Construction method and application of TET2 gene knockout MDS model mouse
The construction of MDS model mice with TET2 knockout through gene editing solved the problem of lack of stable animal models in the prior art, and achieved efficient MDS disease simulation and drug screening.
Patent Information
- Application Number
- CN202510189150.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-20
- Publication Date
- 2025-07-04
AI Technical Summary
There is a lack of stable and efficient animal model of TET2 mutant MDS in the prior art, which affects the screening and efficacy evaluation of related therapeutic drugs.
By microinjecting gRNA and Cas9 mRNA targeting the TET2 gene into the fertilized eggs of mice, combining donor DNA fragments, MDS model mice with TET2 knockout were constructed, and gene editing was used by the Mx1-cre recombinase system, and TET2 knockout mice were gradually screened.
The built model is simple and easy to operate, with a high modeling rate, providing an ideal MDS disease model for exploring pathogenesis and screening of therapeutic drugs.
Smart Images

Figure CN120249402A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a method for constructing and applying a MDS model mouse with TET2 gene knockout. Background Art
[0002] Myelodysplastic syndrome (MDS) is a group of malignant clonal hematopoietic stem / progenitor cell diseases characterized by abnormal myeloid cell development, ineffective hematopoiesis, peripheral blood cytopenia, and the risk of transformation into acute myeloid leukemia. At present, the pathogenesis of MDS in clinical practice is not yet clear, and it may be related to molecular genetics, changes in the hematopoietic microenvironment, disorders of hematopoietic stem / progenitor cell proliferation and apoptosis, immune deficiency, and methylation of tumor suppressor genes. Due to the high heterogeneity of MDS, the only treatment that may achieve long-term remission of the disease at home and abroad is bone marrow hematopoietic stem cell transplantation. However, most MDS patients are of high age at onset and there are few bone marrow donors, so only a few patients can receive this treatment. At present, the treatment of low-risk MDS is mainly supportive treatment, but the curative effect is poor; the treatment of high-risk MDS is mainly based on demethylating drugs, but there are still problems such as large adverse reactions and easy drug resistance.
[0003] Ten-Eleven Translocation 2 (TET2) mutation is one of the common mutations in MDS. Approximately 20-25% of MDS patients have TET2 mutations. At present, the research on TET2 mutations in the field of MDS has become a hot topic. Studies have shown that TET2 mutations, as driver genes of MDS, can lead to dysplastic hematopoiesis and ineffective hematopoiesis. Although there have been a large number of studies on TET2-mutated MDS, the treatment of this disease has not achieved ideal results. In order to promote the treatment of patients with TET2-mutated MDS, establishing a stable, efficient experimental animal model that conforms to TET2-knockout MDS disease is helpful for related experimental studies on myelodysplastic syndrome and is also the key to studying the pathogenesis and treatment measures of myelodysplastic syndrome. Summary of the Invention
[0004] The purpose of the present invention is to provide a method for constructing a MDS model mouse with TET2 gene knockout for the problem that the research and treatment of TET2-mutated MDS in the prior art lack relevant animal model research objects, thereby affecting the screening of relevant therapeutic drugs and the evaluation of curative effects.
[0005] The technical solution of the present invention is described in detail as follows:
[0006] In the first aspect, the present invention provides a method for constructing a MDS model mouse with TET2 gene knockout, including the following steps:
[0007] (1) The first gRNA and Cas9 mRNA targeting the TET2 gene knockout region, as well as the second gRNA targeting the flox site and a donor DNA fragment containing two loxP sites in the same direction, were co-injected into mouse fertilized eggs, and the surviving fertilized eggs were transplanted into pseudo-pregnant female mice to give birth to F0 generation mice; and the flox-positive F0 generation mice were obtained by genetic identification and screening;
[0008] The first gRNA nucleotide sequence is shown in SEQ ID NO.1-2 or SEQ ID NO.3-4;
[0009] The nucleotide sequence of the second gRNA is shown in SEQ ID NO.5-6.
