Application of TaTPI gene in regulation and control of wheat pre-harvest sprouting resistance

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of a TaTPI gene in regulation and control of wheat pre-harvest sprouting resistance. According to the invention, a wheat TaTPI gene is cloned, the contents of TaTPI sequence characteristics, promoter sequence regulation elements, expression characteristics and the like are systematically analyzed, and a wheat TaTPI mutant strain is created by utilizing a CRISPR / Cas9 technology. The TaTPI expression level, the grain germination characteristic and the pre-harvest germination characteristic of a TaTPI mutant material are determined, and the condition that the TaTPI gene positively regulates the germination process of wheat grains is found; after the TaTPI gene is mutated, the pre-harvest sprouting resistance of wheat is obviously improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to the application of TaTPI gene in regulating pre-harvest sprouting tolerance of wheat. Background Art

[0002] Wheat is widely planted and provides important carbohydrates, proteins and nutrients for humans. In addition to playing a key role in food processing, wheat also plays an important role in fields such as feed, industrial raw materials and biofuels, and is crucial for global food security and economic development. Once pre-harvest sprouting occurs due to rain during the mature period, it seriously affects the yield and quality of wheat. Pre-harvest sprouting is a worldwide natural disaster. Therefore, improving the pre-harvest sprouting tolerance of wheat is of great significance for improving the yield and quality of wheat.

[0003] Triose phosphate isomerase (TPI), as a key enzyme in the process of carbon metabolism (MO Y, HARRIS B G, GRACY RW. Triosephosphate isomerases and aldolases from light-and dark-grown Euglenagracilis[J]. Arch Biochem Biophys, 1973, 157(2):580-587.), plays a key role in pathways such as glycolysis and fatty acid synthesis. The patent application with the publication number of CN 110791496A discloses the application of rice gene OsTPI1-1 in improving the disease resistance of rice. Functional verification shows that the OsTPI1-1 gene is a positive regulator in the reaction of rice against bacterial blight, and the disease resistance of rice can be improved by overexpressing the OsTPI1-1 gene. Summary of the Invention

[0004] The present invention cloned the wheat TaTPI gene, systematically analyzed the sequence characteristics, promoter sequence regulatory elements, expression characteristics, etc. of TaTPI, and created a wheat TPI mutant line by using the CRISPR / Cas9 technology. Through the determination of the TaTPI expression level, grain germination characteristics and pre-harvest sprouting characteristics of the TPI mutant materials, it was found that the TPI gene positively regulates the grain germination process of wheat; after the TPI gene mutation, the pre-harvest sprouting tolerance of wheat was significantly improved.

[0005] The specific solution of the present invention is as follows:

[0006] The present invention cloned three partial homologous genes of wheat TaTPI, analyzed the sequence characteristics, promoter sequence regulatory elements, and expression characteristics of TaTPI; used CRISPR / Cas9 technology to create wheat TPI mutant strains, and systematically analyzed the seed germination characteristics and ear germination characteristics of mutant materials after gene knockout. The details are as follows:

[0007] The present invention cloned the full-length sequences of three partial homologous genes of TaTPI, TaTPI-3A, TaTPI-3B and TaTPI-3D, from the wheat variety Zhongyou 9507. All three sequences contain a 762bp reading frame, encoding 253 amino acids (SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3), and belong to the TIM family gene; the lengths of the A, B and D genome sequences are 2965bp (SEQ ID NO: 4), 2946bp (SEQ ID NO: 5) and 3000bp (SEQ ID NO: 6), respectively, and all contain 9 exons and 8 introns, and the consistency of the three sequences reaches more than 92%. The exon sequences are relatively conservative between different sequences, with only SNP differences, and the intron sequences are quite different. In addition to the SNP differences, there are also multiple insertions and deletions; the promoter sequence analysis shows that in addition to the presence of partially identical hormone response elements and stress response elements, the TaTPIS promoter region also has different regulatory elements.

[0008] Using CRISPR / Cas9 gene editing technology, a CRISPR / Cas9-TaTPI editing vector was constructed and introduced into wheat embryos by Agrobacterium transformation. After five consecutive generations of follow-up detection, four mutant homozygous strains with different editing types were obtained. The expression level of TaTPI, grain germination characteristics, and spike germination characteristics in mutants and wild types were measured, indicating that the expression level of TaTPI in the mutant was significantly reduced, and the germination rate, germination potential, and germination index of the grains were significantly reduced, indicating that the TaTPI gene positively regulates the germination process of wheat grains. In addition, the spike germination degree of the TaTPI mutant was significantly lower than that of the control, indicating that the TaTPI gene mutation significantly improved the wheat's ability to resist spike germination.

