MiRNA diagnosis marker related to recurrence of minimal lesion nephropathy, detection primer group and application

Abstract

The invention provides a miRNA diagnosis marker related to recurrence of minimal lesion nephropathy, a detection primer group and application, and belongs to the technical field of biomarkers. According to the invention, differential expression of miR-490-5p, miR-503-5p, miR-660-3p and miR-3198 in an MCD hormone treatment relapse group and a non-relapse group is determined, further, the expression of miR-490-5p, miR-503-5p, miR-660-3p and miR-3198 in LPS (lipopolysaccharide) treated podocyte and HK-2 is proved to be reduced in a cellular level, and the potential of miR-490-5p, miR-503-5p, miR-660-3p and miR-3198 as a biomarker for early diagnosis of MCD relapse is determined. Under the condition of overexpression of the four miRNAs, the expression of inflammatory factors is detected, and it is found that miR-490-5p can significantly inhibit the inflammatory reaction activated by LPS, so that the effect of protecting podocytes and HK-2 is achieved.

Description

Technical Field

[0001] The present invention relates to the technical field of biomarkers, and in particular, to a miRNA diagnostic biomarker related to the recurrence of minimal change nephropathy, a detection primer set, and an application thereof. Background Art

[0002] Minimal Change Disease (MCD) is a common pathological type of primary nephrotic syndrome, also known as Minimal Change Nephrotic Syndrome (MCNS), accounting for 70–90% of childhood and 10–25% of adult primary nephrotic syndrome respectively. Its characteristics are edema caused by massive proteinuria and reduced intravascular volume. The pathological manifestation of MCD is that under light microscopy, the glomeruli are basically normal, and under electron microscopy, the ultrastructure is mainly characterized by diffuse foot process fusion. There is generally no electron-dense deposit in the glomeruli, and the immunofluorescence results are usually negative. Weak positive IgA, IgM or C3 deposits can also be seen in a small number of specimens. Nonspecific global glomerular sclerosis may exist, with manifestations such as tubular injury and shedding of the brush border. Fatty degeneration can be seen in the proximal tubular epithelial cells, and it was once called "lipoid nephrosis" in the mid-20th century.

[0003] Glucocorticoid (GC) has always been the first choice for the treatment of nephrotic syndrome. However, about 70% of children and 40%–70% of adults with MCD who respond effectively to glucocorticoid treatment experience at least one recurrence during clinical treatment. Recurrence after treatment, even frequent recurrence, is a huge problem faced by glucocorticoid treatment. However, many patients cannot tolerate the numerous side effects of glucocorticoids, including osteoporosis, infection, psychological abnormalities, growth retardation, diabetes, obesity, gastrointestinal bleeding and other complications. To reduce the side effects caused by repeated use of glucocorticoids in MCD patients, the KDIGO Clinical Practice Guidelines recommend adding immunosuppressive drugs such as cytotoxic drugs, cyclosporine A (CsA), tacrolimus (TAC), and rituximab.

[0004] Although the above immunosuppressive drugs can reduce the dose of glucocorticoids and glucocorticoid dependence, the recurrence problem still cannot be effectively solved. The high recurrence rate of MCD patients is an outstanding clinical problem at present. Therefore, to explore optimized treatment drugs and regimens for MCD recurrence, we urgently need to find biomarkers that can predict the recurrence risk of glucocorticoid treatment for MCD.

[0005] Increasing evidence suggests that miRNAs can serve as potential disease biomarkers and are considered to be one of the most promising biomarkers. MicroRNA (miRNA) is a class of small non-coding RNA molecules approximately 22 nucleotides (nt) in length. Recent studies have shown that miRNAs are one of the central players in regulating gene expression. miRNA-mediated RNA interference is a regulatory mode of protein expression at the translational level and has been shown to be involved in a series of physiological responses. Many scientific studies have revealed that miRNAs play important roles in normal human growth and development as well as in disease processes, including kidney development and diseases. Researchers have found that the expressions of six miRNAs, namely miR-181a, miR-210, miR-30a, miR-942, miR-192, and miR-586, are upregulated in the sera of patients with nephrotic syndrome. Some studies have reported that miR-30s can target key molecules in the calcineurin signaling pathway and inhibit the activation of the calcineurin signaling pathway, thereby protecting podocytes. Other studies have shown that overexpression of miR-30s can inhibit the high recurrence rate of minimal change disease (MCD), which is the biggest clinical challenge. Therefore, it is necessary to find biomarkers that can detect disease recurrence at an early stage and reveal the specific molecular mechanisms of recurrence.