[0010] (2) The positive F0 generation mice were mated with wild-type mice to obtain F1 generation mice, and Tet2-flox heterozygous mice were screened out by sequencing and identification;
[0011] (3) Tet2-flox heterozygous mice were mated with each other to obtain Tet2-flox homozygous mice; Tet2-flox heterozygous mice were mated with Mx1-cre positive mice to obtain Tet2-flox heterozygous Mx1-cre positive mice;
[0012] (4) Tet2-flox homozygous mice were mated with Tet2-flox heterozygous Mx1-cre positive mice to obtain Tet2-flox homozygous and Mx1-cre positive mice, which are MDS model mice with TET2 gene knockout.
[0013] Optionally or preferably, in the above construction method, the primer pair used for sequencing and identifying the F1 generation in step (2) comprises the primer pair sequence used at the 5' end as shown in SEQ ID NOs. 7-8, and the primer pair sequence used at the 3' end as shown in SEQ ID NOs. 9-10.
[0014] Optionally or preferably, in the above construction method, in step (3), the ratio of male to female numbers of Tet2-flox heterozygous mice mating with each other is 2:1, and the ratio of male to female numbers of Tet2-flox heterozygous mice mating with Mx1-cre positive mice is 2:1.
[0015] Optionally or preferably, in the above construction method, in step (4), the ratio of male to female numbers of Tet2-flox homozygous mice and Tet2-flox heterozygous Mx1-cre positive mice is 2:1.
[0016] Optionally or preferably, in the above construction method, in step (4), the primer pair sequences used for gene identification of Tet2-flox homozygous and Mx1-cre positive mice are as shown in SEQ ID NO.11-12 and SEQ ID NO.13-14.
[0017] Optionally or preferably, in the above construction method, the mouse is a C57BL / 6JGpt mouse.
[0018] In a second aspect, the present invention provides the application of the TET2 gene knockout MDS model mouse constructed by any of the above methods, which is characterized in that it is used for screening therapeutic drugs for TET2 mutant MDS.
[0019] Compared with the prior art, the present invention has the following beneficial effects:
[0020] The construction method of the MDS model mouse with TET2 gene knockout of the present invention has a simple model construction, a high modeling rate, is easy to operate, can be used to simulate the phenotype of MDS, provides an ideal animal model for exploring the pathogenesis and treatment methods of TET2 mutant MDS diseases, and further is used for screening therapeutic drugs for TET2 mutant MDS. Description of the Drawings
[0021] Figure 1 It is a construction strategy diagram of the MDS model mouse with TET2 gene knockout.
[0022] Figure 2 It is a schematic diagram of the identification position of F1 generation mice.
[0023] Figure 3 It is an electrophoresis diagram for identifying F1 generation Tet2-flox heterozygous mice. The numbers are the mouse tail numbers, WT is C57BL / 6JGpt wild type, N is the blank control, and M is the DNA marker.
[0024] Figure 4 It is an electrophoresis diagram of the gene identification result of the MDS model mouse with TET2 gene knockout. B6 is the negative control, which is the B6 genomic DNA; N is the blank control, that is, the control without template; Trans2K PlusII: 8000bp\5000bp\3000bp\2000bp\1000bp\750bp\500bp\250bp\100bp. Detailed Embodiments
[0025] In order to make the technical personnel in this field better understand the present application scheme, the present application will be clearly and completely described below in conjunction with the embodiments and drawings. Obviously, the described embodiments are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work should belong to the scope of protection of this application. The instruments and reagents used in the embodiments are all derived from commercial channels unless otherwise specified.
[0026] Example 1 Construction of TET2 gene knockout MDS model mice
[0027] TET2 gene related information is shown in Table 1 below:
[0028] Table 1 Basic information of Tet2 gene
[0029]
[0030] The strategy for constructing TET2 gene knockout MDS model mice is as follows Figure 1 As shown, C57BL / 6JGpt mice were selected, and the specific steps of the construction method are as follows:
[0031] 1. Vector construction
[0032] (1) The selection of Cas9 target sites targeting the C57BL / 6JGpt mouse gene is shown in Table 1 above, and the specific knockout exon region is exon 3.