[0009] Based on the above content, the first aspect of the present invention provides the use of TaTPI gene, protein encoded by TaTPI gene, recombinant vector targeting TaTPI gene, and cells containing the recombinant vector in regulating wheat ear germination resistance. Specifically, the ability of wheat ear germination resistance can be improved by inhibiting TaTPI gene expression and reducing TaTPI protein content. The inhibition of TaTPI gene expression or reduction of TaTPI protein content can be achieved by using CRISPR / Cas9 gene editing method.

[0010] The recombinant vector targeting the TaTPI gene is a vector for silencing the TaTPI gene in wheat, such as an RNAi silencing recombinant vector or a CRISPR / Cas9 gene editing recombinant vector.

[0011] The recombinant bacterium is Escherichia coli or Agrobacterium tumefaciens containing the recombinant vector.

[0012] The present invention provides a method for cultivating pre-harvest sprouting-resistant wheat, which includes the step of inhibiting the expression of the TaTPI gene or reducing the content of TaTPI protein in wheat. For example, inhibiting the expression of the TaTPI gene in wheat by CRISPR / Cas9 gene editing specifically includes:

[0013] (1) Construct a CRISPR / Cas9 gene editing recombinant vector targeting the TaTPI gene;

[0014] The target sequences of the TaTPI gene are sgRNA1 (target site 1): 5’-CCTCTACGGATGTTGTCGAGGTT-3’ and / or sgRNA2 (target site 2): 5’-TGTCTTCCTTCCCACCGTCAAGG-3’.

[0015] (2) Transform the CRISPR / Cas9 gene editing vector into wheat by Agrobacterium-mediated genetic transformation method, and screen and identify positive transgenic plants with gene mutations.

[0016] The beneficial effects of the present invention are:

[0017] Pre-harvest sprouting of wheat at the mature stage is a worldwide natural disaster. After editing the TaTPI gene of wheat, the average germination rate of grains at the physiological maturity stage of wheat is reduced by 32.6%, and the average pre-harvest sprouting rate is reduced by 60.5%. Description of the Drawings

[0018] Figure 1 Segmented cloning of the TaTPI gene sequence. A and B are the amplification products of primers TPI-GF1 / TPI-GR1 and TPI-GF2 / TPI-GR2 respectively; the template used in lane 1 is Zhongyou 9507; M: DNA molecular weight standard DL2000.

[0019] Figure 2 Alignment of TaTPI amino acid sequences of Zhongyou 9507 and Chinese Spring. Zhongyou 9507, ZY; Chinese Spring, CS.

[0020] Figure 3 Schematic diagram of the promoter element structure of the TaTPI three homologous gene sequences.

[0021] Figure 4 sgRNA target sites of the wheat TaTPI gene.

[0022] Figure 5 Plasmid map of the intermediate vector pCBC-MT1T2. The blue region in the figure is the wheat TaU3 promoter, and sgRNA1 and sgRNA2 are located on both sides of this region respectively.

[0023] Figure 6 Construction of the CRISPR / Cas9-TaTPI expression vector. A: Amplification result of the sgRNA of the intermediate vector; M: DNA molecular weight standard DL2000; Lanes 1-3: sgRNA target fragments; B: Detection of the plasmid of the target fragment by single enzyme digestion; M: DNA molecular weight standard DL5000; Lane 1: Plasmid control; Lanes 2-3: Single enzyme digestion of plasmid BsaⅠ; C: Detection of the backbone vector by single enzyme digestion; M: DNA molecular weight standard DL15000; Lane 1: Plasmid negative control; Lanes 2-3: Single enzyme digestion of the backbone vector BsaⅠ; D: Identification of the recombinant vector bacterial liquid; M: DNA molecular weight standard DL2000.

[0024] Figure 7 Schematic diagram of the structure of the CRISPR / Cas9-TaTPI expression vector.

[0025] Figure 8 Detection of Bar protein in some T0 transgenic plants.

[0026] Figure 9 Molecular detection of TaTPI mutant materials. M: DNA molecular weight standard DL2000; W: H2O.

[0027] Figure 10 Editing types of sgRNA2 in T0 plants of TaTPI mutants. WT: Wild type; Underlined bases: PAM sequence; Red short lines: Deleted bases; Yellow highlighted bases: Inserted bases; Mutation types D: Deletion, I: Insertion; 3A: Wheat A genome; 3D: Wheat D genome.

[0028] Figure 11 Alignment diagram of amino acid sequences at the editing sites of some transgenic lines. In the figure, D: Deletion; I: Insertion; The black box is the position where the stop codon appears.

[0029] Figure 12 Alignment results of amino acid sequences of TaTPI mutants. A: Alignment of the amino acid sequence of mutant TaTPI-3B; B: Alignment of the amino acid sequence of mutant TaTPI-3D; The black box in the figure is the position where the stop codon appears.

