Application of soybean GmSRO5 gene in promoting nodule formation in leguminous plants

By overexpressing the GmSRO5 gene in soybeans and using Agrobacterium-mediated genetic transformation technology, the problem of insufficient number of soybean rhizomes was solved, and the number of soybean rhizomes was significantly increased and the nitrogen fixation capacity was improved, which was of great application value.

CN120249373BActive Publication Date: 2025-08-08SHANDONG AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510736355.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-04
Publication Date
2025-08-08
Estimated Expiration
2045-06-04

AI Technical Summary

Technical Problem

There is a lack of effective methods in the prior art to significantly improve the number of soybean nodules and nitrogen fixation capacity, affecting soybean yield and nitrogen nutrition supply.

Method used

By identifying the soybean GmSRO5 gene and using Agrobacterium-mediated genetic transformation technology, overexpressing the GmSRO5 gene will increase the number of soybean rhizombas and enhance nitrogen fixation ability.

Benefits of technology

It significantly increases the number of soybean rhizombies and improves the nitrogen fixation capacity and yield of soybeans. It has important application value and is suitable for soybean production and molecular breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249373B_ABST
    Figure CN120249373B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to soybean GmSRO5 The present invention uses pZP211 overexpression vector to rapidly obtain transgenic plants through Agrobacterium-mediated soybean genetic transformation, and successfully GmSRO5 Overexpression was performed and the number of nodules in the chimeric transgenic plants was counted. GmSRO5 The gene can positively regulate the number of soybean nodules and the effect is significant. SRO5 It can positively regulate the soybean nodulation process and prove that soybean GmSRO5 Gene overexpression can significantly increase the number of soybean nodules. In the future, it can be applied to soybean production and molecular breeding through genetic modification, molecular markers and other means, and has very important application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to soybean GmSRO5 Application of genes in promoting nodule formation in leguminous plants. Background Art

[0002] Soybeans are an important dual-purpose grain and oil crop, as well as a vital industrial raw material and a good roughage for livestock. Nitrogen is a macronutrient essential for plant growth and development, forming a building block for key components in organisms, such as proteins, nucleic acids, and chlorophyll. Soybeans contain approximately 40% protein and require significant amounts of nitrogen, which they obtain from soil nitrogen, fertilizer nitrogen, and nodulation nitrogen fixation. Nodulation nitrogen fixation can provide 50-60% of a soybean plant's nitrogen needs (Hou Huiyun et al., 2022). Nodulation nitrogen fixation not only increases soybean yields but also reduces cultivation costs and mitigates environmental pollution. Therefore, improving soybean's nitrogen fixation capacity is of great production significance.

[0003] Root nodules, unique structures of legumes, convert free nitrogen in the air into ammonium and nitrate, which are then directly absorbed and utilized by the organism. The establishment of the soybean-rhizobium symbiotic nitrogen-fixing system involves signal recognition, infection, infection line formation, nodule primordium formation, and nodule maturation. First, soybean roots secrete flavonoid signaling substances into the soil. Upon recognition, rhizobia release nodulation factors, stimulating the formation of infection lines within root hairs and the production of nodule primordia, ultimately leading to the formation of mature nodules (Svistoonoff et al. 2014; Soyano et al. 2021).

[0004] Publicly available literature has shown that the soybean nucleoporin gene GmNup96 can regulate nodule formation, and that a mutant GmARF16 gene in soybean hairy roots can inhibit nodule formation. As for the application of nodulation and nitrogen fixation, the development of more diverse and effective technologies is urgently needed to enhance their effectiveness.

