SgRNA expression vector as well as construction method and application thereof

By constructing SgRNA expression vectors and combining single-base editing technology and embryo transfer, the efficiency and accuracy of CRISPR/Cas9 in LBP gene editing was solved, and the efficiency, stability and disease resistance of dairy cows were improved.

CN120249388APending Publication Date: 2025-07-04NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510455369.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-11
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

The existing CRISPR/Cas9 gene editing technology has problems such as low editing efficiency, off-target effects and large fragment gene mutations in the multi-locus precision regulation of LBP genes, which affects the health and production performance of dairy cows and may be subject to ethical policies.

Method used

SgRNA expression vector was designed and constructed, and point mutations were performed at key functional sites of the LBP gene through single-base editing technology, and combined with microinjection and embryo transfer technology, gene-edited clones were obtained to enhance the host's disease resistance and adaptability.

Benefits of technology

It significantly reduces the inflammatory response caused by mastitis pathogenic bacteria, improves the specificity and stability of gene editing, reduces the risk of gene mutations in non-target areas, and enhances the disease resistance of dairy cows and the prevention and treatment effect of mastitis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249388A_ABST
    Figure CN120249388A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and particularly relates to an SgRNA expression vector as well as a construction method and application thereof. The SgRNA expression vector is formed by connecting a pGL3-U6-sgRNA-PGK-puromycin vector with a gRNA1 (guide ribonucleic acid 1), or is formed by connecting a pGL3-U6-sgRNA-PGK-puromycin vector with a gRNA2 (guide ribonucleic acid 2), and the SgRNA expression vector is formed by connecting a pGL3-U6-sgRNA-PGK-puromycin vector with a gRNA2 (guide ribonucleic acid 2); the sequence of the gRNA1 is as shown in SEQ ID NO. 1, and the sequence of the gRNA2 is as shown in SEQ ID NO. 2. Respectively mixing the mRNA of the ABE7.10 and the transcription mRNA of the gRNA1, and mixing the mRNA of the CGBE and the transcription mRNA of the gRNA2, and injecting the mixture into a fertilized egg or co-injecting the mixture into the fertilized egg to obtain the gene editing cloned cattle. Experimental results show that the expression quantity of the proinflammatory factors of the mammary epithelial cells separated from the gene-edited cloned cattle is remarkably reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to an SgRNA expression vector, a construction method thereof, and applications thereof. Background Art

[0002] Mastitis is one of the biggest problems faced in dairy cow farming, and it is also one of the most common, most harmful, and most economically damaging diseases in dairy farms. It seriously affects the production performance of dairy cows and the quality of dairy products, bringing significant economic losses to the dairy farming industry and the dairy product manufacturing industry, and restricting the development of the industry. Dairy cow mastitis can be divided into clinical mastitis with obvious symptoms and subclinical mastitis without obvious symptoms, manifested as breast swelling and redness, elevated body temperature, and even periodic attacks. Chronic mastitis is difficult to treat and easily causes economic losses. Dairy cow mastitis will lead to a decrease in milk production, deterioration of milk quality, an increase in the use of antibiotics, which in turn leads to drug resistance and drug residues, posing a risk to human health, and increasing the mortality rate of dairy cows, seriously affecting economic benefits, dairy cow welfare, and public health safety.

[0003] LBP is a key protein that binds to the main virulence factor LPS of Gram-negative bacteria and plays an important role in the immune response. In the occurrence of mastitis, LBP binds to LPS, promotes the binding of LPS to CD14+ cells, thereby activating the TLR4 pathway, triggering an inflammatory response and releasing pro-inflammatory cytokines. LBP plays an important role in the immune response and disease process of mastitis. According to previous studies, knocking out the LBP gene will cause the invasion of LPS to fail to activate the host innate immune response in a timely manner, unable to effectively control the spread of bacteria, resulting in the death of the host in the short term after infection. Therefore, using single-base editing technology to edit the LBP gene can moderately weaken the activation of the inflammatory response by LPS without destroying the overall gene function, thereby enhancing the disease resistance and adaptability of the host.