[0006] Current studies on miRNAs and MCD mainly focus on differentiating MCD from other kidney disease types, especially on the miRNAs with differential expressions between MCD and FSGS. Some researchers used gene chip detection to analyze the differential miRNAs in the plasma and urine of FSGS and MCD patients and found that 126 and 155 differentially expressed miRNAs were shown in the plasma and urine of MCD compared with the control, respectively. Other studies have shown that serum miR-192 and miR-205 have the potential to differentiate FSGS from MCD. Some studies have proposed that in pediatric kidney diseases, miR-150 is a biomarker for differentiating MCD from other kidney diseases. Huang Z et al. found that the level of miR-193a in urinary exosomes of children with FSGS was significantly higher than that in MCD, and proposed that miR-193a in urinary exosomes can be used as a potential biomarker for pediatric primary FSGS. miR-21 is associated with allograft renal insufficiency and tubular atrophy and is considered to be a potential non-invasive biomarker for monitoring renal transplant function. A group of small RNAs (miR-20a, miR-92a, miR-93, miR-195, miR-451) are expected to be biomarkers for early detection of acute kidney injury caused by oxalate. However, there is currently no study on the relationship between miRNAs and MCD recurrence.

[0007] Therefore, it is crucial to find biomarkers that can predict the recurrence risk of MCD treated with hormones. Summary of the Invention

[0008] The object of the present invention is to provide a miRNA diagnostic marker related to the recurrence of minimal change nephropathy, a detection primer set and an application, and the recurrence risk of MCD can be judged by miR-490-5p, miR-503-5p, miR-660-3p and miR-3198.

[0009] In order to achieve the above object of the invention, the present invention provides the following technical solutions:

[0010] The present invention provides a miRNA diagnostic marker related to the recurrence of minimal change nephropathy, and the

[0011] miRNA diagnostic marker includes one or more of miR-490-5p, miR-503-5p, miR-660-3p and miR-3198.

[0012] Preferably, the sequences of the miR-490-5p, miR-503-5p, miR-660-3p and miR-3198 are shown in the following table:

[0013] Sequence Name Serial Number Sequence miR-490-5p SEQ ID NO.27 CCAUGGAUCUCCAGGUGGGU miR-503-5p SEQ ID NO.28 UAGCAGCGGGAACAGUUCUGCAG miR-660-3p SEQ ID NO.29 ACCUCCUGUGUGCAUGGAUUA miR-3198 SEQ ID NO.30 GUGGAGUCCUGGGGAAUGGAGA 。

[0014] Preferably, the expression of miR-490-5p, miR-503-5p, miR-660-3p and miR-3198 is decreased in patients with recurrent minimal change nephropathy.

[0015] Preferably, the miRNA diagnostic marker includes miR-490-5p.

[0016] Preferably, the miR-490-5p can significantly inhibit the inflammatory response activated by LPS.

[0017] The present invention also provides an application of a miRNA diagnostic marker related to the recurrence of minimal change nephropathy in the preparation of a detection product for the recurrence of minimal change nephropathy.

[0018] The present invention also provides a primer set capable of detecting miRNA related to the recurrence of minimal change nephropathy, including one or more of the following primer sequences:

[0019] miRNA Name Serial Number miRNA qpcr Forward Primer Sequence miR-490-5p SEQ ID NO.1 ACCATGGATCTCCAGGTGGGTC miR-660-3p SEQ ID NO.2 ACCTCCTGTGTGCATGGATTA miR-503-5p SEQ ID NO.3 GTAGCAGCGGGAACAGTTCTGCAG miR-3198 SEQ ID NO.4 GGTGGAGTCCTGGGGAATGGAGA

[0020] The present invention also provides a detection product for the recurrence of minimal change nephropathy, and the detection product for the recurrence of minimal change nephropathy includes the above primer set.