[0005] SRO (similar to radical-induced cell death) proteins are a family of small plant-specific transcription factors that play important roles in plant resistance to biotic and abiotic stresses, growth, and development. Previous studies have shown that rice OsSRO1c regulates drought and oxidative stress by promoting stomatal closure and H₂O₂ accumulation through abscisic acid and jasmonic acid signaling pathways (You et al., 2013). Maize ZmSRO1e promotes mesocotyl elongation by interacting with ZmbZIP61 (Qin et al., 2024). Wheat TaSRO1 regulates seedling vigor and tolerance to abiotic stress by modulating redox homeostasis and maintaining genomic stability (Liu et al., 2014). Analysis of the SRO family in Brassica napus identified BnaSRO1 and BnaSRO11 as potential major drought-responsive members, potentially acting as target genes of NACs involved in drought regulation (Jiang et al., 2024). However, the functional study of the SRO family in soybean has not been reported. GmSRO5 The gene was identified and its function in regulating soybean nodule formation was studied. Summary of the Invention

[0006] In order to solve the deficiencies of the prior art, the present invention provides a soybean GmSRO5 Application of genes in promoting nodule formation in leguminous plants.

[0007] By comparing the homology with the SRO family gene sequences in Arabidopsis, we identified GmSRO5 Gene (Glyma.04G183100), soybean GmSRO5 The CDS sequence of the gene is shown in SEQ ID NO. 1. The amino acid sequence of the encoded protein is shown in SEQ ID NO. 2.

[0008] Soybean nodule GmSRO5 In the process of identifying the function of the gene, the present invention uses an overexpression vector to quickly obtain chimeric transgenic plants through Agrobacterium-mediated soybean hairy root genetic transformation, and successfully GmSRO5 Gene overexpression, the results showed that overexpression GmSRO5 The gene can increase the number of soybean nodules. GmSRO5 Overexpression can increase the number of root nodules, enhance nitrogen fixation ability, and thus improve the yield and quality of legumes. Preferably, the legume is soybean.

[0009] As a second aspect of the present invention, a plant breeding method is provided, which can promote the production of nodules in leguminous plants and can be method (1) or method (2):

[0010] Method (1) is to increase the activity of the protein GmSRO5 in the target plant to obtain plants with more nodules than the target plant. Generally speaking, an increase in gene expression will promote an increase in the corresponding protein content. Therefore, it is speculated that increasing the protein content of GmSRO5 can also promote an increase in the number of nodules.

[0011] Method (2) is to promote the growth of target plants GmSRO5 By regulating the expression of the gene, plants with more nodules than the target plant are obtained.

[0012] Preferably, the target plant is soybean.

[0013] Preferably, method (2) promotes GmSRO5 The expression of the gene is achieved by:

[0014] Method (1) is to GmSRO5 Gene introduction into target plants;

[0015] Method (2) is to introduce a strong promoter and / or enhancer;

[0016] Method (3) includes other common methods in the art, including small RNA regulation, methylation / demethylation, phosphorylation / dephosphorylation, promoter binding site regulation, etc.

[0017] Furthermore, the method (1) includes the following steps:

[0018] Step 1: Soybeans GmSRO5 Construction of gene overexpression vectors;

[0019] Including the extraction and reverse transcription of soybean root RNA, PCR amplification using the reverse transcribed cDNA as a template GmSRO5 The full-length cDNA sequence was constructed GmSRO5 Gene overexpression vectors;

[0020] Step 2: Genetic transformation of soybean hairy roots.

[0021] Preferably, in step 1, the overexpression vector pZP211 is used to prepare GmSRO5 Overexpression vector pZP211-35S- GmSRO5 , pZP211-35S- GmSRO5 The plasmid was transferred into Agrobacterium rhizogenes for genetic transformation of soybean hairy roots.

[0022] Preferably, in step 2, GmSRO5Agrobacterium overexpressing plasmid infects the cotyledonary node of legume plant. After hairy roots grow out, the infected site of the cotyledonary node of legume plant and the part below are buried with vermiculite, watered thoroughly, and cultured to obtain GmSRO5 Gene overexpression plants.

[0023] More specifically, the present invention also provides a method for increasing soybean nodule production, the method comprising the following steps:

[0024] (1) Soybeans GmSRO5 Construction of gene overexpression vector: amplified from soybean cDNA GmSRO5 The full-length cDNA sequence was connected into the vector pZP211 to construct the overexpression vector pZP211-35S- GmSRO5 ;

[0025] (2) Genetic transformation of soybean hairy roots: The overexpression vector pZP211-35S- GmSRO5 The plasmid was transferred into Agrobacterium rhizogenes for genetic transformation of soybean hairy roots;

[0026] (3) Screening of positive soybean plants: After PCR amplification, positive plants are screened to obtain soybean plants with increased number of nodules.

