CsCRK10 gene, application of encoded protein and method for improving citrus canker resistance

Abstract

The invention relates to the technical field of agricultural biological genes, and discloses a CsCRK10 gene, application of encoded protein and a method for improving citrus canker resistance, and the citrus canker resistance of citrus plants is improved by adjusting the expression level of the CsCRK10 gene in the citrus plants; the method specifically comprises the following steps: (1) cloning a citrus CsCRK10 gene sequence; (2) constructing an overexpression vector; and (3) transforming the overexpression vector into citrus to obtain a transgenic material with an up-regulated CsCRK10 gene expression level. By cloning the coding sequence of the CsCRK10 gene of the citrus, constructing an overexpression vector and then transforming the citrus, the canker attack degree of the obtained CsCRK10 overexpression transgenic plant can be reduced to 66.17% of that of the existing citrus to the maximum extent, the canker attack degree can be effectively and remarkably reduced, the scab area is reduced, the phenotype of the transgenic plant is not influenced, and the method is suitable for industrial production. The gene has a great application value for canker-resistant breeding of citrus, and can be used as a candidate gene for canker-resistant breeding with a plurality of canker-resistant and susceptible genes.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biological gene technology. Specifically, it relates to the application of the CsCRK10 gene, the encoded protein, and a method for improving the resistance of citrus to citrus canker disease. Background Art

[0002] Citrus is the main economic pillar in the mountainous areas of southern China and also an important economic crop globally. However, with the development of the industry, citrus is also vulnerable to diseases, and one of the common diseases is citrus canker disease. Citrus canker disease is the main bacterial disease in citrus production areas, caused by the plant pathogenic bacterium Xanthomonas citri subsp. Citri (Xcc). Xcc can infect above-ground parts such as leaves, fruits, branches, and sepals; fruits infected with Xcc may show chlorosis and abscission, and the premature dropping and discoloration of fruits will cause huge economic losses. It has been found that different citrus varieties have different resistances to citrus canker disease. Lime and sweet orange are the most severely infected, lemon, pomelo, and grapefruit are moderately infected, and kumquat is the most resistant.

[0003] So far, there is no radical cure for citrus canker disease. Physical control, chemical control, and integrated control methods are mainly adopted to prevent the occurrence of canker disease. However, the extensive use of chemical agents will cause irreversible pollution to the environment. Strict epidemic prevention systems can prevent the spread of the pathogen, but cannot completely eliminate diseased trees. Therefore, in citrus canker disease epidemic areas, new disease-resistant varieties can be cultivated and planted to enhance the ability of citrus to resist canker disease, thereby achieving the control effect. The long breeding cycle of cross-breeding results in low breeding efficiency. With the rise of molecular biology, people have begun to study the pathogen itself and the disease-resistant defense response of plants from the direction of disease-resistant genetic engineering. With the continuous discovery of disease-resistant genes, new ideas have been provided for citrus molecular breeding. Overexpression of CsBZIP40 affects the production of salicylic acid (SA) and the expression of genes related to its signaling pathway. Defense genes (Pathogenesis-related, PR) can be activated through the SA signaling pathway, which plays an important role in improving the resistance of citrus to citrus canker disease. After overexpression or interference expression of transcription factors such as CitMYB20, CsWRKY61, CsAP2-09, and CsLOB1 in citrus, the resistance of transgenic citrus to canker disease changes, indicating that these transcription factors are related to canker disease. Genome editing of CsWRKY22 mediated by CRISPR / Cas9 and interference mutation of CsDMR6 significantly reduce the susceptibility to citrus canker disease.

[0004] Cysteine-rich receptor-like kinases (CRKs) belong to a large family of receptor-like kinases (RLKs) containing DUF26. They play crucial roles in biotic stress, abiotic stress, immunity, abiotic stress responses, as well as growth and development. For example, in chili peppers, CaCRK5 is involved in regulating SA-mediated signal transduction and the expression of multiple downstream genes, which are involved in defense against Ralstonia solanacearum; Arabidopsis AtCRK2 enhances salt tolerance during germination and is also involved in regulating root length; CRK28 inhibits the germination of lateral root primordia and the main root meristem, and reduces ovule length and seed number. Currently, there is no research or application on using CRKs to improve the resistance of citrus to citrus canker.

