector of the gene is used to transform tobacco, and tobacco varieties containing nerolidol in the leaves are screened.

[0015] Furthermore, the tobacco is K326.

[0016] The present invention has the following beneficial effects: The present invention realizes the heterologous synthesis of high-value nerolidol compounds in tobacco with rapid growth, large biomass and strong environmental adaptability, significantly exceeds the level of the prior art, and has broad industrial practical prospects and potential for large-scale development. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the pNES-Shut plasmid map.

[0018] Figure 2 This is the plasmid map of pNES-121.

[0019] Figure 3 For the detection of nerolidol synthesized from the pNES-121 plasmid transiently expressed in Nicotiana benthamiana by GC-MS.

[0020] Figure 4 For the detection of the RcNES gene in tobacco transformed with the pNES-121 plasmid by PCR.

[0021] Figure 5 For the detection of heterologously synthesized nerolidol in tobacco transformed with the pNES-121 plasmid by GC-MS.

[0022] Figure 6 For the mass spectrometry map of nerolidol in tobacco. A is the comparison of the mass spectrometry map of the synthesized compound in tobacco (red) with the map in the mass spectrometry library (blue). B is the mass spectrometry map and chemical structure of each compound in the mass spectrometry library. Detailed implementation manners

[0023] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments, but it should not be construed as a limitation of the present invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well-known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0024] The vectors pShut and pBI121-GG involved in the following examples are disclosed in the Chinese invention patent with the patent number 202410215703.X.

[0025] The following gene sequences are involved:

[0026]

[0027] SEQ ID NO. 3: GCTTTAATGAGATATGCGAGAAGCCTATGATCGCATGATATTTGCTTTCAATTCTGTTGTGCACGTTGTAAAAAACCTGAGCATGTGTAGCTCAGATCCTTACCGCCGGTTTCGGTTCATTCTAATGAATATATCACCCGTTACTATCGTATTTTTATGAATAATATTCTCCGTTCAATTTACTGATTGTACCCTACTACTTATATGTACAATATTAAAATGAAAACAATATATTGTGCTGAATAGGTTTATAGCGACATCTATGATAGAGCGCCACAATAACAAACAATTGCGTTTTATTATTACAAATCCAATTTTAAAAAAAGCGGCAGAACCGGTCAAACCTAAAAGACTGATTACATAAATCTTATTCAAATTTCAAAAGTGCCCCAGGGGCTAGTATCTACGACACACCGAGCGGCGAACTAATAACGCTCACTGAAGGGAACTCCGGTTCCCCGCCGGCGCGCATGGGTGAGATTCCTTGAAGTTGAGTATTGGCCGTCCGCTCTACCGAAAGTTACGGGCACCATTCAACCCGGTCCAGCACGGCGGCCGGGTAACCGACTTGCTGCCCCGAGAATTATGCAGCATTTTTTTGGTGTATGTGGGCCCCAAATGAAGTGCAGGTCAAACCTTGACAGTGACGACAAATCGTTGGGCGGGTCCAGGGCGAATTTTGCGACAACATGTCGAGGCTCAGCAGGAC。

[0028] Example 1: Obtaining of nerolidol synthesis pathway genes and construction of artificial metabolic pathway vectors Download the nucleotide sequence (MG673510) of rose genes from NCBI. After codon optimization for tobacco species (SEQ ID NO.1), it was fully gene synthesized by Qingdao Personal Biotechnology Co., Ltd., and the sequence fragment shown in SEQ ID NO.1 was inserted into the EcoRV site of the pUC19 plasmid to obtain RcNES a gene plasmid. RcNES

[0029] ​PCR amplification was performed using Takara's PrimeSTAR Max DNA polymerase to obtain the target gene fragment, 35S promoter (SEQ ID NO.2), and OCS terminator (SEQ ID NO.3). The primer information is shown in Table 1.