[0030] Figure 13 Expression characteristics during the grain germination process of TaTPI mutant lines and wild-type plants.

[0031] Figure 14, Changes in TPI enzyme activity during the grain germination process of TaTPI mutants and wild-type wheat.

[0032] Figure 15 , Seed germination of seeds at physiological maturity (3 days).

[0033] Figure 16 , Determination of seed germination indexes of TaTPI mutant wheat at physiological maturity.

[0034] Figure 17 , Identification of the pre-harvest sprouting phenotype of TaTPI mutant wheat at physiological maturity (3 days). A: The spike after 3 days of whole-spike sprouting; B: The grains after 3 days of whole-spike sprouting. Specific implementation manners

[0035] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are some but not all of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0036] Example 1

[0037] Information about relevant test materials, reagents, primers, etc. in the example is as follows:

[0038] (1) Plant materials

[0039] The wheat variety used in the example is Zhongyou 9507, and this material is a commercially available material.

[0040] The CRISPR / Cas9 gene-edited TaTPI mutant was obtained by using JW-1 as the receptor and genetically transforming wheat immature embryos through Agrobacterium tumefaciens-mediated transformation. This TaTPI gene-edited mutant was prepared by the Shandong Academy of Agricultural Sciences. The public can also entrust the Shandong Academy of Agricultural Sciences to prepare transgenic wheat with the wheat material JW-1 as the receptor. The intermediate vector pCBC-MT1T2 and the backbone vector pLGYE-002 used for gene editing were both provided by Li Genying of the Shandong Academy of Agricultural Sciences.

[0041] The plant materials used in this example were all planted in the artificial climate chamber of Henan Agricultural University. They were randomly arranged in blocks by the method of potted planting. The plowed soil layer of 0-30 cm in the field and nutrient soil (purchased from Pindstrup Substrates, https: / / www.pindstrup.com / ) were sieved respectively and then mixed evenly at a ratio of 1:1 as the soil for potted plants. Fertilizers and pesticides were added before filling the soil into the flowerpots. The inner diameter of the flowerpot was 21 cm and the height was 24 cm; 10 kg of soil was filled in each pot; 2 g of pure N, 1.31 g of K2O, and 1.55 g of P2O5 were applied to each pot. 50% of the total N fertilizer dosage was used as the base fertilizer, and 25% of the total N fertilizer dosage was topdressed with watering during the jointing and booting stages respectively; 0.34 g of diazinon was mixed into every 10 pots. During the growth period of the crop, the light and temperature conditions in the artificial climate chamber were set as temperature 25°C, light 16 h, and darkness 8 h.

[0042] (2) Reagents and drugs

[0043] pMD19-T vector, T4 DNA Ligase, qRT-PCR reagent TB Premix Ex Taq TM II (TliRNaseH Plus), reverse transcription cDNA reagent PrimeScript TM RT reagent Kit with gDNA Eraser(Perfect Real Time), RNA extraction reagent RNAiso Plus, Premix Taq TM (LA Taq TM Version 2.0plus dye) enzymes were purchased from TaKaRa Company; Escherichia coli competent cell DH5α and total grain RNA extraction reagent TransZolPlant were purchased from Beijing TransGen Biotech Co., Ltd.; ordinary agarose gel DNA recovery kit, plasmid mini-prep kit, and PCR amplification reagents were purchased from Tiangen Biotech Company.

[0044] (3) Primer design and sequences

[0045] The primers used in the experiment were designed by Premier 5.0 software, and the primer synthesis and gene sequencing were both completed by Shangya Biotechnology Co., Ltd. The primer information is shown in Table 1.

[0046] Table 1. Primer information

[0047]

[0048] (4) DNA, RNA extraction and cDNA synthesis

[0049] DNA extraction: Extract wheat DNA by CTAB method;

[0050] RNA extraction: The total RNA of wheat grains was extracted using the TransZol Plant kit.

[0051] cDNA synthesis: The reverse transcription kit PrimeScript from TaKaRa TM RT reagent Kit with gDNA Eraser(Perfect Real Time) was used to synthesize cDNA.

[0052] 1. Cloning and sequence analysis of the TaTPI gene

[0053] 1.1 Cloning of the TaTPI gene

[0054] (1) Amplification of the TaTPI gene fragment: Using the genomic DNA of Zhongyou 9507 wheat leaves as a template, specific primers TPI-GF1 / TPI-GR1 and TPI-GF2 / TPI-GR2 were used for upstream and downstream segmental amplification. The PCR reaction system is shown in Table 2, and the PCR reaction program is shown in Table 3.