[0005] In view of this, the present application is specifically proposed. Summary of the Invention

[0006] The present invention provides an application of the CsCRK10 gene, the encoded protein, and a method for improving the resistance of citrus to citrus canker. By integrating the cysteine-rich receptor-like kinase-encoding gene CsCRK10 of citrus into citrus through an expression vector, the resistance of citrus to citrus canker can be significantly improved, and the phenotype of transgenic plants is not affected. It has great application value in citrus canker resistance breeding and can be used as a candidate gene for canker resistance breeding with multiple canker-resistant and -susceptible genes.

[0007] The present invention is achieved through the following technical solutions:

[0008] In the first aspect, the present invention provides an application of the CsCRK10 gene for improving the resistance of citrus plants to citrus canker or for breeding citrus varieties with improved resistance to citrus canker;

[0009] The nucleotide sequence of the CsCRK10 gene is as shown in SEQ ID NO: 1.

[0010] In the second aspect, the present invention provides an application of the protein encoded by the CsCRK10 gene in improving the resistance of citrus plants to citrus canker or breeding citrus varieties with improved resistance to citrus canker.

[0011] In the third aspect, the present invention provides a method for improving the resistance of citrus to citrus canker by using the CsCRK10 gene. By regulating the expression level of the CsCRK10 gene in citrus plants, the resistance of citrus plants to citrus canker is improved. The nucleotide sequence of the CsCRK10 gene is as shown in SEQ ID NO: 1.

[0012] In a specific embodiment, the specific method for regulating the expression level of the CsCRK10 gene is: up-regulating the expression level of the CsCRK10 gene in citrus plants.

[0013] In a specific embodiment, the method for up-regulating the expression level of the CsCRK10 gene in citrus plants is as follows: an overexpression vector is used to control the expression level of the CsCRK10 gene in citrus cells, thereby increasing the accumulation of the citrus cysteine-rich receptor-like kinase encoded by the CsCRK10 gene in citrus.

[0014] In a specific embodiment, a method for improving the resistance of citrus to citrus canker by using the CsCRK10 gene includes the following steps:

[0015] (1) Clone the coding sequence of the citrus CsCRK10 gene;

[0016] (2) Construct an overexpression vector for the CsCRK10 gene;

[0017] (3) Transform citrus with the overexpression vector of the CsCRK10 gene to obtain transgenic plants with improved resistance to citrus canker.

[0018] In a specific embodiment of step (1), the method for cloning the coding sequence of the citrus CsCRK10 gene is as follows: extract the total RNA of citrus, then reverse transcribe it into cDNA, and finally amplify the DNA fragment of the coding sequence of the CsCRK10 gene by PCR.

[0019] In a specific embodiment of step (1), the primers used for PCR amplification are OE-CsCRK10-F and OE-CsCRK10-R, and their nucleotide sequences are SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0020] In a specific embodiment of step (2), the method for constructing the overexpression vector of CsCRK10 is as follows: the DNA fragment of the CsCRK10 coding sequence recovered by digestion with BamHI and SalI is ligated to the pLGNe vector recovered by digestion with BamHI and SalI to construct the overexpression vector pLGNe-CsCRK10.

[0021] In a specific embodiment of step (3), the method for transforming citrus with the overexpression vector of CsCRK10 is as follows: the overexpression vector pLGNe-CsCRK10 is transformed into Agrobacterium tumefaciens by electroporation, and then the Agrobacterium tumefaciens is used to mediate the transformation of citrus explants, and transgenic plants are obtained by genetic transformation.

[0022] In a specific embodiment, the transgenic plants are obtained after the explant cells after genetic transformation are identified by GUS staining, grafted, identified by PCR, and the expression level of CsCRK10 is analyzed by qRT-PCR.

[0023] In a specific embodiment, the primers for PCR identification of transgenic plants are: ID-CsCRK10-F and ID-CsCRK10-R. ID-CsCRK10-F is designed according to the terminal sequence of the CsCRK10 gene, and ID-CsCRK10-R is a sequence taken from behind CaMV 35S on the pLGNe vector, and they are nucleotide sequences shown in SEQ ID NO: 4 and SEQ ID NO: 5 respectively.