[0030] Table 1 PCR amplification primer information The PCR reaction system was as follows: 5 μL of 10× buffer, 1 μL of 10 mM dNTP, 0.5 μL of PrimeSTAR Max DNA polymerase, 2 μL of forward primer, 2 μL of reverse primer, 2 μL of RcNES gene plasmid. The PCR conditions were: 95 °C for 5 min; 95 °C for 30 s, 55 °C for 30 s, 72 °C for 120 s, for 35 cycles; 72 °C for extension for 5 min. The PCR products were detected by 1% agarose gel electrophoresis and recovered by cutting the gel.

[0031] RcNES The gel recovery products were respectively ligated with the 35S promoter, OCS terminator, and vector pShut. The reaction system was: 2 μL of 10× T4 DNA Ligase buffer, 1 μL of T4 ligase, 1 μL of BsaI, 1 μL of pShut, and 1 μL of gel recovery product. The reaction conditions were 16 °C for 24 hours. The reaction products were transformed into Escherichia coli DH5α cloning strain. The transformation conditions were: add 20 μL of ligation product to 100 μL of competent cells, gently mix and incubate on ice for 30 min; quickly place in a 42 °C water bath for heat shock for 90 s, immediately place on ice for 3 min; add 800 μL of LB liquid medium, shake culture at 37 °C for 1 h; centrifuge the bacterial solution at 6000 rpm for 1 min, discard 700 μL of supernatant, resuspend the cells, and spread on an LB plate containing ampicillin (Amp, 100 mg / L), and incubate in the dark at 37 °C for 12 h. Colony PCR was used for positive clone screening, positive monoclonal colonies were selected, and the plasmids were extracted and sent for sequencing verification after extraction. The correctly constructed plasmid was named pNES-Shut. The vector structure is as Figure 1 .

[0032] Construct the pNES-Shut plasmid into an artificial metabolic pathway vector. The reaction system is as follows: 2 μL of 10×T4 DNA Ligase buffer, 1 μL of T4 ligase, 1 μL of BsaI, 1 μL of pBI121-GG, and 1 μL of the pNES-Shut plasmid. The reaction condition is 16 °C for 24 hours. Transform the reaction product into the Escherichia coli DH5α cloning strain. The transformation conditions are as follows: Add 20 μL of the ligation product to 100 μL of competent cells, gently mix and incubate on ice for 30 min; quickly place it in a 42 °C water bath for heat shock for 90 s, immediately place it on ice for 3 min; add 800 μL of LB liquid medium, and culture it with slow shaking at 37 °C for 1 h; centrifuge the bacterial solution at 6000 rpm for 1 min, discard 700 μL of the supernatant, resuspend the cells, and spread them on an LB plate containing kanamycin (50 mg / L), and incubate it in the dark at 37 °C for 12 - 16 h. Use colony PCR to screen for positive clones, pick positive monoclonal colonies, extract the plasmid and send it for sequencing verification. The correctly constructed plasmid is named pNES-121 ( Figure 2 ).

[0033] Example 2: Transient expression in Nicotiana benthamiana ( Nicotiana bentamiana ) to verify the function of metabolic pathway genes Add 5 μL of the pNES-121 plasmid to 100 μL of Agrobacterium tumefaciens GV3101 competent cells, quickly freeze it in liquid nitrogen for 2 minutes, place it at 37 °C for 30 minutes, add 1 mL of LB liquid medium, and culture it at 28 °C for 3 hours. Spread it on an LB plate containing 25 mg / L rifampicin, 25 mg / L gentamicin, and 50 mg / L kanamycin, and culture it at 28 °C for 3 days.