[0004] Traditional methods for gene-editing animals mainly rely on the CRISPR / Cas9 system to modify target genes through gene knock-in or knockout. However, these methods are difficult to apply in complex genes (such as LBPThere are certain limitations in the precise multi-site regulation of genes: on the one hand, the editing efficiency of a single editor at specific sites is limited and difficult to meet the requirements of high-precision and multi-functional regulation; on the other hand, traditional methods may produce off-target effects, affecting the integrity of non-target gene regions. In addition, traditional CRISPR / Cas9-mediated gene editing often involves large-fragment gene mutations, weakening its application potential in precision breeding and may be restricted by specific regional ethical policies. To solve the above problems, it is first necessary to design a suitable SgRNA expression vector. The SgRNA expression vector is a key tool for the success of gene editing experiments, and its design needs to comprehensively consider promoter efficiency, delivery methods, sequence optimization, and the synergistic effect with other elements (such as Cas9). By reasonably selecting or optimizing the vector, the efficiency and specificity of gene editing can be significantly improved, while meeting the requirements of different experimental scenarios. Therefore, in CRISPR technology, the SgRNA expression vector is not only necessary but also the core element to achieve precise and efficient gene editing. Based on this, the present invention intends to provide a new SgRNA expression vector and use it to improve the efficiency, accuracy, and stability of gene editing, thereby achieving the improvement of host disease resistance. Summary of the Invention

[0005] In view of the above technical problems, the present invention provides an SgRNA expression vector, which is constructed by performing point mutations on the key functional sites of the LBP gene using single-base gene editing technology, enabling each editor to bind its corresponding SgRNA and perform base editing at specific target sites, thereby effectively reducing off-target effects and improving the specificity and stability of editing.

[0006] To achieve the above object, the present invention adopts the following technical solutions: In the first aspect of the present invention, there is provided an SgRNA expression vector, which is formed by connecting the pGL3-U6-sgRNA-PGK-puromycin vector with gRNA1, or formed by connecting the pGL3-U6-sgRNA-PGK-puromycin vector with gRNA2; the sequence of gRNA1 is: GCAGAGTAAGCTGCACAAAG, and the sequence of gRNA2 is: AGCTTACTCTGCAGAGCCAA.

[0007] As a preferred embodiment of the present invention, there is provided a method for constructing the SgRNA expression vector, including the following steps: Using the pGL3-U6-sgRNA-PGK-puromycin plasmid as a template, amplifying gRNA1 or gRNA2; The amplified product is ligated into the digested linearized pGL3-U6-sgRNA-PGK-puromycin plasmid to obtain the SgRNA expression vector.

[0008] Further preferably, the amplification primers for gRNA1 are: gRNA1-F: 5’-ACCGGCAGAGTAAGCTGCACAAAG-3’; gRNA1-R: 5’-AAACCTTTGTGCAGCTTACTCTGC-3’; The amplification primers for gRNA2 are: gRNA2-F: 5’-ACCGAGCTTACTCTGCAGAGCCAA-3’; gRNA2-R: 5’-AAACTTGGCTCTGCAGAGTAAGCT-3’.

[0009] Further preferably, the pGL3-U6-sgRNA-PGK-puromycin plasmid is digested with BsaI enzyme to obtain the linearized pGL3-U6-sgRNA-PGK-puromycin plasmid.

[0010] In the second aspect of the present invention, there is provided an application of the SgRNA expression vector or its transcribed mRNA in precise gene editing of mammalian cells LBP genes.

[0011] In the third aspect of the present invention, there is provided an application of the SgRNA expression vector or its transcribed mRNA in the preparation of products for preventing and treating mastitis.

[0012] In the fourth aspect of the present invention, there is provided an application of the SgRNA expression vector or its transcribed mRNA in the breeding of mastitis-resistant dairy cows.

[0013] In the fifth aspect of the present invention, there is provided an application of the SgRNA expression vector or its transcribed mRNA in the preparation of products for resisting mastitis pathogenic bacteria.