[0021] The present invention also provides an application of a miRNA diagnostic marker related to the recurrence of minimal change nephropathy in the preparation of a drug for treating the recurrence of minimal change nephropathy.

[0022] The beneficial effects of the present invention compared with the prior art are as follows:

[0023] The present invention determines the differential expression of miR-490-5p, miR-503-5p, miR-660-3p and miR-3198 in the relapse and non-relapse groups of MCD hormone treatment. Further, at the cellular level, it is demonstrated that the expressions of miR-490-5p, miR-503-5p, miR-660-3p and miR-3198 decrease in LPS-treated podocytes and HK-2 cells, determining their potential as biomarkers for early diagnosis of MCD relapse. At the same time, experiments prove that the expressions of these 4 miRNAs all decrease after LPS treatment, suggesting that they may play a certain role in the response of podocytes and HK-2 cells to inflammatory responses. Under the condition of overexpressing these 4 miRNAs, the expressions of inflammatory factors are detected, and it is found that miR-490-5p can significantly inhibit the inflammatory response activated by LPS, thereby playing a role in protecting podocytes and HK-2 cells. Brief Description of the Drawings

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0025] Figure 1 It is a volcano plot of differentially expressed miRNAs in the relapse and non-relapse groups of MCD hormone and tacrolimus treatment in Example 1 of the present application. Among them, A is the volcano plot of differentially expressed miRNAs in the relapse and non-relapse groups of MCD hormone treatment; B is the volcano plot of differentially expressed miRNAs in the relapse and non-relapse groups of MCD tacrolimus treatment; the abscissa in the figure represents the differential expression fold change of log2(Fold Change). We set that the expression difference of more than 2 times is meaningful. The ordinate represents -log10(FDR). Each point represents a gene, and the color is used to distinguish whether the gene is differentially expressed. In the figure, red represents the miRNAs with up-regulated expression in the non-relapse group compared with the relapse group, while green represents the down-regulated miRNAs, and black represents the miRNAs with no differential expression;

[0026] Figure 2This is the miRNA that is differentially expressed in common in the relapse and non-relapse groups treated with MCD hormone and tacrolimus in Example 1 of this application. Among them, A is the Venn diagram of the miRNA that is differentially expressed in common in the relapse and non-relapse groups treated with MCD hormone and tacrolimus. The blue circle represents the set of miRNAs that are differentially expressed in the relapse and non-relapse groups of the hormone group (drugT), and the red circle represents the set of miRNAs that are differentially expressed in the relapse and non-relapse groups of the tacrolimus group (drugF). The overlapping part of the two represents the miRNAs that are differentially expressed in common in the two groups; B is the Venn diagram of the miRNAs divided into four sets according to upregulation and downregulation in the relapse and non-relapse groups treated with MCD hormone and tacrolimus; C is the expression heat map of the miRNAs that are differentially expressed specifically in the tacrolimus group (drugF) (480); D is the expression heat map of the miRNAs that are differentially expressed specifically in the hormone group (drugT) (307); E is the expression heat map of the miRNAs that are differentially expressed in common in the tacrolimus group (drugF) and the hormone group

[0027] (drugT).

[0028] Figure 3 This is the q-PCR verification result of the miRNAs that are differentially expressed in the relapse and non-relapse groups treated with MCD hormone in Example 1 of this application. A is miR-490-5p, B is miR-503-5p, C is miR-660-3p, D is miR-3198. A-D are the relative expression levels of the four miRNAs in the relapse group and the non-relapse group treated with MCD hormone, with U6 as the internal reference. The results are presented as a scatter plot, where one point represents the relative expression level of one sample, and * represents P < 0.05, indicating a significant difference between the two groups;

[0029] Figure 4 This is the expression of miR-490-5p / miR-503-5p / miR-660-3p / miR-3198 in HK-2 and podocytes treated with LPS in Example 2 of this application. A is miR-490-5p, B is miR-503-5p, C is miR-660-3p, D is miR-3198. A-D are the relative expression levels of the four miRNAs in HK-2 and podocytes in the groups treated with LPS for 6 h and 24 h, with U6 as the internal reference. The results are presented as a bar chart. Compared with the control group, * represents P < 0.05, ** represents P < 0.01, *** represents P < 0.001, and **** represents P < 0.0001;