[0034] Pick an Agrobacterium monoclonal and inoculate it into 2 mL of LB medium (containing 25 mg / L rifampicin, 25 mg / L gentamicin, and 50 mg / L kanamycin), and culture it overnight at 28 °C and 220 rpm. Centrifuge the bacterial solution at 8000 rpm for 2 minutes, collect the precipitate and resuspend it in 10 mL of transformation solution (10 mM MES, 10 mM MgCl2, 0.2 mM acetosyringone), let it stand at room temperature for 3 hours and then inject the Nicotiana benthamiana leaves. After growing in the greenhouse for 5 days, take the leaves to detect nerolidol compounds.

[0035] Take 100 mg of Nicotiana benthamiana leaf material, grind it thoroughly in liquid nitrogen, transfer it to a 1.5 mL centrifuge tube, add 1 mL of n-hexane, shake for 2 minutes, centrifuge at 12000 rpm for 2 minutes, and collect the supernatant for GC-MS detection. Gas chromatography (GC) instrument model: Thermo Trace1300 (HP-5ms: 30m×0.25mm×0.25µm). Mass spectrometry instrument model Thermo ITQ 900 (EI ion source; ion trap detector). Injection volume: 1 µl. Chromatographic conditions: Keep at 60 °C for 3 min, increase the temperature to 280 °C at a rate of 10 °C / min, and hold for 5 min. Helium flow rate: 1 ml / min. Mass spectrometry conditions: Ion source temperature 250 °C, interface temperature 250 °C, collect m / z 50 - 500 in scan mode.

[0036] As Figure 3 shown, in the leaf extract of Nicotiana benthamiana transformed with Agrobacterium tumefaciens containing pNES-121, the compound nerolidol was detected, with a content of 15.3 µg / g fresh weight. This indicates that transient expression of metabolic pathway genes in Nicotiana benthamiana can synthesize the compound nerolidol.

[0037] Example 3: Cultivation of transgenic tobacco producing nerolidol Add 5 μL of the pNES-121 vector plasmid to 100 μL of Agrobacterium tumefaciens LBA4404 competent cells, quickly freeze in liquid nitrogen for 2 minutes, place at 37 °C for 30 minutes, add 1 mL of LB liquid medium, culture at 28 °C for 3 hours, and spread on an LB plate containing 25 mg / L rifampicin, 25 mg / L streptomycin, and 50 mg / L kanamycin, then culture at 28 °C for 3 days.

[0038] Pick a single colony of Agrobacterium and inoculate it into 50 ml of LB medium (containing 25 mg / L rifampicin, 25 mg / L streptomycin, and 50 mg / L kanamycin), culture overnight at 28 °C and 220 rpm. Centrifuge the bacterial solution at 8000 rpm for 2 minutes, collect the precipitate, resuspend it in 1 / 2 MS liquid medium, and adjust the OD 600 = 0.6 for use as an infection solution.

[0039] Sterilely cultured tobacco ( Nicotiana tabacum, the leaves of K326 were cut into small pieces of 1×1 cm, soaked in the Agrobacterium infection solution for 15 minutes, transferred to the co-culture medium (MS medium + 30 g / L sucrose + 2 mg / L 6-BA + 8 g / L Agar) and cultured in the dark for 48 hours, then transferred to the selection medium (MS medium + 30 g / L sucrose + 2 mg / L 6-BA + 50 mg / L kanamycin + 8 g / L Agar) and cultured at 25 °C under the condition of 16 h light / 8 h dark for 4 - 8 weeks. The resistant buds were cut and subcultured in the rooting medium (MS medium + 30 g / L sucrose + 8 g / L Agar) for 2 weeks. The regenerated seedlings were transplanted into flower pots and placed in an artificial climate chamber for growth (25 °C, 16 h light / 8 h dark).

[0040] Example 4: Screening and Detection of Nerolidol-producing Tobacco Take the tobacco material (100 mg), grind it thoroughly in liquid nitrogen, transfer it to a 1.5 ml centrifuge tube, add 1 ml of DNA extraction solution (100 mM Tris, 2 M NaCl, 2% CTAB, 2% PVP), mix well, place it at 65 °C for 15 min, centrifuge at 12000 rpm for 10 min, and discard the precipitate. Add 0.5 ml of chloroform to the supernatant, mix well, centrifuge at 12000 rpm for 10 min, take the supernatant and add 0.5 ml of isopropanol to precipitate DNA. Centrifuge at 12000 rpm for 10 min, and dissolve the precipitate in 0.1 ml of water.