[0055] Table 2. PCR reaction system

[0056] Reagent Dosage Premix Taq(LA Taq Version 2.0 plus dye) 25 μL Template 2 μL Primer 1(20 μM) 1 μL Primer 2(20 μM) 1 μL Sterilized water up to 50 μL

[0057] Table 3. PCR amplification program

[0058] Procedure Temperature Time Number of cycles Pre-denaturation 94℃ 3 min 1 Denaturation 94℃ 30s 35 Annealing 60℃ 30s 35 Extension 72℃ 2 Kb / min 35 Post-extension 72℃ 10 min 1 Storage 4℃ 1h 1

[0059] (2) Recovery and detection of PCR products: A common agarose gel recovery kit was used to recover the PCR products. Detection of the recovered products: Using a protein and nucleic acid analyzer, the concentration and peak value of the absorption peak of the recovered products were detected; 1 μL of the recovered product was taken, 1 μL of Loading Buffer was added, and gel electrophoresis was used to detect whether the band size of the recovered fragment was as expected.

[0060] The amplification results of the PCR products are shown in Figure 1 , and it can be seen from Figure 1 that fragments consistent with the expected sizes of 1.77 kb and 1.65 kb were amplified in Zhongyou 9507.

[0061] (3) Ligation of the target fragment to the cloning vector: The recovered target fragment was ligated to the pMD19-T vector, the prepared system was mixed evenly, and the reaction was carried out at 16 °C for 8 h.

[0062] (4) Transformation of the ligation product into Escherichia coli competent DH5α.

[0063] (5) Bacterial liquid identification: Using the monoclonal bacterial liquid after amplification and shaking as a template, pMD19-T vector universal primers (M13-F / M13-R) were used for bacterial liquid PCR identification. After amplification, the PCR products were detected by gel electrophoresis. The bacterial liquid with the band size consistent with the expectation was further identified by using the specific primers of the target fragment A, B, and D genomes (TPI-GF1 / GF1-AR, TPI-GF1 / GF1-BR, TPI-GF1 / GF1-DR, TPI-GF2 / GF2-AR, TPI-GF2 / GF2-BR, TPI-GF2 / GF2-DR) for bacterial liquid PCR. 200 μL of the monoclonal bacterial liquid with the band size consistent with the expectation was aspirated for sequencing.

[0064] The sequencing results of the upstream and downstream cloned sequences were assembled to obtain the genomic sequences of the A, B, and D genomes of the Zhongyou 9507 TaTPI gene.

[0065] 1.2 TaTPI gene sequence analysis

[0066] The ORFs of the genomic sequences of the cloned Zhongyou 9507 TaTPI gene A, B, and D genomes were all 762 bp, encoding 253 amino acids, and all contained a domain of the TIM family gene. Among them, the genomic sequence lengths of the 'Zhongyou 9507' TaTPI gene were 2965 bp (SEQ ID NO: 4), 2946 bp (SEQ ID NO: 5), and 3000 bp (SEQ ID NO: 6). The cloned genomic sequences of the Zhongyou 9507 TaTPI were compared with the corresponding genomic sequences of Chinese Spring TaTPI, and the sequence similarity was found to be 93.86%. Therefore, it can be confirmed that the cloned sequence is the TaTPI gene.

[0067] The Snapgene software was used to analyze the sequence structure of the obtained TaTPI gene. The three homeologous sequences from chromosomes 3A, 3B, and 3D all contained 9 exons and 8 introns. The DNAMAN software was used to analyze the identity among the three homeologous genes. The results showed that there were partial InDel and SNP differences among the genomes of the three cloned homeologous genes, and the identity of the three homeologous sequences was 92.31%. The cloned TaTPI genomic sequences were compared with the Chinese Spring TaTPI genomic sequences on the corresponding chromosomes. The results showed that the consistencies of the TaTPI-3A, TaTPI-3B, and TaTPI-3D genomic sequences with the Chinese Spring genomic sequences on the corresponding chromosomes were 99.86%, 99.39%, and 99.96% respectively, and the different sites were mostly concentrated in the intron regions, and the exon regions were relatively conserved.

[0068] The DNAMAN software was further used to compare the amino acid sequences encoded by the cloned TaTPI gene ( Figure 2) The results showed that there were differences in 9 sites such as the 54th, 83rd, and 142nd positions of the three amino acid sequences from 3A, 3B, and 3D of the wheat variety Zhongyou 9507, and their identity was 98.81%. By comparing with the amino acid sequence encoded by the TaTPI gene of Chinese Spring, the amino acid sequences of TaTPIs had a relatively high identity, with differences only at some sites, and the difference sites accounted for about 1.05%.

[0069] 1.3 Promoter sequence analysis of TaTPI gene

[0070] Download the 2000bp sequence upstream of ATG of the TaTPI gene through NCBI (https: / / www.ncbi.nlm.nih.gov / ), and use PlantCARE (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) for promoter element analysis.