[0030] Figure 5 This is miR-490-5p mimic / miR-503-5p mimic in Example 2 of this application

[0031] Expression efficiency of / miR-660-3p mimic / miR-3198 mimic in HK-2 and podocytes. A is miR-490-5p mimic, B is miR-503-5p mimic, C is miR-660-3p mimic, D is miR-3198 mimic, with U6 as the internal reference, and the results are presented as bar graphs. Compared with the control group, *** represents P < 0.001, and **** represents P < 0.0001;

[0032] Figure 6 This is the expression result of IL-6, TNF-α, and IL-1β gene mRNAs in Example 2 of this application. Among them, A-C are the detection of the expression of IL-6, TNF-α, and IL-1β gene mRNAs by overexpressing miR-490-5p mimic in HK-2. A is IL-6, B is TNF-α, and C is IL-1β; D-F are the detection of the expression of IL-6, TNF-α, and IL-1β gene mRNAs by overexpressing miR-503-5p mimic in HK-2. D is IL-6, E is TNF-α, and F is IL-1β; G-I are the detection of the expression of IL-6, TNF-α, and IL-1β gene mRNAs by overexpressing miR-660-3p mimic in HK-2; J-L are the detection of the expression of IL-6, TNF-α, and IL-1β gene mRNAs by overexpressing miR-3198 mimic in HK-2; compared with the transfection NC group, **P < 0.01, ***P < 0.001; compared with the LPS-treated transfection control group, +P < 0.05, ++P < 0.01;

[0033] Figure 7 This is the expression of miR-490-5p inhibiting LPS-activated related inflammatory genes in mouse podocytes in Example 2 of this application. Among them, A is IL-6, B is MCP-1, C is CD80, D is ICAM-1, and the mRNA expression of these four genes in the mouse podocyte transfection NC and miR-490-5p overexpression groups and the LPS-treated control group and miR-490-5p overexpression group. Compared with the transfection NC group, **P < 0.01, ***P < 0.001; compared with the LPS-treated transfection control group, +P < 0.05, ++P < 0.01;

[0034] Figure 8In Example 2 of this application, miR-490-5p in podocytes and HK-2 cells can inhibit the protein expression of inflammatory factors activated by LPS. Among them, A shows that overexpression of miR-490-5p in podocytes can inhibit the phosphorylation of NF-κB p65 and the expression of IL-6 inflammatory factor activated by LPS, and TNF-α is not expressed or expressed at a very low level in podocytes; B shows that overexpression of miR-490-5p in HK-2 cells inhibits the phosphorylation of NF-κB p65 and the protein expression of IL-6 and TNF-α inflammatory factors activated by LPS. Detailed implementation manners

[0035] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0036] It should be understood that the terms used in the present invention are only for describing specific implementation manners and are not used to limit the present invention. In addition, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0037] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0038] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the specification of the present invention, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are only exemplary.

[0039] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.

[0040] Example 1

[0041] Example 1 of the present invention provides a method for screening miRNAs related to the recurrence of minimal change nephropathy, and the specific steps are as follows:

[0042] (1) Research subjects:

[0043] Patients who were hospitalized in the Nephrology Center of the First Affiliated Hospital of Zhejiang University School of Medicine for renal biopsy and were pathologically diagnosed with minimal change disease, treated with hormones or tacrolimus (TAC), and were newly diagnosed patients without other secondary factors except for the primary disease of the kidney itself. Peripheral blood mononuclear cell specimens of all enrolled patients were collected on the day of renal biopsy during hospitalization. This study was approved by the Ethics Committee of the First Affiliated Hospital of Zhejiang University School of Medicine.

[0044] Hormone treatment regimen: After patients received methylprednisolone pulse therapy at a dose of 0.8 mg / kg per day for 10 days, according to the treatment response, patients then orally took prednisone at a dose of 1 mg / kg per day (maximum 80 mg / day) for 6 - 8 weeks. Subsequently, the dose was reduced by 5 mg per week to 30 mg per day and maintained for 8 weeks, and then gradually reduced within about 12 weeks until complete discontinuation of the drug.

