Application of DNA (deoxyribonucleic acid) molecule STTM-miR169d / p in enhancing bacterial leaf blight and rice blast resistance of rice

Abstract

As a main grain crop in the world, the yield and quality of rice are often threatened by bacterial leaf blight and rice blast. According to the invention, a recombinant expression vector for expressing STTM-miR169d / p is constructed by starting from regulation and control of the expression quantity of miRNA through an STTM technology. By adopting an agrobacterium tumefaciens-mediated rice protoplast transformation technology, a rice plant containing the STTM-miR169d / p transgenic fragment is obtained. Through field inoculation of xanthomonas oryzae pv. Oryzae and inoculation of rice blast spores on in-vitro leaves, it is verified that the STTM-miR169d / p transgenic rice has significantly improved resistance to xanthomonas oryzae pv. Oryzae and rice blast compared with wild type rice. The invention not only provides a new germplasm resource for cultivating disease-resistant rice, but also provides a new thought for regulating and controlling the disease resistance of rice from the aspect of miRNA.

Description

Technical Field

[0001] The present invention relates to the field of rice genetic breeding, and specifically relates to the application of the DNA molecule STTM-miR169d / p in enhancing the resistance of rice to bacterial blight and blast disease. Background Art

[0002] MicroRNA (miRNA) is a class of small non-coding RNA molecules with a length of about 20-24 nucleotides. They play a key role in gene expression regulation, mainly by complementary pairing with the mRNA of target genes to inhibit protein translation or promote mRNA degradation, thereby down-regulating target genes. miRNAs are widely present in animals and plants, and their regulatory roles cover almost all aspects of the eukaryotic life cycle, such as growth, development, epigenetics, genome integrity, environmental stress resistance, and host defense.

[0003] MiR169 is a conserved and relatively large miRNA family in plants. It plays an important role in plant growth and development, stress response, and hormone regulation by targeting transcription factors of the NF-YA family. In Arabidopsis thaliana, AtNFYA2 can bind to the promoter of the flowering inhibitor FLC and activate its expression, thereby delaying the flowering time of plants. Overexpression of miR169 will lead to a decrease in the expression of the target gene AtNFYA2, resulting in earlier flowering. The miR169 / NF-YA module plays a key role in plants' response to various abiotic stresses (such as drought, salt stress, low temperature, high temperature, etc.), mainly by regulating the hormone signal pathway and the expression of stress response genes to enhance the stress tolerance of plants. Under drought and salt stress conditions, the expression of miR169 is usually inhibited, while the expression of its target gene NF-YA family members is significantly up-regulated. Rice overexpressing miR169 has reduced tolerance to drought stress.

[0004] STTM (Short Tandem Target Mimic) is a technique used to reduce the expression level of a target miRNA. This technique designs an artificially synthesized nucleotide sequence that can bind to the target miRNA but is not cleaved by the miRNA. This mimic target forms a bulge structure (usually an imperfect complement of 3 bases) at the cleavage site of the miRNA, thereby preventing the miRNA from binding to the true target gene, and ultimately achieving the inhibition of miRNA function.

[0005] In the existing technology, the association between miR169 and the disease resistance of rice has not been reported, nor has there been a report on using the STTM technique to inhibit the function of miR169 to improve the disease resistance of rice. Starting from miRNAs, researching and creating new rice germplasms that can simultaneously improve the resistance to bacterial blight and blast disease has positive significance for rice molecular design breeding. Summary of the Invention

[0006] The object of the present invention is to provide a germplasm resource that can enhance the disease resistance of rice to both bacterial blight and rice blast in view of the deficiencies of the prior art.

[0007] The technical solution of this application is as follows:

[0008] The first object of the present invention is to provide the use of miRNA169d and / or miRNA169p as targets in improving the resistance of rice to bacterial blight and / or rice blast. The nucleotide sequence of miRNA169d is shown in SEQ ID NO.1: UAGCCAAGGAUGAAUUGCCGG, and the nucleotide sequence of miRNA169p is shown in SEQ ID NO.2: UAGCCAAGGACAAACUUGCCGG.