[0033] (2) A TET2 first gRNA in vitro transcription vector was constructed, wherein the first gRNA was 5S1, 3S1, or 5S2, 3S2, and the specific sequence was shown in Table 2. A homologous recombination vector (Donor vector) was constructed at the same time. The donor DNA fragment of the homologous recombination vector contained two unidirectional loxP sites. The loxP site genomic sequences of the Tet2 wild-type second gRNAs and Tet2 Cas9-CKOd are shown in Table 3. The correctness of the vector sequence was verified by sequencing.
[0034] Table 2 Insertion sequence information of the first gRNA in vitro transcription vector
[0035] First gRNA Name First gRNA Sequence (5’→3’) PAM 5S1 GCACCCTTGAAGATGGTCGG (SEQ ID NO.1) AGG 5S2 GTGGCACCCTTGAAGATGGT (SEQ ID NO.3) CGG 3S1 CAAGTTCCAGCAGATGTGGG (SEQ ID NO.2) AGG 3S2 CCAGCAGATGTGGGAGGTAG (SEQ ID NO.4) GGG
[0036] Table 3 Genomic sequences of Tet2 wild type and Tet2 Cas9-CKO
[0037]
[0038] (3) Prepare gRNA and cas9 mRNA.
[0039] The constructed TET2 first gRNA in vitro transcription vector was used as a template to perform PCR amplification of the first gRNA to obtain the first gRNA sequence. The cas9 protein and the first gRNA were mixed, and then an expression vector was constructed, and cas9 mRNA was obtained by screening, inducing expression and purification.
[0040] 2. Microinjection
[0041] (1) The first gRNA and Cas9 mRNA targeting the TET2 gene knockout region, as well as a donor DNA fragment containing two loxP sites in the same direction and a second gRNA targeting the flox site, were microinjected into C57BL / 6JGpt mouse fertilized eggs.
[0042] (2) The fertilized eggs that survive the injection are transplanted into pseudo-pregnant female mice, which are then allowed to become pregnant and give birth. The pups born are the F0 generation.
[0043] 3. Identification of F0 generation mice
[0044] The F0 generation pups were tail-clipped and toe-clipped at 5-7 days old and numbered. Genomic DNA was extracted for PCR and sequencing identification to confirm the genotype, and flox-positive F0 generation mice were screened.
[0045] 4. Breeding of positive F0 generation mice
[0046] (1) After flox-positive F0 mice reached sexual maturity, they were mated with wild-type background mice;
[0047] (2) The F1 generation mice were tail-clipped and toe-clipped at 5-7 days after birth and numbered. Genomic DNA was extracted for PCR and sequencing identification. The primer information used for identification is shown in Tables 4 and 5, and the PCR conditions are shown in Table 6. After confirming the genotype, Tet2-flox heterozygous mice were screened.
[0048] Table 4 PCR primer information
[0049]
[0050]
[0051] Table 5 Sequencing primer information
[0052]
[0053] The PCR reaction components are as follows:
[0054] Table 6 PCR reaction components and PCR conditions
[0055]
[0056]
[0057] The judgment criteria for the PCR identification results of F1 generation mice are shown in Figure 2 , which are the sequencing identification criteria at both ends of the target gene after the target gene of F1 generation mouse pups is knocked out:
[0058] Wild type: ① The PCR product of the 5'arm primer pair can only obtain a single WT band.
[0059] Heterozygote: ① The PCR product of the 5'arm primer pair shows two bands, Target and WT, and ② the PCR product of the 3'arm primer pair is a single Target band.
[0060] Homozygote: Then ① the PCR product of the 5'arm primer pair is a single Target band, and ② the PCR product of the 3'arm primer pair is a single Target band.
[0061] According to the schematic diagram of the PCR strategy, after PCR confirmation, the F1 generation mice numbered 46, 54, 56, 62, and 63 are Tet2-flox heterozygous mice, and the electrophoresis patterns are as Figure 3 shown.
[0062] 5. Tet2-flox mating with Mx1-Cre
[0063] (1) Collect blood from Mx1-cre positive male mice for microbial detection, sample and recheck the genotype, mate with C57BL / 6JGpt background mice by IVF and transplant the recipients, and wait for sexual maturity.