[0014] In the sixth aspect of the present invention, there is provided a gene editing method for enhancing the mastitis resistance of dairy cows, including any one of the following steps (1) to (3): (1) The process of co-injecting the mRNA of ABE7.10 and the transcribed mRNA of the gRNA1 into the fertilized egg; (2) The process of co-injecting the mRNA of CGBE and the transcribed mRNA of the gRNA2 into the fertilized egg.

[0015] (3) The process of co-injecting the mixed solutions in (1) and (2) into the fertilized egg.

[0016] As a preferred embodiment of the present invention, the vector backbone of ABE7.10 is pCMV-ABE7.10, and the vector backbone of CGBE is CGBE1 (pRZ3885).

[0017] As a preferred embodiment of the present invention, the mixing mass ratio of ABE7.10 mRNA to SgRNA1 and that of CGBE mRNA to SgRNA2 are both 2:1.

[0018] The present invention first constructs an SgRNA expression vector for the functional site of the LBP gene, enables each editor to bind to its corresponding SgRNA respectively, and performs base editing at specific target sites, thereby effectively reducing the off-target effect and improving the specificity and stability of editing. The optimized design of the SgRNA expression vector can significantly improve the expression level of SgRNA and enhance the efficiency and accuracy of gene editing.

[0019] The present invention transcribes the obtained SgRNA expression vector, pCMV-ABE7.10 vector and CGBE1 (pRZ3885) vector in vitro. The obtained mRNA of ABE7.10 is mixed with SgRNA1, and the mRNA of CGBE is mixed with SgRNA2. Each fertilized egg is injected with the two mixtures, and then Sanger sequencing is performed to detect the base changes at the editing sites. Gene-edited cloned cattle are obtained through microinjection and embryo transfer techniques. The calves are in good condition, survive normally, show no abnormal manifestations, and are identified as LBP gene-edited individuals, indicating that this site is safe. Treating mammary epithelial cells isolated from the gene-edited cloned cattle with LPS, it can be known from the experimental results that after editing the functional site of the LBP gene, the expression level of cell pro-inflammatory factors is significantly reduced. Compared with the traditional method, the gene editing method of the present invention can not only reduce the risk of gene mutation in non-target regions, but also improve the operability and stability of gene-edited animals, providing a more efficient strategy for precision breeding and biomedical research.

[0020] The present invention uses single-base gene editing technology combined with microinjection and embryo transfer techniques to create gene-edited cloned cattle. In vitro experiments show that separating the mammary epithelial cells of gene-edited cloned cattle and placing them in an inflammatory environment induced by mastitis pathogenic bacteria significantly reduces the expression of inflammatory factors, reduces the disruption of cell tight junctions, and decreases the apoptosis rate. A low level of cell inflammatory response is achieved, thereby providing an environment conducive to cell repair and regeneration, enhancing the host's disease resistance to mastitis pathogenic bacteria, and effectively reducing the incidence of mastitis. Brief Description of the Drawings

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the attached drawings required in the description of the embodiments or the prior art. Obviously, the attached drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other attached drawings can also be obtained based on the provided attached drawings.

[0022] Figure 1 Screening of LBP gene editing sites; among them, (A) Binding mode of LPS and LBP (predicted by Autodock Vina); (B) Key amino acids and interactions of LPS binding to LBP protein; Figure 2 Statistics of amino acid interactions of LPS binding to LBP protein (analyzed by Autodock Vina); Figure 3 Plasmid map of pGL3-U6-sgRNA-PGK-Puro; Figure 4 Plasmid map of pCMV-ABE7.10; Figure 5 Plasmid map of GBE1 (pRZ3885); Figure 6 Schematic diagram of gene editing; Figure 7 Embryo development map after editing, Bar = 200 μm; Figure 8 Gel electrophoresis gel map for identification of gene-edited embryos; Figure 9 Sanger sequencing peak map (Sanger sequencing results of sgRNA1 site and sgRNA2 site); Figure 10 Embryo development map after transplantation of edited embryos (Bar = 200 μm); Figure 11 LBP gene-edited cloned cattle; Figure 12 Gene-edited bovine mammary epithelial cells, Bar = 100 px; Figure 13 Gel electrophoresis gel map for identification of gene-edited cloned cattle; Figure 14 Sanger sequencing peak map of cloned cattle after embryo transplantation (Sanger sequencing results of sgRNA1 site and sgRNA2 site); Figure 15is the expression level of the pro-inflammatory cytokine TNF-α; ** indicates P <0.01; Figure 16 is the expression level of the pro-inflammatory cytokine IL-1β, ** indicates P <0.01. Detailed implementation manners