[0045] Tacrolimus treatment regimen: TAC treatment started on the 8th day, and the initial oral dose was 0.05 mg / kg per day (divided into two doses, 12 hours apart). The TAC dose was adjusted to a target trough whole blood level of 4 - 8 ng / ml and maintained for 16 - 20 weeks according to the treatment response. Subsequently, the dose was gradually reduced within about 18 weeks to reach a target trough value of 2 - 5 ng / ml until complete discontinuation of the drug. Inclusion criteria: 1) Patients over 15 years old who are eligible for kidney biopsy; 2) First diagnosed with primary MCD and have not received hormone or immunosuppressive treatment previously; 3) Treated with glucocorticoid treatment or tacrolimus treatment regimen and sensitive to hormones and tacrolimus.

[0046] Exclusion criteria were: 1) Patients confirmed or suspected of having secondary MCD by renal biopsy; 2) Patients with systemic diseases (diabetes), infections (HIV, HBV, HCV), or drug abuse; 3) Patients with steroid resistance or steroid dependence.

[0047] Table 1 Basic information of small RNA sequencing samples in the hormone treatment group

[0048]

[0049]

[0050] Table 2 Basic information of small RNA sequencing samples in the hormone treatment group

[0051] Non-recurrence Group N = 7 Recurrence Group N = 9 Proportion of Females, n(%) 50.0％ 50.0％ Enrollment Age (years) 32±9 33±16 Protein / Creatinine Ratio (g / g) 7.79±5.59 6.52±2.75 Serum Albumin (g / L) 15.37±3.81 15.60±4.24 Creatinine (mmol / L) 61.83±17.59 63.00±7.85 <![CDATA[Glomerular filtration rate (ml / min per 1.73 m 2 )]]> 127.79±23.88 121.31±19.01 Fasting Blood Glucose (mmol / L) 4.44±0.60 4.40±0.61 Cholesterol (mmol / L) 9.59±0.88 10.99±4.84 Triglyceride (mmol / L) 2.39±1.11 1.87±0.35 Low Density Lipoprotein (mmol / L) 6.42±0.53 7.73±2.82 Uric Acid (μmol / L) 322.83±110.37 382.00±99.82

[0052] Table 3 Basic information of small RNA sequencing samples in the hormone treatment group

[0053]

[0054]

[0055] (2) Grouping: The sequenced samples were divided into four groups: 7 cases in the minimal change nephropathy group with no recurrence after steroid treatment (steroid non-recurrence group) and 9 cases in the minimal change nephropathy group with recurrence after steroid treatment (steroid recurrence group), a total of 16 cases; the minimal change nephropathy group with no recurrence after tacrolimus treatment (TAC non-recurrence group) and the minimal change nephropathy group with recurrence after tacrolimus treatment (TAC recurrence group), with 6 cases in each group, a total of 12 cases.

[0056] Verification sample grouping: Since there were fewer patients treated with tacrolimus alone and the sample size was small, only the steroid treatment group was verified, divided into two groups: steroid recurrence and steroid non-recurrence, with 20 samples in each group, a total of 40 samples.

[0057] The definitions of recurrence and non-recurrence for MCD are as follows. Non-recurrence group: No recurrence occurred after sufficient dose and full course of treatment after the initial onset, and the drug was successfully discontinued. Recurrence group: During the treatment with sufficient dose of drug, 1 or more recurrences occurred, that is, urinary protein > 3.5 g / d.

[0058] (3) RNA extraction

[0059] 1), Extraction of peripheral blood RNA samples

[0060] After mixing the whole blood specimens of the patients, slowly add lymphocyte separation medium with the same volume as the whole blood, centrifuge at 3500 rpm for 10 min, aspirate the middle cell layer, be careful not to aspirate other layers, wash once with PBS, centrifuge again, discard PBS, then add the prepared cell cryopreservation solution, and store in a -80 °C refrigerator.