[0027] In the present invention, there are no particular limitations on the plants or target plants suitable for the present invention, as long as they are suitable for genetic transformation, such as various crops, flower plants, or forestry plants. The plants may be, for example (but not limited to): dicots, monocots, or gymnosperms.

[0028] As a preferred embodiment, the "plant" includes but is not limited to leguminous plants, especially soybeans, and any plant having the gene or a gene homologous thereto is applicable.

[0029] As used herein, "plant" includes the entire plant, its parent and progeny plants, and various parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues, and organs, all of which contain the target gene or nucleic acid. "Plant" also includes plant cells, suspension cultures, callus, embryos, meristematic regions, gametophytes, sporophytes, pollen, and microspores, each of which may contain the target gene / nucleic acid.

[0030] The present invention encompasses any plant cell, or any plant obtained or obtainable by any of the methods herein, and all plant parts and propagules thereof. The present invention also encompasses transfected cells, tissues, organs, or whole plants obtained by any of the aforementioned methods. The only requirement is that the progeny exhibit the same genotypic or phenotypic characteristics, and that the progeny obtained using the methods of the present invention have the same characteristics.

[0031] The present invention also extends to harvestable parts of the plants described above, including, but not limited to, seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers, and bulbs. It further relates to other derivatives of the harvested plants, such as dry granules or powders, oils, fats and fatty acids, starches, or proteins. The present invention also relates to foods or food additives obtained from the plants.

[0032] The beneficial effects of the present invention are:

[0033] (1) This invention proposes for the first time SRO5 It can positively regulate the soybean nodulation process and prove that soybean GmSRO5 Gene overexpression can significantly increase the number of soybean nodules. In the future, it may be applied to soybean production and molecular breeding through transgenic technology, molecular markers, etc., and has very important application value.

[0034] (2) The breeding method provided by the present invention significantly increases the number of soybean nodules, which has important theoretical value and practical significance for cultivating high-quality and high-yield soybean germplasm and has broad application prospects in plant molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0036] Figure 1 for GmSRO5 Expression patterns of genes in overexpressing soybean hairy roots.

[0037] Figure 2 Empty vector (Control) and overexpression GmSRO5 Comparison of soybean nodule numbers of gene lines; a and b represent empty vector and overexpression, respectively. GmSRO5 Plants ( GmSRO5 OE -9 ) of soybean nodules; c is the empty vector line, overexpression line GmSRO5 strain ( GmSRO5 OE ) were performed, with three replicates in total. DETAILED DESCRIPTION

[0038] It should be noted that the following detailed descriptions are exemplary and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs.

[0039] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be purchased from the market.

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0041] Unless otherwise indicated, the practice of the present invention will utilize conventional botanical techniques, microbiology, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination, and bioinformatics techniques readily apparent to those skilled in the art. These techniques are fully explained in the published literature. In addition, the methods employed in the present invention for DNA extraction, phylogenetic tree construction, gene editing methods, gene editing vector construction, and gene-edited plant production, in addition to the methods employed in the following examples, can all be accomplished using methods disclosed in the existing literature.

[0042] The gene referred to herein may include introns and exons in the genomic sequence, and / or include the coding sequence in the cDNA, and / or include cDNA and its regulatory sequences. In particular embodiments, for example, regarding the isolated nucleic acid sequence, it is preferably acquiesced to as cDNA.

[0043] "Expression vector" refers to a vector that adds expression elements (such as promoter, RBS, terminator, etc.) to the basic skeleton of a cloning vector to enable the expression of the target gene.

[0044] "Agrobacterium-mediated transformation" refers to the technology of inserting the target gene into the modified T-DNA region, using the infection of Agrobacterium to achieve the transfer and integration of exogenous genes into plant cells, and then regenerating transgenic plants through cell and tissue culture technology.