[0024] In a specific embodiment, the primers for qRT-PCR analysis of CsCRK10 expression level are: RT-CsCRK10-F and RT-CsCRK10-R, and they are nucleotide sequences shown in SEQ ID NO: 6 and SEQ ID NO: 7 respectively.

[0025] In a specific embodiment, after obtaining the transgenic plants in step (3), the transgenic plants are subjected to resistance evaluation, and it is determined that overexpression of CsCRK10 improves the resistance to citrus canker.

[0026] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0027] 1. A method for the application of a CsCRK10 gene, encoded protein and improving the resistance to citrus canker provided by the embodiment of the present invention. By cloning the coding sequence of the citrus CsCRK10 gene, constructing an overexpression vector, and then transforming citrus leaves, the incidence degree of canker of the obtained CsCRK10 overexpression transgenic plants can be reduced to 66.17% of the existing citrus at most, which can effectively and significantly reduce the incidence degree of canker and reduce the lesion area;

[0028] 2. A method for the application of a CsCRK10 gene, encoded protein and improving the resistance to citrus canker provided by the embodiment of the present invention. By integrating the overexpression vector of the citrus cysteine-rich receptor-like kinase encoding gene CsCRK10 into citrus, promoting the accumulation of citrus cysteine-rich receptor-like kinase, the resistance of citrus to canker can be significantly improved, and the phenotype of transgenic plants is not affected;

[0029] 3. A method for the application of a CsCRK10 gene, encoded protein and improving the resistance to citrus canker provided by the embodiment of the present invention. By overexpressing the CsCRK10 gene, the resistance of transgenic plants to canker can be greatly improved, which has great application value in citrus canker resistance breeding, and can be used as a candidate gene for canker resistance breeding with multiple canker-resistant and -susceptible genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] To more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the accompanying drawings required for the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings.

[0031] Figure 1 Bioinformatics characteristics of the citrus CsCRK10 gene in the embodiments of the present invention: A is the chromosomal localization of the citrus CsCRK10 gene, B is the gene structure of citrus CsCRK10; C is the conserved domain of the citrus CsCRK10 gene, and aa represents amino acid;

[0032] Figure 2 PCR amplification electrophoresis diagram of the cloning of the citrus CsCRK10 gene in the embodiments of the present invention: CDS represents the coding sequence of the CsCRK10 gene; M represents the DNA molecular weight standard, the same hereinafter;

[0033] Figure 3 Overexpression vector structure diagram of the citrus CsCRK10 gene in the embodiments of the present invention: GUS represents the β-glucuronidase gene; NPT II represents neomycin phosphotransferase II; CaMV 35S represents a plant constitutive promoter derived from cauliflower mosaic virus; NOS represents the terminator of the nopaline synthase gene;

[0034] Figure 4 Flow chart of citrus genetic transformation in the embodiments of the present invention;

[0035] Figure 5 GUS staining diagram in the embodiments of the present invention: OE10-1, OE10-2, OE10-3, OE10-4, OE10-5, OE10-6, OE10-7 respectively represent transgenic plants, WT represents wild-type late Jincheng orange plants, + represents plasmid pLGNe-CsCRK10, the same hereinafter;

[0036] Figure 6 PCR identification diagram of transgenic plants in the embodiments of the present invention;

[0037] Figure 7 Analysis diagram of the expression level of CsCRK10 in transgenic plants in the embodiments of the present invention: ** indicates extremely significant difference compared with WT (P<0.01), *** indicates extremely extremely significant difference compared with WT (P<0.001), **** indicates extremely highly significant difference compared with WT (P<0.0001), the same hereinafter;

[0038] Figure 8 Phenotype diagram of transgenic plants in the embodiments of the present invention (A: the first batch of grafted seedlings; B the second batch of grafted seedlings);

[0039] Figure 9 Symptom diagram of the leaves of the transgenic plants in the embodiment of the present invention 10 days after inoculation with the canker pathogen

[0040] Figure 10 Statistical chart of the lesion size of the leaves of the transgenic plants in the embodiment of the present invention 10 days after inoculation with the canker pathogen

[0041] Figure 11 Statistical chart of the disease index of the leaves of the transgenic plants in the embodiment of the present invention 10 days after inoculation with the canker pathogen Detailed implementation manners

[0042] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below with reference to the embodiments and the accompanying drawings. The illustrative embodiments and descriptions thereof of the present invention are only used to explain the present invention and are not intended to limit the present invention.