[0009] Furthermore, the precursor sequence of rice miR169d, osa-MIR169d, is shown in SEQ ID NO.3; the precursor sequence of rice miR169p, osa-MIR169p, is shown in SEQ ID NO.4:

[0010] SEQ ID NO.3 (pre osa-MIR169d)

[0011] auuuaucgugUAGCCAAGGAUGAAUUGCCGGcguuucacgcuguugauggugcgugcauauauaaguugg cgccggcaagucauuucaggcuacauguuugcc

[0012] SEQ ID NO.4 (pre osa-MIR169p)

[0013] gagcaaggugUAGCCAAGGACAAACUUGCCGGaucaacagagaaggacugccagucuccggccaauuaauu aaccucgccgucggccaucgccggccggcaagucauccuuggcugcauccugcuc

[0014] The second object of the present invention is to provide STTM-miR169d and STTM-miR169p targeting the aforementioned miRNA169d and miRNA169p. The nucleotide sequence of STTM-miR169d is shown in SEQ ID NO.17: CCGGCAATTCACTATCCTTGGCTA; the nucleotide sequence of STTM-miR169p is shown in SEQ ID NO.18: CCGGCAAGTTTGCTATCCTTGGCTA.

[0015] The third object of the present invention is to provide a recombinant vector containing the aforementioned STTM-miR169d and / or STTM-miR169p.

[0016] Furthermore, the basic vector of the recombinant vector is pCAMBIA1300, and the STTM-miR169d and / or STTM-miR169p is inserted between HindIII and EcoRI, and the insertion position is after the CaMV35S promoter.

[0017] Furthermore, when the recombinant vector includes STTM-miR169d and STTM-miR169p, STTM-miR169d and STTM-miR169p are connected by an 88bp spacer. The 88bp spacer sequence is shown in SEQ ID NO.5:

[0018] SEQ ID NO.5(88nt-F):

[0019] GTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAAT.

[0020] The fourth object of the present invention is to provide a recombinant expression cell containing the aforementioned recombinant vector.

[0021] The fifth object of the present invention is to provide a kit for detecting the expression level of the aforementioned miR169d or miR169p. The kit contains primers for specifically detecting the aforementioned miR169d or miR169p.

[0022] Furthermore, the primer is miR169d / p-RT:

[0023] gtcgtatccagtgcagggtccgaggtattcgcactggatacgacCCGGCA(SEQ ID NO.11), U6-R: GCGGACCATTTCTCGATTTG(SEQ ID NO.12), miR169d-qPCR-F:

[0024] cgccgTAGCCAAGGATGAAT(SEQ ID NO.13), miR169p-qPCR-F:

[0025] cgcgTAGCCAAGGACAAACT(SEQ ID NO.14), Universal R: TATCCAGTGCAGGGTCCGAG(SEQ ID NO.15) and U6-qPCR-F: CGCGGAACGATACAGATAAGA(SEQ ID NO.16).

[0026] The sixth object of the present invention is to provide the use of the foregoing STTM-miR169d or STTM-miR169p or the foregoing recombinant vector or the foregoing recombinant expression cell or the foregoing kit in improving the resistance of rice to bacterial blight and / or rice blast.

[0027] Furthermore, it includes the following steps:

[0028] S1: Construct a recombinant expression vector expressing the DNA molecule STTM-miR169d and / or STTM-miR169p, wherein the STTM-miR169d or STTM-miR169p is a mimic target of miR169d or miR169p, which can competitively bind to miR169d or miR169p, thereby inhibiting its function;

[0029] S2: Transform the recombinant expression vector constructed in S1 into rice to specifically inhibit miR169d and / or miR169p and improve the resistance of rice to bacterial blight and / or rice blast.

[0030] Due to the requirements for the preparation of the sequence listing, in the sequence listing of this patent, the "U" base in the RNA sequence shown in the specification is replaced with "T".