[0023] Mastitis is one of the biggest problems faced in dairy cow farming, and it is also one of the most common, most harmful, and most economically damaging diseases in dairy farms. It seriously affects the production performance of dairy cows and the quality of dairy products, bringing considerable economic losses to the dairy farming industry and the dairy product manufacturing industry, and restricting the development of the industry. LBP is a key protein that binds to the main virulence factor LPS of Gram-negative bacteria and plays an important role in the immune response. Knockout of the LBP gene will cause the invasion of LPS to fail to activate the host innate immune response in a timely manner, unable to effectively control the spread of bacteria, and leading to the death of the host in the short term after infection. Therefore, using single-base editing technology to edit the LBP gene can moderately weaken the activation of the inflammatory response by LPS without destroying the overall gene function, thereby enhancing the disease resistance and adaptability of the host.

[0024] Existing LBP gene editing technologies mainly rely on traditional CRISPR / Cas9 gene knockout or knock-in technologies, but these methods have some significant disadvantages: (1) Off-target effect: Although traditional CRISPR / Cas9 technology has a high editing efficiency, it may cause off-target effects, that is, mutations occur at non-target sites. These mutations may interfere with the functions of other genes and even lead to adverse biological effects, affecting the health and production performance of dairy cows.

[0025] (2) Large fragment gene mutations: Existing technologies often edit by knocking out or knocking in large segments of genes, which may lead to the complete loss of the function of the target gene or the introduction of unnecessary genes, affecting the normal growth and development of animals and other important traits.

[0026] (3) Insufficient precision: Although CRISPR / Cas9 technology can achieve gene knockout, in some cases, the editing precision is low, especially in the precise replacement of single nucleotides. This lack of precision may lead to inaccurate editing of the key regions of the LBP gene, thereby affecting the resistance of dairy cows to mastitis.

[0027] (4) Ethical issues: Gene knockout or knock-in technologies may be regarded as "excessive modification" by regulatory agencies in some countries or regions and trigger ethical controversies. Especially for large-scale modifications of animal genomes, it may face relatively strict laws and regulations restrictions, limiting the application and promotion of this technology.

[0028] Based on this, the present invention provides an SgRNA expression vector, which is formed by ligating the pGL3-U6-sgRNA-PGK-puromycin vector with gRNA1, or is formed by ligating the pGL3-U6-sgRNA-PGK-puromycin vector with gRNA2; the sequence of gRNA1 is: GCAGAGTAAGCTGCACAAAG, and the sequence of gRNA2 is: AGCTTACTCTGCAGAGCCAA.

[0029] The above vectors, the pCMV-ABE7.10 vector, and the CGBE1 (pRZ3885) vector were in vitro transcribed. The obtained ABE7.10 mRNA was mixed with SgRNA1, and the CGBE mRNA was mixed with SgRNA2. Each fertilized egg was injected with the two mixtures. Gene-edited cloned cattle were obtained through microinjection and embryo transfer techniques. The calves were in good condition, survived normally, showed no abnormal manifestations, and were identified as LBP gene-edited individuals after identification, indicating that this locus is safe. The mammary epithelial cells isolated from the gene-edited cloned cattle were treated with LPS. From the experimental results, it can be seen that after editing the functional site of the LBP gene, the expression level of pro-inflammatory factors in the cells decreased significantly.

[0030] The vectors stored in the laboratory of the research team of the present invention are: pGL3-U6-sgRNA-PGK-puromycin, pCMV-ABE7.10, and CGBE1 (pRZ3885).