[0043] In the following description, a large number of specific details are set forth in order to provide a thorough understanding of the present invention. However, it is obvious to those of ordinary skill in the art that the present invention does not have to be implemented with these specific details. In other embodiments, well-known structures, materials, or methods are not specifically described in order to avoid obscuring the present invention.

[0044] Throughout the specification, the reference to "one embodiment", "embodiment", "one example" or "example" means that the specific features, structures or characteristics described in connection with the embodiment or example are included in at least one embodiment of the present invention. Therefore, the phrases "one embodiment", "embodiment", "one example" or "example" appearing throughout the specification do not necessarily all refer to the same embodiment or example. In addition, the specific features, structures or characteristics can be combined in any appropriate combination and / or sub-combination in one or more embodiments or examples. In addition, those of ordinary skill in the art should understand that the drawings provided herein are for illustrative purposes only and are not necessarily drawn to scale. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0045] In the description of the present invention, the orientation or positional relationship indicated by the terms "front", "rear", "left", "right", "upper", "lower", "vertical", "horizontal", "high", "low", "inner", "outer", etc. is based on the orientation or positional relationship shown in the drawings, and is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as a limitation on the protection scope of the present invention.

[0046] Embodiment 1

[0047] Bioinformatics Analysis of Citrus CsCRK10 Gene

[0048] As Figure 1 shown, the Citrus CsCRK10 gene is located between 38,063,255bp and 38,066,657 on chromosome 5 of Citrus. The full length of this chromosome is 3.4Kbp, and the full length of the CDS sequence is 1119bp, which can encode 347 amino acids. Analysis of the protein sequence shows that there is an obvious Gnk2-homologous structural functional domain.

[0049] The nucleotide sequence of CsCRK10 gene SEQ ID NO: 1 (from ATG to the stop codon):

[0050]

[0051] Example 2

[0052] Cloning of the coding sequence of the Citrus CsCRK10 gene

[0053] 1. RNA Extraction and cDNA Synthesis

[0054] Total RNA from citrus (Wanjincheng) leaves was extracted using a plant total RNA extraction kit (Adlai, CAT: RN09), the RNA quality was verified by agarose gel electrophoresis, and its concentration was measured by a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A).

[0055] 2. PCR amplification of the coding sequence of CsCRK10 gene

[0056] The CsCRK10 coding sequence was amplified from citrus cDNA using primers OE-CsCRK10-F (SEQ ID NO: 2), OE-CsCRK10-R (SEQ ID NO: 3) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q) to obtain a DNA fragment with a length of 1119 bp (e.g. Figure 2 The amplified DNA fragment was sequenced and confirmed to be the coding sequence of the citrus CsCRK10 gene (SEQ ID NO: 1). Under ultraviolet light, a clean blade was used to cut the agarose gel block containing the target fragment, and the DNA fragment was recovered using a gel recovery kit (BioFlux, CAT: BSC02M1).

[0057] PCR amplification program: 98°C, 5 min; 98°C, 30 s, 58°C, 30 s, 72°C, 1 min, 35 cycles; extension at 72°C for 10 min.

[0058] The nucleotide sequence of primer OE-CsCRK10-F is SEQ ID NO: 2 (including the restriction site, the restriction site is marked with an underline, and the homology arm is marked with a double underline):

[0059]

[0060] The nucleotide sequence of primer OE-CsCRK10-R is SEQ ID NO: 3 (including the restriction site, the restriction site is marked with an underline, and the homology arm is marked with a double underline):

[0061]

[0062] Example 3

[0063] Construction of Overexpression Vector of Citrus CsCRK10 Gene and Transformation into Agrobacterium

[0064] 1. Construction of Overexpression Vector

[0065] The DNA fragment of the CsCRK10 coding sequence and the overexpression vector pLGNe were double-digested with the restriction enzymes BamHI and SalI (ThermoFisher), and then recovered by gel extraction and ligated overnight at 16°C using the T4 DNA Ligase kit (Promega, CAT: M1801). The ligation product was transformed into Escherichia coli DH5α, and the plasmid of the positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the overexpression vector pLGNe-CsCRK10 of CsCRK10 (as Figure 3 shown).