[0071] Analysis of the 2000bp promoter sequences upstream of ATG of the three genes TaTPI-3A, TaTPI-3B, and TaTPI-3D using PlantCARE found that ( Figure 3 ), in addition to containing basic elements such as the core promoter elements TATA-box and CAAT-box in the A, B, and D genomes, hormone response elements were also detected in the promoter regions of the three TaTPI genes: cis-acting regulatory elements involved in methyl jasmonate response (CGTCA-motif and TGACG-motif), cis-regulatory elements involved in abscisic acid response (ABRE); stress response elements: enhancer elements involved in hypoxia-specific induction (GC-motif), cis-acting regulatory elements involved in drought stress response (MBS), which combine with MYB transcription factors to participate in drought induction. It is speculated that these regulatory elements are related to stress gene responses. There are also some light response elements (I-box), cis-acting regulatory elements (A-box), and elements involved in palisade mesophyll cell differentiation (HD-Zip1), etc.

[0072] In addition, through comparative analysis of promoter elements in the three genomes of TaTPI-3A, TaTPI-3B, and TaTPI-3D, it was found that: in the promoter region of TaTPI-3A, cis-acting regulatory elements responsive to auxin (TGA-element) and cis-acting regulatory elements essential for anaerobic induction (ARE), which are related to antioxidant and regulation of mRNA stability, were also detected; in the promoter region of TaTPI-3B, elements involved in cold response (LTR), regulatory elements involved in circadian rhythm control (circadian), gibberellin response elements (GARE-motif), and some light response elements (chs-CMA1a, CATA-motif, and G-box) were detected; in the promoter region of TaTPI-3D, meristem-specific expression regulatory elements (CAT-box) and elements involved in light response (Box II and LAMP-element) were detected.

[0073] Analysis revealed differences in promoter elements among the genomes of the three homoeologous genes of the TaTPI gene. First, there are some identical transcriptional regulatory elements in the promoter regions of TaTPI-3A, TaTPI-3B, and TaTPI-3D, suggesting that the A, B, and D genomes have the same response pattern. Second, there are unique regulatory elements in the promoter regions of the A, B, and D genomes, suggesting that these three genes have different expression patterns under different external conditions.

[0074] 2. Creation of CRISPR / Cas9-TaTPI transgenic wheat

[0075] 2.1 Design of sgRNA for the target sequence of the TaTPI gene

[0076] According to the principle of CRISPR / Cas9 technology, through the online analysis software CRISPRresearch (http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html), "AGG" was selected as the PAM site at the 3' end of the conserved regions of the second and third exons of the three sequences of the TaTPI gene in the A, B, and D genomes, and a 20bp sequence was selected in front of the PAM site sequence as the target sequence, namely sgRNA1 (target site 1): 5'-CCTCTACGGATGTTGTCGAGGTT-3' and sgRNA2 (target site 2): 5'-TGTCTTCCTTCCCACCGTCAAGG-3'( Figure 4 ).

[0077] 2.2 Construction of the CRISPR / Cas9-TaTPI gene editing expression vector

[0078] Add the sticky-end linker GGTCTC of the BsaⅠ restriction endonuclease and the matching sequence of part of the intermediate vector pCBC-MT1T2( Figure 5 ) to the 5' end of the sequences of sgRNA1 and the reverse complementary sequence of sgRNA2, and use this as the primer for PCR amplification of the intermediate vector. The primers for amplifying sgRNA1 are MT1T2-F1 and MT1T2-F0, and the primers for amplifying sgRNA2 are MT1T2-R1 and MT1T2-R0. The primer information is shown in Table 1 (the underlined part is the BsaⅠ restriction site and part of the sequence of the intermediate vector pCBC-MT1T2). Use the intermediate vector pCBC-MT1T2 as the template for PCR amplification. The PCR reaction system is shown in Table 2, and the PCR reaction program is shown in Table 3. After amplification, detect the PCR product by agarose gel electrophoresis. Use an agarose gel recovery kit to recover and purify the gel fragment. The results show that a band with a target fragment size of about 964 bp was obtained( Figure 6 A).