[0031] The beneficial effects of the present invention are as follows:

[0032] Rice miR169 negatively regulates rice resistance to bacterial blight. In the present invention, the functions of miR169d and miR169p were inhibited by STTM technology, and STTM-miR169d / p transgenic rice plants with stably reduced miR169d and miR169p were obtained. Compared with the wild type, the STTM-miR169d / p transgenic rice showed improved resistance to bacterial blight and rice blast. This provides important germplasm resources and ideas for rice molecular breeding and variety improvement. Description of the Drawings

[0033] Figure 1 : Schematic diagram of the structure of the recombinant expression plasmid expressing STTM-miR169d / p.

[0034] Figure 2 : Obtaining STTM-miR169d / p transgenic rice.

[0035] A. PCR detection of the STTM-miR169d / p fragment in STTM-miR169d / p transgenic rice.

[0036] B. Quantitative fluorescence PCR detection of the expression levels of miR169d and miR169p in STTM-miR169d / p transgenic rice. Double asterisks (**) indicate significant differences between the transgenic lines and the wild type TP309, p < 0.01.

[0037] Figure 3 : Detection of the resistance of STTM-miR169d / p transgenic rice to bacterial blight.

[0038] A. Lesion leaves of Taibei 309 (TP309) and transgenic lines at 14 days after inoculation with the bacterial blight pathogen J18 by the leaf-clipping method during the full tillering stage of rice. The picture shows that the lesion length of the transgenic lines was shortened by 25% - 40% compared with the wild type TP309.

[0039] B. Statistical analysis of the lesion lengths of Taibei 309 (TP309) and transgenic lines at 14 days after inoculation with the bacterial blight pathogen J18 by the leaf-clipping method. Double asterisks (**) indicate significant differences between the transgenic lines and the wild type TP309, p < 0.01.

[0040] Figure 4 : Detection of the resistance of STTM-miR169d / p transgenic rice to rice blast.

[0041] A. Lesion leaves of Taibei 309 (TP309) and transgenic lines at 7 days after in vitro inoculation of 2-month-old rice leaves with the rice blast pathogen FJ812787. The picture shows that the lesion length of the transgenic lines was shortened by 50% - 70% compared with the wild type TP309.

[0042] B. Statistical analysis of lesion lengths of rice leaves of 2-month-old rice inoculated with Magnaporthe oryzae FJ812787 in vitro for 7 days in Taibei 309 (TP309) and transgenic lines. The double asterisks (**) indicate significant differences between transgenic lines and wild-type TP309, p < 0.01. Detailed implementation mode

[0043] The following examples are used to further explain the present invention, but the examples do not limit the present invention in any form.

[0044] The raw materials involved in the following examples are all commercially available unless otherwise specified; the detection methods involved are all conventional methods unless otherwise specified.

[0045] Example 1 Construction of transgenic rice with down-regulated miR169d / p in rice by STTM technology

[0046] 1.1 The method for constructing a recombinant expression vector containing the DNA molecule STTM-miR169d / p is as follows:

[0047] 1) Synthesis of the STTM-miR169d / p fragment Using 88nt-F and 88nt-R as templates, and the upstream adapter primer (STTM169d-F) and downstream adapter primer (STTM169p-R) as primers for PCR. The PCR reaction system is:

[0048]

[0049] The PCR reaction program is: 95°C for 3 min, (95°C for 15 s, 58°C for 15 s, 72°C for 30 s) for 30 cycles, 72°C for 5 min, 4°C for 2 min. The product is recovered and purified using the Tiangen universal DNA purification and recovery kit.

[0050] 88nt-F:

[0051] GTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAAT(SEQ ID NO.5)

[0052] 88nt-R:

[0053] ATTCTTCTTCTTTAGACCATATTCTTCTTCTTTAGACCATATTTAAATTAGACCATAACAACAACAACTAGACCATAACAACAACAAC(SEQ ID NO.6)

[0054] STTM169d-F: GGACAGCCCAAGCTTCCGGCAATTCACTATCCTTGGCTAGTTGTT (SEQ ID NO.7)

[0055] STTM169p-R: CAGCGTACCGAATTCTAGCCAAGGATAGCAAACTTGCCGGATTCTT (SEQ ID NO.8)

[0056] 2) The pCAMBIA1300 vector plasmid was double digested with the restriction enzymes HindIII and EcoRI (NEB). The digestion system was as follows: 20 μL of plasmid, 1 μL of HindIII, 1 μL of EcoRI, 5 μL of 10× cutsmart Buffer, and 23 μL of ddH2O. The system was mixed well and digested at 37°C for 2 hours, then inactivated at 85°C for 5 s. The vector digestion product was subjected to agarose gel electrophoresis, and the required band was cut out and purified using the Tiangen Universal DNA Purification and Recovery Kit, and the nucleic acid concentration was measured.