[0066] 2. Transformation of Overexpression Vector into Agrobacterium

[0067] The constructed overexpression vector was introduced into Agrobacterium tumefaciens EHA105 by electroporation. The method is as follows: Take the frozen Agrobacterium competent cells EHA105 (50 μL) and thaw them on ice in advance; add 2 μL of the plasmid of the overexpression vector to the competent cells, mix well by pipetting, and place on ice for 5 min; transfer the mixture to the bottom of the pre-dried electroporation cuvette, place the electroporation cuvette in the card slot and adjust to the correct position, adjust the electroporation device to the "Agr" gear, press the electroporation button, and check the electroporation data to ensure successful electroporation; add 1 mL of LB liquid medium (containing 50 mg / L kanamycin) to the electroporation cuvette, mix well with a pipette, transfer to a sterile centrifuge tube, and incubate on a shaker at 260 r / min and 28°C for 60 min; centrifuge the bacterial solution at 10000 r / min for 1 min, discard the supernatant (leave about 100 μL to resuspend the bacteria), resuspend and spread on LB solid medium, and incubate in the dark at 28°C for 2 days; after the bacterial colonies grow, use the primers OE-CsCRK10-F (SEQ ID NO: 2) and OE-CsCRK10-R (SEQ ID NO: 3) to perform PCR verification on single colonies.

[0068] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0069] Example 4

[0070] Genetic Transformation of Citrus with CsCRK10 Gene Overexpression Vector

[0071] According to Figure 4 the shown process for citrus genetic transformation, the specific operations are as follows:

[0072] 1. Obtaining of Epicotyls of Citrus Seedlings

[0073] The fresh citrus fruits were washed, surface-sterilized with 70% alcohol, and the seeds were taken out under sterile conditions. The seed coats were removed, and the seeds were germinated on the seed germination medium, and cultured in the dark at 28 °C for 2 weeks, and then cultured under the condition of 16 h light / 8 h darkness for 1 week; the epicotyls of the germinated seedlings were cut into 1 cm stem segments under sterile conditions for Agrobacterium tumefaciens-mediated genetic transformation.

[0074] 2. Preparation of Agrobacterium tumefaciens suspension

[0075] Before transfection, the Agrobacterium tumefaciens (containing the pLGNe-CsCRK10 vector) for transfection was streaked and cultured on the LB solid medium containing 50 mg / L kanamycin; a single colony was picked and inoculated into 25 mL of LB liquid medium containing the same antibiotic, and cultured overnight with shaking at 28 °C; the bacterial suspension was diluted to OD = 0.1 and then continued to be cultured until OD = 0.5, centrifuged at 5000 r / min for 10 min, the supernatant was discarded, and resuspended with the MS liquid medium at pH 5.4 for transfection.

[0076] 3. Transformation of citrus epicotyls

[0077] The citrus epicotyl stem segments were immersed in the Agrobacterium tumefaciens suspension for 13 min and then dried, and the stem segments were transferred to the co-culture medium and cultured in the dark at 26 °C for 2 days; after the co-culture was completed, the epicotyls were transferred to the selection medium and cultured in the dark at 28 °C for 7 days, and the epicotyls were cultured at 28 °C under the condition of 16 h light / 8 h darkness, subcultured every two weeks, and then identified by GUS staining.

[0078] 4. Seedling culture of transformants

[0079] When the seedlings grew to more than 1 cm, they were cut off and grafted onto the seedlings of late Jincheng orange in sterile test tubes and cultured in the seedling culture medium; when the seedlings grew to about 5 cm, they were grafted onto the seedlings of trifoliate orange and cultured in a greenhouse at 28 °C.

[0080] The media used in this example are as follows:

[0081] Seed germination medium: MS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0082] Co-culture medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 1 mg / L 2,4–D + 100 μmol AS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0083] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, PH 5.8.

[0084] Seedling medium: MS + 30g / L sucrose, PH 5.8.

[0085] Example 5

[0086] Verification of CsCRK10 overexpressing transgenic plants

[0087] 1. GUS staining identification of transgenic plants

[0088] The leaves of the transgenic plants obtained in the initial screening were cut into leaf discs (7 mm in diameter) and subjected to GUS histochemical staining (24 h). The edges of the leaf discs of the positive plants showed blue color, while the leaf discs of the WT plants did not show color (e.g. Figure 5 shown).