[0045] Example 1 Soybean GmSRO5 Prediction of gene fragments

[0046] Soybean GmSRO5 The gene fragment (Glyma.04G183100) has a CDS sequence as shown in SEQ ID NO.1. The full-length coding frame nucleotide sequence of the gene is 954 bp in length and consists of 317 amino acids. The protein sequence is shown in SEQ ID NO.2.

[0047] Example 2 Overexpression GmSRO5 The number of root nodules in transgenic soybean plants increased

[0048] 1. Soybeans GmSRO5 Construction of gene overexpression vector

[0049] (1) Extraction and reverse transcription of soybean root RNA

[0050] 1. Extract total RNA using TRIzol method

[0051] (1) Weigh approximately 0.1 g of soybean W82 roots, freeze them in liquid nitrogen, grind them into fine powder, add 1 mL of TRIzol extract, vortex for 2 min, and let stand at room temperature for 5 min.

[0052] (2) Centrifuge at 12,000 rpm for 10 min at 4°C to remove the precipitate;

[0053] (3) Transfer the supernatant to a new centrifuge tube, add 200 μL of chloroform, vortex, and let stand at room temperature for 3 min;

[0054] (4) Centrifuge at 11,000 rpm for 10 min at 4°C;

[0055] (5) Transfer the supernatant to a new centrifuge tube, add 600 μL of isopropanol, and let it stand at room temperature for 10 min;

[0056] (6) Discard the supernatant, add 1 mL of 75% ethanol, resuspend, and centrifuge at 11,000 rpm for 5 min at 4°C; repeat once.

[0057] (7) Open the lid and dry at room temperature for 5-7 min, add 20 μL DEPC-H2O to dissolve the precipitate, and freeze at -80°C.

[0058] 2. Reverse transcription of cDNA

[0059] (1) Use the kit provided by Vazyme Company to perform reverse transcription according to the instructions. Take the RNA product of the previous step as the template and perform the reaction in a 0.2 ml centrifuge tube for two steps. The genomic gDNA removal mixed system is shown in Table 1. First, prepare the genomic gDNA removal mixed system (Table 1). Add 4 μL of 4×gDNA wiper mix and 1pg-1μg of RNA template to the centrifuge tube in sequence. Add RNase-free ddH2O to make the volume 16 μL. Mix gently with a pipette, centrifuge, and react at 42℃ for 2 min on a PCR instrument:

[0060] Table 1 Mixed system for genomic gDNA removal

[0061]

[0062] (2) Take out the reaction product from the previous step and add 4 μL of 5×HiScript III qRT SuperMix to quantify it to 20 μL. Mix gently with a pipette tip and place the microcentrifuge tube on a PCR instrument at 37°C for 15 minutes or 85°C for 5 seconds. The product is cDNA. After the reaction is completed, take it out for use or store it at -20°C.

[0063] (II) Obtaining the full-length cDNA sequence

[0064] Design specific primers GmSRO5 OX -F, GmSRO5 OX -R, F, and R end primers are respectively Bam HI Xba Ⅰ restriction enzyme cutting site. PCR amplification was performed using the cDNA synthesized by reverse transcription as a template.

[0065] GmSRO5 OX -F:

[0066] 5'- GGTACCCGAGGATCCATGGAACTAACATTCCCTCATC -3';

[0067] GmSRO5 OX -R:

[0068] 5'-GTAGTCCATTCTAGAAAAAGAGAATCGACGTACCTTG -3';

[0069] The PCR amplification system is shown in Table 2.

[0070] The PCR reaction program was as follows: pre-denaturation at 95°C for 7 min; 35 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 1 min, and extension at 72°C for 1 min; and extension at 72°C for 5 min.

[0071] Table 2 PCR amplification system

[0072]

[0073] The PCR product was electrophoresed on 1.5% agarose gel to obtain a 954 bp GmSRO5 The full-length cDNA sequence.