[0079] Separate the recovered PCR fragment and the backbone vector pLGYE-002 (containing the Cas9 sequence, and the Cas9 sequence is shown in SEQ ID NO: 7) with the restriction endonuclease BsaⅠ by single enzyme digestion at 37 °C in a metal bath for 1 h. The enzyme digestion results are shown in Figure 6 B, 6C. Separate and recover the linearized pLGYE-002 vector plasmid and the enzyme-digested PCR recovery product. Use T4 DNA Ligase to ligate the enzyme-digested and recovered PCR fragment and the linearized pLGYE-002 vector plasmid. The reaction condition is to react at 16 °C for 1 h. After ligation, transform the ligation product into Escherichia coli competent DH5α. After transformation, coat the chloramphenicol-resistant petri dish and culture at 37 °C for 12 h. Use the primers TPI-CRISPR-F1 and TPI-CRISPR-R1 for monoclonal plaque PCR identification. The identification results are shown in Figure 6 D, and the results show that the amplified band is exactly the same as the expected size. Pipette 200 μL of the positive bacterial liquid and send it to the company for sequencing. Extract the plasmid from the bacterial liquid with the correct sequencing result using a plasmid miniprep kit. Name the recombinant vector CRISPR / Cas9-TaTPI, and the vector structure is shown in Figure 7 , and store the recombinant vector plasmid at -80 °C for a long time.

[0080] 2.3 Obtaining and molecular identification of TaTPI gene-edited mutant materials

[0081] 2.3.1 Obtaining and identification of T0 generation TaTPI mutant plants

[0082] The CRISPR / Cas9-TaTPI vector plasmid was transformed into competent cells of Agrobacterium tumefaciens strain EHA105, and plated on plates with kanamycin and rifampicin resistance. Single colonies with successful transformation were picked into 1.5 mL centrifuge tubes, and 1 mL of LB medium containing Kna+Rif antibiotics was added. It was placed on a shaker at 28 °C and shaken at 180 rpm until OD 600 ≈0.5 - 0.8, and then the cultured bacterial solution was used for subsequent processes such as infection of wheat (JW-1 material) callus, induction of embryogenic callus, and plant regeneration until transgenic regenerated plants were obtained.

[0083] After plant regeneration in this example, 43 T0 generation regenerated seedlings were obtained, numbered tpi-1 to tpi-43. To confirm whether they were transgenic seedlings, first, a BAR gold-labeled immunochromatographic rapid detection kit was used to identify the regenerated seedlings with a Bar gene test strip. It was confirmed that 22 out of 43 regenerated seedlings were positive plants, and the positive rate was 51.16% ( Figure 8 ). The 22 mutant plants were named: tpi-1, tpi-2, tpi-4, tpi-6, tpi-10, tpi-11, tpi-12, tpi-16, tpi-17, tpi-18, tpi-19, tpi-21, tpi-23, tpi-24, tpi-29, tpi-31, tpi-34, tpi-36, tpi-38, tpi-40, tpi-41, and tpi-43.

[0084] To further clarify the editing of the target site sequence of the target gene in the positive plants, a pair of specific primers TPI-CRISP-F1 and TPI-CRISP-R1 (Table 1) were designed on both sides of the editing sequence, and genomic DNA of the mutant positive plants was subjected to PCR amplification. The amplified fragment size was 307 bp ( Figure 9 ). The amplified PCR products were subjected to second-generation high-throughput sequencing (http: / / 121.40.237.174 / Hi-TOM / index.php). Using DNAMAN software to compare the sequencing results with the wild-type sequence, it was found that the gene editing sites in all 22 submitted lines occurred in the first 3 - 4 bases of the PAM sequence of target 2. The mutation types ( Figure 10 ) included the insertion of a single base (T), the deletion of a single base (G), the deletion of two bases (CG), the deletion of three bases (CCG), and the deletion of five bases (CACCG). These five editing types caused frameshift mutations in the TaTPI gene, presumably leading to premature termination of TaTPI protein translation. Therefore, the nucleotide sequence of the mutant TaTPI gene was translated into an amino acid sequence and compared with the wild-type amino acid sequence. The results showed ( Figure 11) Among the above five mutation types, except that the 3bp (CCG) base deletion has no effect on translation, the insertions of 1bp (T), deletions of 1bp (G), deletions of 2bp (CG), and deletions of 5bp (CACCG) result in stop codons at amino acid positions 55, 69, 54, and 53 respectively. The detailed editing types of target 2 in the T0 generation of each strain are shown in Figure 10 。

[0085] 2.3.2 Statistical analysis of editing types of TaTPI mutants in T1 - T5 generations

[0086] Due to the continuous activity of CRISPR / Cas9, seeds were harvested from single plants of tpi - 1, tpi - 2, tpi - 40, and tpi - 43 selected from the T0 generation mutants and planted and sequenced in the greenhouse. The results showed (Table 4) that new mutation types occurred in all four mutant lines tpi - 1, tpi - 2, tpi - 40, and tpi - 43 in the T1 generation, and all occurred on chromosomes 3B and 3D. After the T1 generation, except that a new mutation type was identified in the tpi - 2 line in the T2 generation, which showed a 24bp (CACCGTCAAGGGTAAGCTGCGCCC) base deletion in the TPI - 3B gene and an 11bp (CAGAG, G, GG, A, CC) base insertion in the TPI - 3D gene, the mutation types of the other lines were stably inherited to the offspring.