[0031] Example 1 Screening of LBP gene editing sites (1) Obtaining of LPS and LBP structure files Obtaining of the receptor LBP protein: The amino acid sequence of bovine-derived LBP (LPS-binding protein) was downloaded through the UniProt database, with the UniProt accession number Q2TBI0 (LBP_BOVIN) and a protein length of 481 amino acids. The main function of LBP is to interact with lipopolysaccharide (LPS) in the outer membrane of Gram-negative bacteria, especially binding to the lipid A part of LPS. Database website: https: / / www.uniprot.org / uniprotkb / Q2TBI0 / entry;

[0032] Obtaining of the ligand LPS: The lipid A structure of Escherichia coli (E. coli) LPS was downloaded from the PubChem database, with the compound name E. coli lipid A and PubChem CID 9877306. Database website: https: / / pubchem.ncbi.nlm.nih.gov / compound / 9877306.

[0033] (2)Molecular docking analysis Molecular docking analysis of LPS and LBP was performed using AutoDock Vina. The analysis process includes: Preparation of the receptor LBP structure: Remove water molecules and optimize the protein structure. Pretreatment of the ligand LPS: Optimize the structure and generate flexible docking parameters. Set the docking grid: Define the search space around the possible LPS binding site of LBP. Run AutoDock Vina, and 9 possible binding conformations were obtained by docking.

[0034] (3)Visual analysis combining molecular docking Figure 1 In Figure A is the result of the molecular docking of LPS and LBP protein molecules, and the binding position and spatial conformation of LPS in the LBP structure were confirmed. Figure 1 In Figure B is the interaction of key amino acids in the binding of LPS and LBP. Subsequently, the key amino acids and their interactions in the binding of LPS and LBP were counted, and it was found that amino acids such as Ser52 play a key role in the process of LBP binding to LPS.

[0035] (4)Screening of key binding sites Further analyze the interaction of key amino acids in the binding of LPS and LBP. Figure 2 Table is the amino acid statistical table of the interaction relationship between LPS and LBP. The results show that Ser52 (serine 52) is located in the second exon of the LBP gene and forms stable hydrogen bonds and hydrophobic interactions with LPS. Although ALA49 has the highest proportion in the statistical data, Ser52 plays a more critical role in protein function. The amino acid residue of Ser52 contains a polar hydroxyl group, which can participate in more complex biochemical reactions or interactions with other molecules, thus playing an important role in the binding of LPS and LBP. Based on its significant impact on protein structure and function, Ser52 was screened as the best gene editing target, and its sequence is as follows: 5’-CTCTGCAGgcTAAGCTGCA-3’, SEQ ID NO.1; NC_037340.1[67217967..67217985]. It can be used for subsequent gene editing experiments to optimize the LBP protein and reduce its affinity for LPS.

[0036] Example 2 Vector construction and in vitro transcription (1)gRNA design Predict the editing sites at positions 154 and 155 in the coding region of the bovine LBP gene through the DeepBE website. According to the prediction scores of the website, select the top 1 with the highest score from each of the ABE system and the CGBE system, and use them as gRNA1 and gRNA2 respectively. The sequence of gRNA1 is as follows: 5’-GCAGAGTAAGCTGCACAAAG-3’, SEQ ID NO.2; the sequence of gRNA2 is as follows: 5’-AGCTTACTCTGCAGAGCCAA-3’, SEQ ID NO.3.

[0037] (2)Construction of gRNA expression vector First, design cloning primers containing the gRNA sequence. The primer sequences are as follows: Table 1 Primers used to construct gRNA plasmids targeting LBP a.154 and LBP g.155 Using the pGL3-U6-sgRNA-PGK-puromycin (Addgene #51133) plasmid as a template, perform overnight digestion at 37°C with BsaI enzyme to obtain a linearized pGL3-U6-sgRNA-PGK-puromycin plasmid. Anneal the two single-stranded primers in Table 1 to form double-stranded DNA, and then insert them into the linearized pGL3-U6-sgRNA-PGK-puromycin plasmid digested with BsaI enzyme through sticky-end ligation to form complete U6-sgRNA1 and U6-sgRNA2 plasmids that can target the position of the 2nd exon of the LBP gene, namely the SgRNA expression vector.