[0057] 3) The Novoprotein ClonExpress II One Step Cloning Kit was used to ligate the target fragment with the double-digested vector. The system was as follows: 2 μL of the digested vector product, 1 μL of the target fragment, 2 μL of 5× CE II Buffer, 1 μL of Exnase II, and 4 μL of ddH2O. The ligation system was mixed well and reacted at 37°C for 30 min; then cooled to 4°C or immediately placed on ice.

[0058] 4) The recombinant plasmid was transferred into Escherichia coli competent DH5α by heat shock method, and single colonies were selected on LB plates containing kanamycin and sent to Tsingke Biotechnology Co., Ltd. for sequencing verification. The plasmid with correct sequencing was named: STTM-169d / p. The correct structure of the recombinant expression vector was: CaMV 35S promoter - STTM-169d / p - CaMV 35S terminator (see Figure 1 ).

[0059] 1.2 Obtaining transgenic rice

[0060] 1) The above recombinant expression vector STTM-169d / p was transferred into Agrobacterium tumefaciens EHA105 and spread on LB plates containing kanamycin and rifampicin. Single colonies were selected and sent to Tsingke Biotechnology Co., Ltd. for sequencing verification. The recombinant bacterium with correct sequencing was named EHA105 / STTM-169d / p and stored in glycerol.

[0061] 2) The rice material Taibei 309 (TP309) was selected as the transgenic background.

[0062] Select complete and plump mature rice seeds and remove the husks with a thresher;

[0063] Disinfect and wash them successively with 75% ethanol, 30% NaClO, and sterile water;

[0064] Place the seeds on sterile filter paper to absorb the surface moisture, sow them on the induction medium, and culture them in the dark for about 15 days until yellow calli of appropriate size grow out;

[0065] Peel off the calli and transfer them to the subculture medium for dark culture for two weeks;

[0066] Gently shake the recombinant bacterium EHA105 / STTM-169d / p with the calli in the liquid co-culture medium, co-culture for 30 minutes, transfer the calli to sterile filter paper to dry, and transfer them to the co-culture medium for culture for 2 - 3 days;

[0067] Absorb the moisture of the calli with sterile filter paper and transfer them to the screening medium containing hygromycin resistance until new calli grow out;

[0068] Transfer the new calli to the differentiation medium to induce shoot formation;

[0069] Transfer the grown seedlings to the rooting medium to induce root formation. After 2 weeks, take out the seedlings and wash the root medium, and then they can be transplanted into the soil;

[0070] 3) PCR identification of transgenic fragments

[0071] Extract the genomic DNA of T0 generation STTM-miR169d / p transgenic rice and wild type, and then perform PCR identification of transgenic fragments with the universal primers STTM-common-F and STTM-common-R on the STTM vector. Transgenic positive plants can amplify a 176bp transgenic fragment (see Figure 2 .A). The identification primer sequences are as follows:

[0072] STTM-common-F: CATTTGGAGAGGACAGCCCAAG (SEQ ID NO.9)

[0073] STTM-common-R: CTGGTGATTTCAGCGTACCGAA (SEQ ID NO.10)

[0074] 4) Fluorescent quantitative PCR detection of the expression level of miR169d / p

[0075] Extract the RNA of T0 generation STTM-miR169d / p transgenic rice and wild type rice that are positive in PCR identification respectively;

[0076] Reverse transcription of total RNA was performed using the miRNA 1st Strand cDNA Synthesis Kit (by stem-loop) (Vazyme):

[0077] The stem-loop reverse transcription primer miR169d / p-RT sequence for miR169d / p was:

[0078] gtcgtatccagtgcagggtccgaggtattcgcactggatacgacCCGGCA (SEQ ID NO.11);

[0079] The reverse transcription primer U6-R sequence for the internal reference U6 was: GCGGACCATTTCTCGATTTG (SEQ ID NO.12); The reverse transcription product was diluted 10-fold with sterilized ddH2O and used as the template for fluorescence quantitative PCR;

[0080] miRNA fluorescence quantitative PCR was performed using the miRNA Unimodal SYBR qPCR Master Mix kit (Vazyme):

[0081] The miR169d fluorescence quantitative specific F primer miR169d-qPCR-F sequence was: cgccgTAGCCAAGGATGAAT (SEQID NO.13);

[0082] The miR169p fluorescence quantitative specific F primer miR169p-qPCR-F sequence was: cgcgTAGCCAAGGACAAACT (SEQID NO.14);

[0083] The universal fluorescence quantitative R primer Universal R sequence was: TATCCAGTGCAGGGTCCGAG (SEQ IDNO.15);

[0084] The internal reference U6 fluorescence quantitative specific F primer U6-qPCR-F sequence was: CGCGGAACGATACAGATAAGA (SEQ IDNO.16);

[0085] The internal reference U6 fluorescence quantitative R primer used U6-R;

[0086] The results of fluorescence quantitative PCR showed that, compared with the wild-type TP309, miR169d and miR169p were significantly reduced in three independent lines of STTM miR169d / p transgenic rice. The expression level of miR169d was about 10%-25% of that of the wild type, and the expression level of miR169p was about 10%-40% of that of the wild type (see Figure 2.B). Experiments showed that positive transgenic rice containing the STTM-miR169d / p transgenic fragment was successfully obtained in this study, and the expression levels of miR169d and miR169p were successfully reduced.

[0087] Example 2 Identification of the resistance of STTM miR169d / p transgenic rice to bacterial blight.

[0088] 1) Inoculation with Xanthomonas oryzae pv. oryzae:

[0089] Take out the stored strain J18 of Xanthomonas oryzae pv. oryzae (Xanthomonas oryzae pv. oryzae, Xoo) from the -80°C refrigerator, streak and activate it on NA solid medium containing 15 mg / L cefalexin resistance, and invert it in a 30°C constant temperature incubator until monoclonal colonies grow;

[0090] Take the activated colonies, slightly dilute them in 200 μL of sterilized ddH2O, and then spread them on NA solid medium containing cefalexin resistance, and invert it in a 30°C constant temperature incubator and statically culture for about 2 - 3 days;

[0091] Scrape off the bacteria grown on the solid medium, mix and dilute them with sterilized water until the OD 600 is about 1.0;

[0092] Dip scissors in the diluted bacterial solution and inoculate rice plants about 8 weeks old in the field using the leaf-shearing method. The shearing position is about 2 cm from the leaf tip, and cut more than 5 fully expanded leaves for each single plant;

[0093] 2) Identification of resistance to bacterial blight:

[0094] Measure the length of the lesion extension 14 days after inoculation, Figure 3 The results showed that the lesion lengths of the three STTM-169d / p transgenic lines were all shorter than that of the wild type TP309, and the lesion length was shortened by about 25% - 40%. The study determined that the STTM-169d / p transgenic lines had significantly improved resistance to bacterial blight compared with the wild type TP309.

[0095] Example 3 Identification of the resistance of STTM miR169d / p transgenic rice to rice blast

[0096] 1) Inoculation with rice blast spores:

[0097] Place the filter paper containing the rice blast fungus FJ81278 on CM solid medium for activation, and place it in a 28°C constant temperature incubator for 7 - 10 days;

[0098] Inoculate the conidial hyphae grown on CM medium onto rice straw corn medium, inoculate 4 points on each petri dish, and place it in a constant temperature incubator at 28°C for static culture until the hyphae cover the petri dish;

[0099] Use a spreading rod to break the conidial hyphae, place the petri dish back into the constant temperature incubator at 28°C, do not seal the petri dish with a sealing film, maintain a certain air permeability, and induce sporulation under light for about 3 days;