[0061] Use the miRNeasy Mini Kit (Qiagen, 217004) kit to extract total RNA from peripheral blood mononuclear cell samples according to the instructions, measure its concentration using NanoDrop 2000, aliquot and store at -80 °C for later use.

[0062] 2) Reverse transcription and screening of miRNAs related to recurrence of minimal change nephropathy

[0063] A. Reverse transcription: Use the miRNA reverse transcription kit (Takara, 638313, whose principle is to perform reverse transcription by the tailing method) to reverse transcribe the RNA in step (1), and finally add double-distilled water to dilute the reverse-transcribed sample to make the total volume reach 100 uL.

[0064] B. miRNA Sequencing Screening: RNA was extracted from the peripheral blood mononuclear cell samples of 9 patients in the recurrence group and 7 patients in the non-recurrence group after steroid treatment, as well as 6 patients in the recurrence group and 6 patients in the non-recurrence group after tacrolimus treatment, a total of 28 patients who were pathologically diagnosed with MCD by renal biopsy. BGISEQ-500 small RNA sequencing method was used for sequencing. The results showed that a total of 578 differentially expressed miRNAs were found in the steroid treatment recurrence and non-recurrence groups. Compared with the recurrence group, 287 miRNAs were up-regulated and 291 miRNAs were down-regulated in the non-recurrence group (as shown in A in

[0065] ). A total of 751 differentially expressed miRNAs were found in the tacrolimus treatment recurrence and non-recurrence groups. Compared with the recurrence group, 371 miRNAs were up-regulated and 380 miRNAs were down-regulated in the non-recurrence group. The inclusion criteria were |log2FC| > 2 and the adjusted P value < 0.001. Volcano plots of differentially expressed miRNAs in the steroid treatment group and the tacrolimus treatment group were drawn according to the sequencing results as shown in B in Figure 1 ). Figure 1 ).

[0066] C. Identification of Common Differentially Expressed miRNAs in Two Treatment Groups

[0067] To find the common differentially expressed miRNAs that affect the recurrence and non-recurrence groups in steroid and tacrolimus treatment of MCD, the sequencing results were analyzed. Using the Venn diagram method, it was shown that there were 271 common differentially expressed miRNAs in the recurrence and non-recurrence groups of steroid (drugT) and tacrolimus (drugF) treatment of MCD. The number of specific differentially expressed miRNAs between the recurrence and non-recurrence groups in steroid treatment was 307, and the number of specific 480 differentially expressed miRNAs between the recurrence and non-recurrence groups in tacrolimus treatment (as shown in A in Figure 2 ). It can also be divided into four sets according to the up-regulation and down-regulation of miRNAs in the steroid (drugT) and tacrolimus (drugF) treatment groups. The common and differentially expressed miRNAs in each group are as shown in B in Figure 2 ). Heat maps of their expression in the samples were drawn respectively according to the specific differentially expressed miRNAs in the steroid group, the specific differentially expressed miRNAs in the tacrolimus group, and the common differentially expressed miRNAs in the tacrolimus group and the steroid group, as shown in C, D, and E in Figure 2 ). Among them, miR-490-5p, miR-503-5p, miR-660-3p, and miR-3198 are 4 miRNAs with significantly different expression among the common differentially expressed miRNAs. Therefore, further verification and functional studies were carried out on these 4 miRNAs, and their sequences are shown in Table 4.

[0068] Table 4 Sequences of 4 miRNAs

[0069] Sequence Name Serial Number Sequence miR-490-5p SEQ ID NO.27 CCAUGGAUCUCCAGGUGGGU miR-503-5p SEQ ID NO.28 UAGCAGCGGGAACAGUUCUGCAG miR-660-3p SEQ ID NO.29 ACCUCCUGUGUGCAUGGAUUA miR-3198 SEQ ID NO.30 GUGGAGUCCUGGGGAAUGGAGA

[0070] 3) miRNA real-time RT-PCR detection markers

[0071] A. miRNA real-time RT-PCR primer sequences

[0072] Since the 5' ends of the reverse transcription products by the tailing method are all universal sequences, the q-PCR reverse primers are

[0073] the same, and all use the universal primers provided in the kit without the need to design them by oneself, while the forward primers need to be designed according to different miRNA sequences.