[0038] (0)In vitro transcription of sgRNA Using the U6-sgRNA1 and U6-sgRNA2 plasmids as templates respectively, design and synthesize the sgRNA nucleotide sequence, and use the GeneArt Precision gRNA Synthesis Kit (Invitrogen, A29377) for the transcription and purification and recovery of sgRNA to obtain sgRNA1 and sgRNA2. The single-stranded nucleotide sequences used are shown in Table 2.

[0039] Table 2 Single-stranded DNA to be synthesized during in vitro synthesis of sgRNA (4)In vitro transcription of base editors Digest pCMV-ABE7.10 (Addgene #102919) and CGBE1 (pRZ3885) (Addgene #140252) with PmeI restriction endonuclease at 37 °C for 6 hours to linearize the fragments. Pipette a portion for agarose gel electrophoresis to ensure that all plasmids have been digested into linear forms. Subsequently, add 25x RNAsecure™ RNase Inactivation Reagent (Invitrogen, AM7005) solution to the digestion system to make its final concentration 1x. Treat the above mixture at 60 °C for 10 minutes to remove RNase, and then purify the linearized DNA fragments using the MinElute PCR Purification Kit (QIAGEN, 28004). Using this as a template, perform in vitro transcription with the mMESSAGE mMACHINE T7 Ultra Kit (Invitrogen, AM1345) according to the instructions. Subsequently, purify and recover the transcribed mRNA of the target CGBE or ABE7.10 using the MEGAclear™ Transcription Clean-Up Kit (Invitrogen, AM1908).

[0040] The plasmid maps of pGL3-U6-sgRNA-PGK-puromycin plasmid, pCMV-ABE7.10 plasmid and GBE1 (pRZ3885) plasmid are shown in Figures 3 - 5 .

[0041] Example 3 Editing, culturing and transplanting of dairy cow fertilized eggs (1)Oocyte acquisition The oocytes used in this experiment were obtained from the ovaries of freshly slaughtered Holstein dairy cows, obtained from a dairy farm in Yangling District, Shaanxi Province. All were healthy Holstein dairy cows and were transported to the laboratory within 2 h. After removing connective tissue and washing, the ovaries were placed on a 37 °C constant temperature heating plate. The liquid in follicles with a surface diameter of 2 - 8 mm was aspirated with an egg aspiration needle, and the follicular fluid was placed in a 90 mm culture dish. Cumulus-oocyte complexes with uniform cytoplasm, dense cumulus and three or more layers of cumulus cells wrapped around the outside were selected under a stereomicroscope.

[0042] (2)In vitro maturation of oocytes Prepare and preheat the egg washing solution: Sodium penicillin and streptomycin sulfate are dissolved in physiological saline at 37°C. Wash the collected oocytes three times in the preheated egg washing solution to remove impurities; then wash them three times in the pre-equilibrated maturation solution, and finally transfer them into the well-equilibrated oocyte maturation medium (OM) (Medium-199, Sigma), and incubate them for 20 hours in an incubator at 38.5°C, 5% CO2, and saturated humidity.

[0043] (2)In vitro fertilization Place the mature oocytes in the preheated washing solution, wash them three times with the preheated fertilization solution, transfer them into a well-equilibrated small drop of fertilization solution, use a pipette to aspirate 50 µL of the sperm suspension with adjusted concentration, and slowly add it to the small drop of fertilization solution to make the final volume of the fertilization solution 100 µL. Then co-incubate the sperm and eggs for 8 hours in an incubator at 38.5°C, 5% CO2, and saturated humidity.

[0044] (3)Editing of fertilized eggs Eight hours after the completion of in vitro fertilization, transfer the fertilized eggs to a preheated droplet of SOF-HEPES solution containing hyaluronidase, and repeatedly pipette the fertilized eggs with a mouth pipette and an egg picking needle to remove the granulosa cells around the fertilized eggs. Select the successfully fertilized eggs that have extruded the second polar body under the microscope. Wash the fertilized eggs three times in a 0.1% PVP / M2 droplet, then place them on the injection platform and perform microinjection under the microscope. Mix ABE7.10 mRNA (100 ng / μL) and sgRNA1 (50 ng / μL) in equal volumes, and mix CGBE mRNA (100 ng / μL) and sgRNA 2 (50 ng / μL) in equal volumes. Inject 20 pL of each mixture into each fertilized egg. The injected fertilized eggs are rinsed three times in KSOM culture medium to remove the dead embryos, and the remaining embryos are cultured in an incubator at 37°C with 5% CO2. In HECM-9 medium containing 10% fetal bovine serum (FBS, GIBCO), culture them in an incubator at 37°C and 5% CO2. The gene editing strategy is shown in Figure 6 。