[0064] (2) Mate the Tet2-flox heterozygous mice obtained in step 4 in a male-to-female ratio of 2:1, and at the same time mate the Tet2-flox heterozygous mice with Mx1-cre positive mice.
[0065] (3) Identify by tail snipping of the offspring. Screen Tet2-flox homozygous mice from the offspring obtained by mating Tet2-flox heterozygous mice with each other, and screen Tet2-flox heterozygous Mx1-cre positive mice from the offspring obtained by mating Tet2-flox heterozygous mice with Mx1-cre positive mice, and wait for sexual maturity.
[0066] (4) Mate the Tet2-flox homozygous mice with the Tet2-flox heterozygous Mx1-cre positive mice in a male-to-female ratio of 2:1.
[0067] (5) Identify by tail snipping of the offspring. Screen the mice that are Tet2-flox homozygous and Mx1-cre positive. This mouse is the Tet2 knockout MDS mouse model. The primer information for gene identification is shown in Table 7.
[0068] Table 7 Primer Information for Mouse Gene Identification
[0069]
[0070]
[0071] For the gene identification results, see Figure 4 , and the electrophoresis results showed that the mice numbered 116, 132, 136, 140, 141, 147, and 153 were Tet2 knockout MDS mice.
[0072] In this article, specific examples are used to elaborate on the inventive concept in detail. The description of the above embodiments is only used to help understand the core idea of the present invention. It should be noted that for those of ordinary skill in the art, any obvious modifications, equivalent replacements, or other improvements made without departing from the inventive concept shall be included within the protection scope of the present invention.
Claims
1. A method for constructing a MDS model mouse with TET2 gene knockout, characterized in that The following steps are involved: (1) The first gRNA and Cas9 mRNA targeting the TET2 gene knockout region, as well as the second gRNA targeting the flox site and a donor DNA fragment containing two loxP sites in the same direction, were co-injected into mouse fertilized eggs, and the surviving fertilized eggs were transplanted into pseudo-pregnant female mice to give birth to F0 generation mice; and the flox-positive F0 generation mice were obtained by genetic identification and screening; The first gRNA nucleotide sequence is shown in SEQ ID NO.1-2 or SEQ ID NO.3-4; The nucleotide sequence of the second gRNAh is shown in SEQ ID NO.5-6. (2) The positive F0 mice were mated with wild-type mice to obtain F1 mice, and Tet2-flox heterozygous mice were screened out by sequencing; (3) Tet2-flox heterozygous mice were mated with each other to obtain Tet2-flox homozygous mice; Tet2-flox heterozygous mice were mated with Mx1-cre positive mice to obtain Tet2-flox heterozygous Mx1-cre positive mice; (4) Tet2-flox homozygous mice were mated with Tet2-flox heterozygous Mx1-cre positive mice to obtain Tet2-flox homozygous and Mx1-cre positive mice, which are MDS model mice with TET2 gene knockout.
2. The construction method according to claim 1, characterized in that The primer pair used for F1 gene identification in step (2) has the sequences of the primer pair used at the 5' end as shown in SEQ ID NOs. 7-8, and the sequences of the primer pair used at the 3' end as shown in SEQ ID NOs. 9-10.
3. The construction method according to claim 1, wherein In step (3), the female-to-male ratio of Tet2-flox heterozygous mice mating with each other was 2:1, and the female-to-male ratio of Tet2-flox heterozygous mice mating with Mx1-cre positive mice was 2:
1.
4. The construction method according to claim 1, characterized in that In step (4), the female-to-male ratio of Tet2-flox homozygous mice and Tet2-flox heterozygous Mx1-cre positive mice is 2:
1.
5. The construction method according to claim 1, wherein In step (4), the primer pair sequences used for gene identification of mice that are homozygous for Tet2-flox and positive for Mx1-cre are shown in SEQ ID NOs. 11-12 and SEQ ID NOs. 13-14.
6. The construction method according to claim 1, wherein The mice are C57BL / 6JGpt mice.
7. Use of the TET2 gene knockout MDS model mice constructed by the method according to any one of claims 1 to 6, characterized in that, Used for screening therapeutic drugs for TET2 mutant MDS.