[0087] Table 4. Editing types of sgRNA2 in each generation of TaTPI mutants

[0088]

[0089] In Table 4, D: deletion, I: insertion; 3B: wheat B genome; 3D: wheat D genome.

[0090] The nucleotide sequence of the mutated TaTPI gene was translated into an amino acid sequence and aligned with the wild - type amino acid sequence. The alignment results are shown in Figure 12 。Except that the 24bp base deletion in the 3B genome of the tpi - 2 line did not affect normal translation, the mutation types in the 3B and 3D genes of the other edited lines all resulted in frameshift mutations, leading to premature termination of TaTPI protein translation. Stop codons appeared prematurely at amino acid positions 69 and 70 in the 3B and 3D genes of the tpi - 1 mutant; a stop codon appeared at amino acid position 73 in the 3D gene of the tpi - 2 mutant; stop codons appeared at amino acid positions 54 and 69 in the 3B and 3D genes of the tpi - 40 mutant; stop codons appeared at amino acid positions 69 and 68 in the 3B and 3D genes of the tpi - 43 mutant.

[0091] The above results indicate that the CRISPR / Cas9 system can effectively knockout wheat genes and create mutant lines with down-regulated expression of target genes.

[0092] 2.4 Analysis of the expression characteristics of wheat TaTPI gene in mutants

[0093] 2.4.1 Expression characteristics of wheat TaTPI gene at the transcriptional level

[0094] To determine whether the knockout of the wheat TaTPI gene caused changes in the expression levels of endogenous genes, RNA was extracted from wild-type and TaTPI mutant plants at the physiological maturity stage (imbibition 0 h) and 48 h after imbibition of grains. Primers TPI-qRT-F1 and TPI-qRT-R1 (Table 1) were designed in the conserved regions of TaTPI gene A, B, and D genes, and the changes in the expression levels of TaTPI gene were detected by qRT-PCR.

[0095] The results showed ( Figure 13 ) that the expression of TaTPI gene in TaTPI mutant plants and wild-type plants showed an upward trend during the period of 0 - 48 h of grain imbibition, and the relative expression level at 48 h was significantly higher than that at 0 h. At the two periods of 0 h and 48 h of grain imbibition, the expression levels of TaTPI gene in each TaTPI mutant line were significantly lower than those in wild-type plants, with an average decrease of 47.72% and 45.70% compared with the control.

[0096] 2.4.2 Changes in the activity of triose phosphate isomerase (TPI) in wheat TaTPI mutants

[0097] To further determine whether the TaTPI gene mutation affected the activity of the protease encoded by this gene, in this example, grains at the physiological maturity stage and 48 h after imbibition of mutants and wild-type controls were used as test materials, and the activity of triose phosphate isomerase was measured. The results showed ( Figure 14 ) that at the physiological maturity stage, compared with wild-type wheat, the TPI enzyme activity of the whole plant in mutants tpi-1, tpi-2, and tpi-40 increased significantly, with the increase rates being 85.3%, 117.63%, and 64.76% respectively. Compared with wild-type wheat, the TPI enzyme activity of mutant tpi-43 increased at the physiological maturity stage, but the difference did not reach a significant level. At 48 h after grain imbibition, the enzyme activities of mutants tpi-1 and tpi-40 decreased, and there was no significant change in TPI enzyme activity compared with wild-type wheat.

[0098] 2.5 Effects of wheat TaTPI gene knockout on the germination characteristics of wheat grains

[0099] 2.5.1 Germination characteristics of wheat grains at the physiological maturity stage

[0100] To explore the effect of TaTPI gene knockout in wheat on the germination characteristics of grains, grains at the physiological maturity stage of mutants and wild-type wheat were selected for germination tests, and the specific operations are as follows:

[0101] Grains of uniform size at the physiological maturity stage of wild-type and TaTPI mutant wheat were respectively selected. After disinfection and sterilization, they were placed with the ventral groove facing down in a sterile petri dish lined with two layers of sterilized filter paper. 30 seeds were placed in each dish, and three replicates were set. 8 mL of distilled water was added, and they were placed in an incubator at 25 °C in the dark for 24 h, and water was replenished and observed every day. Taking the emergence of the radicle as the germination standard, the number of germinated grains was statistically recorded every 24 h. After 7 d, the germination situation was statistically analyzed, and the germination potential, germination rate, and germination index were calculated. The calculation of the germination index refers to the literature (Zhang Weijun, Zhao Junjie, He Jinshang, et al. Identification of resistance to pre-harvest sprouting and evaluation of the effectiveness of related molecular markers in wheat germplasm resources in Ningxia [J]. Journal of Triticeae Crops, 2019, 39(05): 532-539.), and the calculation method is as follows:

[0102] Germination rate = total number of germinated seeds / number of tested seeds × 100%;

[0103] Germination potential = number of grains germinated on the third day / number of tested seeds × 100%;

[0104] Germination index = (7×n1 + 6×n2 + 5×n3 + … + 1×n7) / (7×N) × 100%;

[0105] In the formula, n1, n2, …, n7 refer to the number of grains germinated on the first day, second day, … seventh day of the seeds, and N refers to the total number of grains used for germination in the experiment.