[0045] (4)Sample collection and first-generation sequencing Prepare bovine embryo lysis solution in advance: Add 60 μL of 1M Tris-HCl solution with pH = 8.0, 13.5 μL of TritonX-100 solution, 13.5 μL of NP-40 solution, and 30 μL of 0.4 ng / mL proteinase K solution to 1383 μL of H2O, mix well, and store at 4°C for later use.

[0046] After culturing bovine embryos for 6 days, the embryonic development was observed under a microscope. The embryos at the morula stage were collected into PCR tubes, with 1 embryo placed in each PCR tube. 10 μL of bovine embryo lysis buffer was added, and the samples were incubated at 55 °C for 1 h and then at 95 °C for 10 min to lyse the embryos. The lysed products were used as PCR templates, and nested PCR amplification was performed for each target editing site. After electrophoresis and recovery of the PCR products, they were sent to a sequencing company for first-generation sequencing. The results are shown in Figures 7 - 9 .

[0047] Figure 7 Figure showing the morphological observation of the edited embryos (Bar = 200 μm).

[0048] Figure 8 Figure showing the successful amplification of the target site, with the target band size of 279 bp (forward primer lbp-p1-F used for amplification: 5’-AGGTAGGAGCCACTGAAG-3’, SEQ ID NO.12; reverse primer lbp-p4-279-R: 5’-GAGAGGTCTTAAGCCATCC-3’, SEQ ID NO.13).

[0049] Figure 9 The sequencing peak map results show that after editing, base mutations occurred at the editing sites corresponding to the two sgRNAs, resulting in a double-peak phenomenon in the sequencing peak map, indicating that the gene editing successfully introduced the target mutations.

[0050] (5) Embryo transfer The recipient cows were grouped intensively 15 days before estrus synchronization. Any immunization injection was prohibited within 1 week before embryo transfer and 45 days after embryo transfer to avoid stress. The recipient cows were not less than 13 months old, with a body height of not less than 130 cm, a body weight of not less than 350 kg, a body condition score of 2.5 - 3 points, being healthy, in good nutritional status, having intact reproductive organs, and having a normal estrus cycle. After estrus synchronization, according to the estrus records, recipient cows in estrus for 6 - 8 days were selected. After fixation, 3 - 5 mL of 2% lidocaine was used for epidural anesthesia. The feces in the rectum were removed, the vulva was disinfected with 75% alcohol, and wiped with 0.9% normal saline. The embryo was loaded into the embryo straw, and transported to the transplantation site at 37°C. After arrival, the surface moisture of the straw was dried with sterile paper, the straw plug was removed, the embryo straw was loaded into the transplantation gun, a hard plastic outer sheath was put on, the outer sheath of the dura mater was clamped tightly with a buckle, and finally a soft outer membrane was put on. The transplantation gun was inserted into the vulva at an angle of about 45° upward, and then horizontally passed through the vulva to reach the external orifice of the cervix. When the front section of the transplantation gun reached the cervical orifice, the soft outer membrane was torn, and then passed through the cervix, uterine body, and uterine horn on the side of the corpus luteum in turn. After the front end of the transplantation gun reached the 1 / 2 or 1 / 3 position at the front end of the uterine horn, the steel core of the transplantation gun was pushed to push out the embryo, and the transplantation gun was slowly withdrawn. After the operation, the cows were marked and the transplantation date was recorded. 30 - 35 days after transplantation, early pregnancy examination was carried out on the recipient cows that did not return to estrus, and the results of the first and re-examinations were recorded.

[0051] Finally, 3 calves were obtained, 3 survived, and 1 was identified as positive. The results are shown in Figures 10 - 14 .