[0100] After the surface of the medium is covered with spores, rinse the hyphae with sterilized water containing 0.02% Tween 20, filter with two layers of lens paper, take the spore suspension and drop it onto a hemocytometer, and examine the spore concentration under a microscope, and adjust it to 1×10 5 cells / mL;

[0101] Take the leaves of rice seedlings about 2 weeks old, punch holes every 3 cm, suck the spore suspension with a pipette, drop it onto the punched positions, place the leaves in a petri dish lined with moist filter paper, place it in a constant temperature light incubator at 28°C, after dark treatment for 24 hours, set the photoperiod to: light 14 h / dark 10 h;

[0102] 2) Identification of rice blast resistance:

[0103] Measure the lesion length at 7 days after inoculation, Figure 4 It shows that the lesion lengths of the three STTM-169d / p transgenic lines are all shorter than that of the wild type TP309, and the lesion length is shortened by about 50%-70%. The study determines that the STTM-169d / p transgenic lines have significantly improved the resistance to rice blast compared with the wild type TP309.

[0104] The above is only the preferred embodiment of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Use of miRNA169d and / or miRNA169p as a target in enhancing the resistance of rice to bacterial blight and / or rice blast, characterized in that, The nucleotide sequence of miRNA169d is shown as SEQ ID NO.1, and the nucleotide sequence of miRNA169p is shown as SEQ ID NO.

2.

2. STTM-miR169d and STTM-miR169p targeting miRNA169d and miRNA169p as claimed in claim 1, characterized in that, The nucleotide sequence of STTM-miR169d is shown as SEQ ID NO.17, and the nucleotide sequence of STTM-miR169p is shown as SEQ ID NO.

18.

3. A recombinant vector, characterized in that, Containing the STTM-miR169d and / or STTM-miR169p described in claim 2.

4. The recombinant vector according to claim 3, wherein The basic vector of the recombinant vector is pCAMBIA1300, and the STTM-miR169d and / or STTM-miR169p is inserted between HindIII and EcoRI, and the insertion position is after the CaMV35S promoter.

5. The recombinant vector according to claim 3 or 4, characterized in that, When the recombinant vector includes STTM-miR169d and STTM-miR169p, STTM-miR169d and STTM-miR169p are connected by an 88bp spacer, and the 88bp spacer sequence is shown as SEQ ID NO.

5.

6. A recombinant expression cell, characterized in that, Containing the recombinant vector described in claim 3.

7. A kit for detecting the expression level of miRNA169d or miRNA169p according to claim 1, characterized in that, The kit contains primers for specifically detecting the miRNA169d or miRNA169p described in claim 1.

8. The kit according to claim 7, wherein The primers are miR169d / p-RT: gtcgtatccagtgcagggtccgaggtattcgcactggatacgacCCGGCA (SEQ ID NO.11), U6-R: GCGGACCATTTCTCGATTTG (SEQ ID NO.12), miR169d-qPCR-F: cgccgTAGCCAAGGATGAAT (SEQ ID NO.13), miR169p-qPCR-F: cgcgTAGCCAAGGACAAACT (SEQ ID NO.14), Universal R: TATCCAGTGCAGGGTCCGAG (SEQ ID NO.15) and U6-qPCR-F: CGCGGAACGATACAGATAAGA (SEQ ID NO.16).

9. Use of the STTM-miR169d or STTM-miR169p described in claim 2, or the recombinant vector described in claim 3, or the recombinant expression cell described in claim 6, or the kit described in claim 7 in improving the resistance of rice to bacterial blight and / or rice blast.

10. The application according to claim 9, wherein Including the following steps: S1: Construct a recombinant expression vector expressing the DNA molecule STTM-miR169d and / or STTM-miR169p, the STTM-miR169d or STTM-miR169p is a mimic target of miR169d or miR169p, which can competitively bind to miR169d or miR169p, thereby inhibiting its function. S2: Transform rice with the recombinant expression vector constructed in S1 to specifically inhibit miR169d and / or miR169p, thereby improving the resistance of rice to bacterial blight and / or rice blast.

Images