[0106] The results showed that ( Figure 15 ), the number of germinated grains of the 4 mutants was significantly lower than that of the control plants; further statistical analysis of the germination potential, germination rate, and germination index showed that ( Figure 16 ), compared with the wild type, the germination rate, germination potential, and germination index of the mutant lines were all lower than those of the control, with an average decrease of 32.62%, 42.77%, and 29.31% respectively compared with the control. There were significant differences in the decrease in germination among the mutant lines. The mutant lines tpi-1 and tpi-2 had larger decreases, with an average decrease of 42.68%, 64.04%, and 46.17% respectively compared with the control.

[0107] The above results indicate that the TaTPI gene plays a certain promoting role in the process of seed germination. After the TaTPI gene mutation, the germination ability of grains is significantly inhibited.

[0108] 2.5.2 Pre-harvest sprouting characteristics of wheat at the physiological maturity stage

[0109] The ear sprouting of wheat ears at physiological maturity stage was identified, and the specific operation was as follows: The method for identifying ear sprouting referred to the "Agricultural Industry Standard of the People's Republic of China - Detection Method for Wheat Resistance to Ear Sprouting" NY / T 1739-2009, and the determination method was as follows:

[0110] Select wheat ears with basically the same size at physiological maturity stage. First, soak them in tap water for 4 h, then disinfect them with 0.1% sodium hypochlorite solution for 5 min, and then place them in a light incubator (22 °C, 100% RH) for 72 h. Manually shell the grains, and take the rupture of the embryo epidermis as the germination standard. Count the total number of grains and the number of germinated grains respectively, and calculate the ear sprouting rate. The results showed that the ear sprouting rates of mutants tpi-1, tpi-2, and tpi-40 decreased by 43.0%, 75.8%, and 62.8% respectively compared with the control, and the average ear sprouting rate of the three mutant lines decreased by 60.5% compared with the control. The germination degree of TaTPI mutants was significantly lower than that of the control, indicating that after the TaTPI gene mutated, the ear sprouting tolerance of wheat was significantly improved( Figure 17 ).

[0111] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements for some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. TaTPI Gene, TaTPI protein encoded by the gene, target TaTPI Application of the recombinant vector targeting the gene and the cell containing the recombinant vector in regulating pre-harvest sprouting tolerance of wheat; TaTPI The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO:

3.

2. The application according to claim 1, wherein By inhibiting TaTPI gene expression and reducing the content of TaTPI protein to improve the pre-harvest sprouting tolerance of wheat.

3. The application according to claim 1, characterized in that, The suppression TaTPI of gene expression or reduction of TaTPI protein content is achieved by the CRISPR / Cas9 gene editing method.

4. The application according to claim 1, characterized in that, The target TaTPI recombinant vector for the gene is a vector used to silence the TaTPI gene in wheat.

5. The application according to claim 1, characterized in that Targeted TaTPI The recombinant vector targeting the gene is an RNAi silencing recombinant vector or a CRISPR / Cas9 gene editing recombinant vector.

6. The application according to claim 1, characterized in that, The recombinant bacterium is Escherichia coli or Agrobacterium tumefaciens containing the recombinant vector.

7. A method for cultivating pre-harvest sprouting-resistant wheat, characterized in that, Including the step of inhibiting gene expression in wheat or reducing the content of TaTPI protein; TaTPI The amino acid sequence of the protein encoded by the gene is as shown in SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:

3. TaTPI The amino acid sequence of the protein encoded by the gene is as shown in SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:

3.

8. The method according to claim 7, wherein Inhibition of gene expression in wheat by CRISPR / Cas9 gene editing TaTPI Gene expression 9. The method according to claim 8, wherein Including: (1)Construct a CRISPR / Cas9 gene editing recombinant vector targeting TaTPI gene; TaTPI The target sequences of the genes are respectively sgRNA1: 5'-CCTCTACGGATGTTGTCGAGGTT-3' and / or sgRNA2: 5'-TGTCTTCCTTCCCACCGTCAAGG-3'; (2) Transforming the CRISPR / Cas9 gene editing vector into wheat by Agrobacterium-mediated genetic transformation method, and screening and identifying to obtain positive transgenic plants with gene mutations.

Images