[0074] (three) GmSRO5 Construction of gene overexpression vector

[0075] The target band was recovered using the Kangwei DNA recovery and purification kit, and the purified DNA fragment was then ligated into the vector pGEM-T (Promega) and transformed into E.coli DH5ɑ competent cells were used to select positive clones for plasmid extraction, and sequencing was completed by BGI, obtaining a 954 bp GmSRO5 The fragment has the DNA sequence of SEQ ID NO.1 in the sequence table. The above-mentioned purified cDNA fragment was digested by double enzyme ( Bam HI Xba Ⅰ) Ligation into overexpression vector pZP211, heat shock transformation E. coli After the DH5α competent cells were grown, the recombinants were subjected to colony PCR and agarose gel electrophoresis. The recombinants contained a band of the same size as the target fragment. The identified recombinants were expanded and cultured, and the plasmids were extracted. After the plasmids were sequenced and compared with the original sequence, the inserted fragments were full-length cDNA and had no base mutations or deletions, proving that GmSRO5 Overexpression vector pZP211-35S- GmSRO5 The construction was successful. GmSRO5 The plasmid and the pZP211 empty vector plasmid were respectively transformed into Agrobacterium rhizogenes K599 for genetic transformation of soybean hairy roots.

[0076] 2. Genetic Transformation of Soybean Hairy Roots

[0077] (1) Plant Williams 82 soybeans in mixed soil and germinate them in a greenhouse. When the cotyledons are not fully expanded after 6 days, use a syringe to pick out the GmSRO5 Agrobacterium overexpressing the plasmid and Agrobacterium containing the pZP211 empty vector plasmid were used to infect the cotyledonary nodes respectively.

[0078] (2) After the injection is completed, cover it with a transparent cover to keep the inside moist. After the hairy roots grow, bury the infected site of the soybean cotyledonary node and the part below it with vermiculite and water it thoroughly.

[0079] (3) After 6 days, remove the transparent cover and cover the infected area and the area below with moist vermiculite to maintain a moist environment. Water the infected area every 2 days. Incubate at 28°C with 14 h light / 10 h dark for about 2 weeks before analyzing the nodulation phenotype.

[0080] 3. Positive identification of overexpressing transgenic material

[0081] Pick GmSRO5 The genomic DNA was extracted from the single root of the gene overexpressing plant and the expression vector was constructed using GmSRO5The specific primers of the gene were used to amplify the PCR products and the PCR products were identified by agarose gel electrophoresis. GmSRO5 Overexpression of transgenic positive seedlings can be used for phenotypic analysis.

[0082] Four, GmSRO5 Detection of gene expression patterns in soybean overexpression hairy roots

[0083] The qRT-PCR method was used to detect GmSRO5 Expression patterns of genes in soybean overexpression hairy roots. GmSRO5 Roots of transgenic seedlings expressing the gene and the empty vector were snap-frozen in liquid nitrogen and stored at -80°C. Total RNA was extracted using the TRIzol method and reverse-transcribed to obtain cDNA. The reaction was performed using a TAKARA fluorescence quantitative PCR kit. The reaction was performed on an Applied Biosystems Stepone Plus instrument, and gene expression levels were determined using relative quantification methods. The reaction procedure was performed according to the TAKARA manual. Actin The gene was used as an internal reference in the reaction, and the primer sequences were:

[0084] GmActin -F:5'- CGGTGGTTCTATCTTGGCATC -3'

[0085] GmActin -R:5'- GTCTTTCGCTTCAATAACCCTA -3'

[0086] GmSRO5 -F:5'- CGCTTTCCAAGGTTTTGCCT -3'

[0087] GmSRO5 -R:5'-GAATCGACGTACCTTGTTGTCT -3'

[0088] The reaction procedure was as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 56°C for 40 s, extension at 72°C for 40 s, and 35 cycles. -ΔΔCt Method calculation A The expression level of the gene was measured. This experiment was repeated three times. GmSRO5 As shown, the analysis results showed that when overexpressed Figure 1 In the hairy roots of genes, GmSRO5 The expression level increased significantly.