[0041] PCR detection was carried out using 2 × Taq Master Mix (Vazyme). Detection was performed using primers SEQ ID NO. 4 - 5 RcNES . The PCR reaction system was: 2 × Taq Master Mix 10 μL, 1 μL forward primer, 1 μL reverse primer, 1 μL DNA. The PCR conditions were: 95 °C for 5 min; 95 °C for 30 s, 55 °C for 30 s, 72 °C for 120 s, for 35 cycles; extension at 72 °C for 5 min. The PCR products were detected by 1% agarose gel electrophoresis. As Figure 4 shown, the gene has been integrated into the genomes of most transgenic plants RcNES genes.

[0042] Take 100 mg of tobacco leaf material, grind it thoroughly in liquid nitrogen, transfer it to a 1.5 mL centrifuge tube, add 1 mL of n-hexane, shake for 2 minutes, centrifuge at 12,000 rpm for 2 minutes, and collect the supernatant for GC-MS detection. Gas chromatography (GC) instrument model: Thermo Trace1300 (HP-5ms: 30m × 0.25mm × 0.25µm). Mass spectrometry instrument model: Thermo ITQ 900 (EI ion source; ion trap detector). Injection volume: 1 µl. Chromatographic conditions: Keep at 60 °C for 3 min, increase the temperature to 280 °C at a rate of 10 °C / min, and hold for 5 min. Helium flow rate: 1 ml / min. Mass spectrometry conditions: Ion source temperature 250 °C, interface temperature 250 °C, collect m / z 50 - 500 in scan mode.

[0043] As Figure 5 and Figure 6 shown, in the tobacco leaf extracts of the transgenic plants carrying the pNES-121 vector, the compound nerolidol was detected. The content in line 1 was 18.7 µg / g fresh weight, and the content in line 2 was 46.2 µg / g fresh weight. This indicates that these transgenic tobaccos can synthesize the compound nerolidol.

[0044] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications once they know the basic creative concepts. Therefore, the appended claims are intended to be construed to include the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0045] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. RcNES Application of gene in regulating synthesis of nerolidol in tobacco, characterized in that, The said RcNES The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. According to claim 1 RcNES The application of the gene in regulating the synthesis of nerolidol in tobacco, characterized in that By overexpressing RcNES genes, tobacco plants capable of synthesizing nerolidol are produced.

3. According to claim 1 RcNES Use of a gene in regulating the synthesis of nerolidol in tobacco, characterized in that Compared with wild-type tobacco, the tissues of transgenic tobacco overexpressing RcNES gene or its progeny contain nerolidol.

4. According to claim 3 RcNES Use of the gene in regulating the synthesis of nerolidol in tobacco, characterized in that The tissue is a leaf.

5. According to claim 1 RcNES Use of a gene in regulating the synthesis of nerolidol in tobacco, characterized in that The tobacco is K326.

6. The application of the gene described in claim 1 RcNES in the improvement of tobacco germplasm resources, characterized in that The improvement of the germplasm resource is to produce tobacco that can synthesize nerolidol.

7. According to claim 6 RcNES The application of the gene in the improvement of tobacco germplasm resources, characterized in that Through transgenic technology, a super-expression vector containing RcNES gene was constructed, transformed into tobacco, and tobacco varieties containing nerolidol in their leaves were screened and obtained.

8. According to claim 7 RcNES The application of the gene in the improvement of tobacco germplasm resources, characterized in that The tobacco is K326.

Citation Information

Patent Citations

  • Vector construction system capable of freely defining joints and connection modes and application thereof

    CN118006648A