[0089] 2. PCR Identification of Transgenic Plants

[0090] 100 mg of leaves from transgenic plants were used to extract genomic DNA using a DNA extraction kit (Adlai, CAT: DN15), and PCR was used to detect the integration of the CsCRK10 coding sequence in the citrus genome. The detection primers were ID-CsCRK10-F (SEQ ID NO: 4) and ID-CsCRK10-R (SEQ ID NO: 5). A 1127 bp amplified fragment was obtained from positive plants, while no amplification was obtained from WT plants (e.g. Figure 6 shown).

[0091] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0092] Nucleotide sequence of primer ID-CsCRK10-F SEQ ID NO: 4

[0093] CGGCCAATCTTCATGATCTTGC

[0094] Nucleotide sequence of primer ID-CsCRK10-R SEQ ID NO: 5

[0095] TCATAGGCGTCTCGCATATCTCATT

[0096] 3. qRT-PCR Analysis of Transgenic Plants

[0097] Total RNA (Aidelai, CAT No: RN09) was extracted from the leaves of transgenic plants, and cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT No: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsCRK10-F (SEQ ID NO: 6) and RT-CsCRK10-R (SEQ ID NO: 7). -△△Ct The relative expression of CsCRK10 gene in transgenic plants was calculated by the following method: the water-treated sample was defined as the reference factor, i.e., its CsCRK10 expression level was 1, and then the multiple of the gene expression in transgenic citrus relative to the reference factor was calculated. -△△Ct , which is the relative expression level. Figure 7 As shown, the CsCRK10 gene was expressed at a higher level in the transgenic plants than in the wild-type plants (up to 555 times higher than that in the control).

[0098] qRT-PCR reaction conditions: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min.

[0099] The nucleotide sequence of primer RT-CsCRK10-F is SEQ ID NO: 6

[0100] GGTCTGTCAATTGCGCTACG

[0101] The nucleotide sequence of primer RT-CsCRK10-R is SEQ ID NO: 7

[0102] CTTTGCTTGCCTCTCCCAGA

[0103] 4. Phenotypic observation of transgenic plants

[0104] The phenotypes of the seven transgenic plants were observed and analyzed, and it was found that there was no obvious abnormality in appearance and growth compared with the wild type plants of the same period (such as Figure 8 This indicates that overexpression of the CsCRK10 gene did not significantly affect the phenotype and development of the plant.

[0105] Example 6

[0106] Evaluation of resistance of transgenic materials overexpressing CsCRK10 gene

[0107] The mature leaves of the transgenic plants were washed, disinfected with 75% alcohol, rinsed with sterile water, and placed on a clean bench. The veins were punctured with a needle, and the ulcer pathogen liquid was applied with a pipette. 1 μL (1×10 5(CFU / mL); Cultivate in a constant temperature light incubator at 28°C (16 h light / 8 h darkness); After inoculating the leaves with bacteria, cultivate for 10 days and take pictures, and use Image J V1.47 software to count the lesion area.

[0108] Classify the disease severity into grades 0 - 7 according to the lesion area. Represent the lesion area with the letter R. Grade 0 (R ≤ 0.25 mm 2 ), Grade 1 (0.25 mm 2 <R ≤ 0.5 mm 2 ), Grade 2 (0.5 mm 2 <R ≤ 0.75 mm 2 ), Grade 3 (0.75 mm 2 <R ≤ 1 mm 2 ), Grade 4 (1.0 mm 2 <R ≤ 1.25 mm 2 ), Grade 5 (1.25 mm 2 <R ≤ 1.5 mm 2 ), Grade 6 (1.5 mm 2 <R ≤ 1.75 mm 2 ), Grade 7 (R > 1.75 mm 2 ); Calculate the disease index according to the formula: DI = 100 × Σ (number of lesions at each grade × corresponding grade value) / (total number of lesions X maximum grade).