[0052] Example 4 Determination of the mRNA expression level of pro-inflammatory cytokines The primary bovine mammary epithelial cells and gene-edited bovine mammary epithelial cells were passaged into 6-well cell culture plates. DMEM / F12 medium (Procell, PM150312) containing 10% fetal bovine serum was used. When the cells grew to 70 - 80%, the primary bovine mammary epithelial cells and gene-edited bovine mammary epithelial cells were treated with (10 μg / mL) LPS. After 12 h, the cell culture medium was collected. According to the instructions of the bovine tumor necrosis factor α (TNF-α) ELISA kit (Vankel, F6720-B) and the bovine interleukin 1β (IL-1β) ELISA kit (Vankel, F4049-B), the expression levels of the pro-inflammatory cytokines TNF-α and IL-1β were measured. The results are shown in Figures 15 - 16 .

[0053] By Figures 15 - 16It can be seen that under LPS (lipopolysaccharide) stimulation, bMECs (bovine mammary epithelial cells) with LBP gene editing release lower levels of TNF-α and IL-1β compared to normal bMECs. This phenomenon indicates that the LBP gene may play a key role in the inflammatory response of mammary epithelial cells, and its editing may enhance the cell's tolerance to LPS-induced inflammation, thereby reducing the release of inflammatory factors.

[0054] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but rather will be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A SgRNA expression vector, characterized in that, It is formed by ligating the pGL3-U6-sgRNA-PGK-puromycin vector with gRNA1, or by ligating the pGL3-U6-sgRNA-PGK-puromycin vector with gRNA2; the sequence of gRNA1 is: GCAGAGTAAGCTGCACAAAG, and the sequence of gRNA2 is: AGCTTACTCTGCAGAGCCAA.

2. A method for constructing the SgRNA expression vector according to claim 1, characterized in that, It includes the following steps: Using the pGL3-U6-sgRNA-PGK-puromycin plasmid as a template, amplifying gRNA1 or gRNA2; Connecting the amplification product into the linearized pGL3-U6-sgRNA-PGK-puromycin plasmid after digestion with enzymes to obtain the SgRNA expression vector.

3. The construction method according to claim 2, characterized in that The amplification primers for gRNA1 are: gRNA1-F: 5’-ACCGGCAGAGTAAGCTGCACAAAG-3’; gRNA1-R: 5’-AAACCTTTGTGCAGCTTACTCTGC-3’; The amplification primers for gRNA2 are: gRNA2-F: 5’-ACCGAGCTTACTCTGCAGAGCCAA-3’; gRNA2-R: 5’-AAACTTGGCTCTGCAGAGTAAGCT-3’.

4. The construction method according to claim 2, characterized in that, Digesting the pGL3-U6-sgRNA-PGK-puromycin plasmid with BsaI enzyme to obtain the linearized pGL3-U6-sgRNA-PGK-puromycin plasmid.

5. Use of the SgRNA expression vector or its transcribed mRNA according to claim 1 in precise gene editing of mammalian cells LBP ​ 6. Use of the SgRNA expression vector or its transcribed mRNA according to claim 1 in the preparation of a product for preventing and treating mastitis.

7. Use of the SgRNA expression vector or its transcribed mRNA according to claim 1 in the breeding of dairy cows resistant to mastitis.

8. Use of the SgRNA expression vector or its transcribed mRNA according to claim 1 in the preparation of a product for resisting mastitis pathogenic bacteria.

9. A gene editing method for enhancing the anti-mastitis resistance of dairy cows, characterized in that, It includes any one of the following steps (1) to (3): (1) The process of mixing and injecting the mRNA of ABE7.10 and the transcribed mRNA of gRNA1 according to claim 1 into the fertilized egg; (2) The process of mixing and injecting the mRNA of CGBE and the transcribed mRNA of gRNA2 according to claim 1 into the fertilized egg; (3) The process of co-injecting the mixed solutions in (1) and (2) into the fertilized egg.

10. The gene editing method according to claim 9, wherein The vector backbone of ABE7.10 is pCMV-ABE7.10, and the vector backbone of CGBE is CGBE1 (pRZ3885).