[0074] Table 5 Primer sequences

[0075] miRNA Name Serial Number miRNA qpcr Forward Primer Sequence miR-490-5p SEQ ID NO.1 ACCATGGATCTCCAGGTGGGTC miR-660-3pA SEQ ID NO.2 ACCTCCTGTGTGCATGGATTA miR-503-5p SEQ ID NO.3 GTAGCAGCGGGAACAGTTCTGCAG miR-3198 SEQ ID NO.4 GGTGGAGTCCTGGGGAATGGAGA

[0076] B. RT-PCR detection markers

[0077] The process of miRNA fluorescence quantitative PCR is similar to that of ordinary mRNA. For real-time fluorescence quantitative PCR, TB Green enzyme from Takara is used, and the reaction system is as follows:

[0078] Table 6 Reaction system

[0079] Reagent Name Liquid Addition Volume (μL / well) TBGreen Advantage Premix(2X) 7.5 μL Forward Primer 0.3 μL Reverse Primer 0.3 μL <![CDATA[ddH2O]]> 5 μL Diluted Reverse Transcription Product 2.0 μL Total Volume 15 μL

[0080] Dispense the reaction solution into a 96-well plate, then add the cDNA sample, seal it with a sealing film, and after low-speed centrifugation in a centrifuge, simultaneously use the U6 gene as an internal reference, and make 3 replicates for each sample, and put it into a fluorescence quantitative PCR instrument for detection.

[0081] The reaction conditions of this method: pre-denaturation reaction at 95°C for 10 sec; reaction at 95°C for 5 sec and 60°C for 20 sec, 40 cycles; melting curve: reaction at 95°C for 60 sec, 55°C for 30 sec, 95°C for 30 sec.

[0082] Real-time fluorescence quantitative PCR technology adds a fluorescent group to the PCR reaction system and uses the accumulation of fluorescent signals to monitor the entire PCR process in real time. The Ct value refers to the number of cycles experienced by the fluorescent signal in each reaction tube to reach the set threshold. The more the initial copy number of the target miRNAs, the smaller the Ct value, and vice versa. When the amplification efficiency of the target miRNAs and the internal reference is the same, the quantitative △Ct of the target miRNAs relative to the internal reference can be directly obtained as △Ct = Ct_target - Ct_internal_reference, and △△Ct = △Ct_case - △Ct_control. Calculate the 2-△△Ct value, use graphpad prism 8 to plot the graph, and analyze and compare the relative expression levels of miR-490-5p, miR-503-5p, miR-660-3p, and miR-3198 in peripheral blood mononuclear cells of MCD patients treated with hormones. There are 20 peripheral blood mononuclear cell samples from MCD patients in the hormone treatment recurrence and non-recurrence groups respectively. The results are as Figure 3 shown.

[0083] Figure 3 It is shown that the expressions of miR-490-5p, miR-503-5p, miR-660-3p and miR-3198 all decreased in the recurrence group (P < 0.05).

[0084] In the present invention, miRNA sequencing was performed on a total of 28 mononuclear cell samples before treatment of recurrence and non-recurrence patients in the MCD hormone treatment group and the TAC treatment group. The sample size of the MCD hormone treatment group was expanded to verify miRNAs with different expressions and the same expression trends in both groups. Since the number of patients treated with TAC alone was small and the sample size was insufficient, only the hormone treatment group was verified with an expanded sample. The verification results showed that the expressions of the 4 miRNAs, miR-490-5p, miR-503-5p, miR-660-3p and miR-3198, decreased in the recurrence group, suggesting that they may have an important impact on the recurrence of MCD and have the potential to be used as biomarkers for early diagnosis of MCD recurrence.

[0085] Example 2

[0086] Example 2 of the present invention detected the roles played by miR-490-5p, miR-503-5p, miR-660-3p and miR-3198 in the recurrence of MCD. The specific steps are as follows:

[0087] (1) Expression of miR-490-5p, miR-503-5p, miR-660-3p and miR-3198 in HK-2 and podocytes treated with LPS

[0088] 1), Coating of podocyte culture flasks and culture dishes

[0089] For better attachment and growth of podocytes, before inoculating podocytes, the cell culture flask or dish needs to be coated with type I collagen diluted with 20 mM acetic acid solution at a final added amount of 5 μg / cm 2 and placed in an incubator at 37°C for 3 hours. After rinsing twice with PBS, it can be used, or it can be air-dried and sealed with a sealing film and stored briefly in a 4°C refrigerator for later use.