[0109] The results showed that 10 days after inoculating with Xanthomonas citri subsp. citri, both the overexpressing plants and the WT plants grafted at the same time showed varying degrees of disease, and there were certain differences in the lesion size (as Figure 9 shown). After statistics and analysis, it was found that the lesion area of the transgenic materials was significantly smaller than that of the wild-type control, reduced to 62.61% - 87.93% of the control (as Figure 10 shown). The disease index of the transgenic materials was significantly smaller than that of the wild-type control, reduced to 66.17% - 91.62% of the control (as Figure 11 shown). Thus, it can be seen that overexpression of CsCRK10 can significantly reduce the lesion area of citrus bacterial canker and alleviate the incidence of citrus canker.

[0110] In summary, the present invention can greatly reduce the lesion area of canker and alleviate the incidence of canker by overexpressing the CsCRK10 gene. The CsCRK10 gene provided by the present invention can be overexpressed by various techniques and used for anti-canker molecular breeding. It can also be used together with other disease-resistant or disease-susceptible genes to synergistically conduct citrus anti-canker molecular breeding, and has great application value in citrus anti-canker breeding.

[0111] The specific embodiments described above further elaborate on the objective, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only for the specific embodiments of the present invention and is not used to limit the protection scope of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Application of the CsCRK10 gene, characterized in that, For improving the resistance of citrus plants to citrus canker or for breeding citrus varieties with improved resistance to citrus canker; The nucleotide sequence of the CsCRK10 gene is shown as SEQ ID NO:

1.

2. Use of the protein encoded by the CsCRK10 gene according to claim 1 in improving the resistance of citrus plants to citrus canker or in breeding citrus varieties with improved resistance to citrus canker.

3. A method for improving the resistance of citrus to citrus canker by using the CsCRK10 gene, characterized in that, By regulating the expression level of the CsCRK10 gene in citrus plants, the resistance of citrus plants to citrus canker is improved, and the nucleotide sequence of the CsCRK10 gene is shown as SEQ ID NO:

1.

4. A method for improving the resistance of citrus to citrus canker by using the CsCRK10 gene according to claim 3, characterized in that, The specific method for regulating the expression level of the CsCRK10 gene is: up-regulating the expression level of the CsCRK10 gene in citrus plants.

5. A method for improving the resistance of citrus canker by using the CsCRK10 gene according to claim 3, characterized in that, The way to up-regulate the expression level of the CsCRK10 gene in citrus plants is: using an overexpression vector to control the expression level of the CsCRK10 gene in citrus cells, and up-regulating the accumulation of the citrus cysteine-rich receptor-like kinase, the protein encoded by the CsCRK10 gene in citrus.

6. A method for improving the resistance of citrus canker by using the CsCRK10 gene according to claim 5, characterized in that, It includes the following steps: (1) Clone the coding sequence of the citrus CsCRK10 gene; (2) Construct an overexpression vector for the CsCRK10 gene; (3) Transform citrus with the overexpression vector of the CsCRK10 gene to obtain transgenic plants with improved resistance to citrus canker.

7. A method for improving the resistance of citrus to citrus canker by using the CsCRK10 gene according to claim 6, characterized in that, In step (1), the cloning method of the coding sequence of the citrus CsCRK10 gene is: extract the total RNA of citrus, then reverse transcribe it into cDNA, and finally amplify the DNA fragment of the coding sequence of the CsCRK10 gene by PCR.

8. A method for improving the resistance of citrus to citrus canker by using the CsCRK10 gene according to claim 7, characterized in that, In step (1), the primers used for PCR amplification are OE-CsCRK10-F and OE-CsCRK10-R, and their nucleotide sequences are SEQ ID NO: 2 and SEQ ID NO: 3 respectively.

9. A method for improving the resistance of citrus to citrus canker by using the CsCRK10 gene according to claim 6, characterized in that, In step (2), the construction method of the CsCRK10 overexpression vector is: recover the DNA fragment of the CsCRK10 coding sequence by digestion with BamHI and SalI, and ligate it to the pLGNe vector recovered by digestion with BamHI and SalI to construct the overexpression vector pLGNe-CsCRK10.

10. A method for improving the resistance of citrus to citrus canker by using the CsCRK10 gene, characterized in that, In step (3), the method for transforming citrus with the CsCRK10 overexpression vector is: transform the overexpression vector pLGNe-CsCRK10 into Agrobacterium tumefaciens by electroporation, and then use Agrobacterium tumefaciens-mediated transformation of citrus explants to obtain transgenic plants by genetic transformation.

Images