[0089] 4. Analysis of soybean plant nodulation phenotype

[0090] (1) When the plant has grown for 25-30 days (the length of the hairy roots is 5-10 cm), cut off the main root and transplant the composite plant into a small hole with a nutrient soil: vermiculite ratio of 1:1 for further cultivation;

[0091] (2) After 3 days, 50 mL of soybean Bradyrhizobium USDA110 (OD 600 =0.08), evenly pour it around the root system, treat it once every other week, and pour the bacteria for 3 weeks in total.

[0092] (3) After one week of recovery, the soil on the surface of the hairy roots was washed off, the number of nodules was counted and photographed. The above experiment was repeated three times. GmSRO5 It can be seen that Figure 2 a in Figure b in the figure shows the empty vector transformed plant and an overexpression plant ( ​ OE - 9 ) root phenotype diagram. It can be seen from the figure that the number of nodules in the overexpression plants is significantly more than that in the empty vector plants. In addition, ​ c in Figure 2 shows that the average number of nodules in hairy roots of the empty vector-transformed strains and the overexpression strains was 13.05, while the average number of nodules in hairy roots of the overexpression strains was 13.05. ​ strain ( ​ OE The average number of nodules in soybean hairy roots was 20.02, which was an average increase of 53.41% compared with the empty vector, and reached an extremely significant level. ​ The gene can significantly increase the number of soybean nodules.

[0093] This invention proposes for the first time that SRO5 can positively regulate the soybean nodulation process, which has important theoretical value and practical significance for cultivating high-quality and high-yield soybean germplasm, and has broad application prospects in plant molecular breeding.

[0094] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. Soybeans GmSRO5 The application of the gene in promoting the production of nodules in leguminous plants is characterized in that: described GmSRO5 The CDS sequence of the gene is shown in SEQ ID NO. 1, and the legume plant is soybean.

2. Contains GmSRO5 The use of a gene overexpression vector in promoting the production of leguminous plant nodules is characterized in that: described GmSRO5 The CDS sequence of the gene is shown in SEQ ID NO. 1, and the legume plant is soybean.

3. The use according to claim 1 or 2, characterized in that Promoting nodule formation is manifested in increasing the number of soybean nodules.

4. The use according to claim 1, characterized in that The soybean GmSRO5 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.

2.

5. A plant breeding method, characterized in that: The method is selected from method (1) or method (2): Method (1) is to increase the activity of GmSRO5 protein in the target plant to obtain a plant with more nodules than the target plant; Method (2) is to promote the growth of GmSRO5 By expressing the gene, plants with more nodules than the target plant are obtained; The soybean GmSRO5 The CDS sequence of the gene is shown in SEQ ID NO.

1. GmSRO5 The amino acid sequence of the protein is shown in SEQ ID NO. 2; the target plant is soybean.

6. The method according to claim 5, characterized in that Method (2) Promote the growth of target plants GmSRO5 The gene expression is achieved by selecting from the following methods (1) or (2): Method (1) is to GmSRO5 Gene introduction into target plants; Method (2) is to introduce a strong promoter and / or enhancer.

7. A method for increasing soybean nodule production, characterized in that: The method comprises the following steps: (1) Soybeans GmSRO5 Construction of gene overexpression vector: Amplify the gene as claimed in claim 1 from soybean cDNA GmSRO5 The full-length cDNA sequence of the gene was connected into the vector pZP211 to construct the overexpression vector pZP211-35S- GmSRO5 ; (2) Genetic transformation of soybean hairy roots: The overexpression vector pZP211-35S- GmSRO5 The plasmid was transferred into Agrobacterium rhizogenes for genetic transformation of soybean hairy roots; (3) Screening of soybean positive plants: After PCR amplification, positive plants are screened to obtain soybean plants with increased number of nodules.

Citation Information

Patent Citations

  • Methods for producing proteins in plants

    CN106520520A

  • Application of soybean GmNOD19 gene in promoting generation of leguminous plant root nodules

    CN117004644A