[0090] 2) Cell culture method for mouse podocytes MPC5

[0091] Select an immortalized MPC-5 mouse podocyte line with a lower passage number of cryopreservation and resuscitate it in an incubator at 33°C. Culture it with RIMP1640 medium containing 10% FBS and 10 U / ml interferon-γ to inhibit its differentiation and allow it to grow and proliferate. After subculturing twice at 33°C and when the cell state is good, transfer the cells to an incubator at 37°C to differentiate and mature. Generally, it takes 10 - 14 days for podocytes to differentiate and mature. During this process,

[0092] the culture medium needs to be changed every other day, the cell state needs to be observed daily, and subculturing is carried out irregularly according to the different growth rates. At the same time, the culture medium used is RIMP1640 medium containing 10% FBS without interferon-γ. The differentiated and mature podocytes can be used for various experiments.

[0093] 3. HK-2 cell culture

[0094] HK-2 cells do not require coating the cell culture dish with collagen. Directly resuscitate the cells in an incubator at 37°C with 5% CO2 and culture them with RIMP1640 medium containing 10% FBS. When the cells grow to 80% - 90% confluence, subculture them. After subculturing twice after resuscitation and when the cell state is good, they can be used for related experiments.

[0095] (2) Expression of miR-490-5p / miR-503-5p / miR-660-3p / miR-3198 in LPS-treated HK-2 and podocytes

[0096] Treat podocytes and HK-2 cells with LPS at concentrations of 25 μg / ml and 2 μg / ml respectively, collect the cells at two time points of 6 and 24 hours, extract RNA, and perform q-PCR detection. The results are as Figure 4 shown.

[0097] Figure 4It was shown that the expressions of these four miRNAs in podocytes and HK-2 cells in the LPS treatment group were downregulated compared with those in the control group, which was consistent with the previous miRNA sequencing results showing the downregulation of miR-490-5p, miR-503-5p, miR-660-3p, and miR-3198 in the recurrent MCD group.

[0098] (3) Transfection of miRNA by liposome method

[0099] To further investigate the roles of these four miRNAs in the inflammatory response activated by LPS, these four miRNA mimics were transfected into these two cell lines respectively, and the specific steps were as follows:

[0100] 1) Seed an appropriate amount of cells into a six-well plate so that the density can reach about 50% the next day.

[0101] 2) Preparation of solution A: Add 50 μL of Opti-MEM to a 1.5 mL EP tube, and then add 100 pmol of miRNA (see Table 6).

[0102] 3) Preparation of solution B: Add 50 μL of Opti-MEM to a 1.5 mL EP tube, and then add 5 μL of Lipofectamine 3000.

[0103] 4) Mix solution A and solution B and incubate for 15 min.

[0104] 5) Change the medium of the cells to be transfected. It is best not to add antibiotics to the medium.

[0105] 6) Drop the incubated mixture of solution A and solution B into the wells to be transfected, gently shake the six-well plate to mix evenly, culture in an incubator at 37 °C, and extract RNA.

[0106] Table 7 miRNA mimic sequences

[0107]

[0108] (4) Reverse transcription

[0109] 1) Use the Takara reverse transcription kit. First, remove genomic DNA. Prepare the reaction premix on ice according to the components in Table 8 to prevent losses during the experiment and ensure the accuracy of the experiment. Prepare the Master Mix by appropriately increasing the amount by 1 to 2 according to the number of reactions required, aliquot it into each RNase-Free reaction tube, and finally add up to 1 μg of RNA sample. After centrifugation, place it at room temperature for 5 min or at 42 °C for 2 min.

[0110] Table 8 Premix

[0111] Reagent Volume 5×gDNA Eraser Buffer 2 μL gDNA Eraser 1 μL Total RNA 1 μg <![CDATA[RNaseFreedH2O]]> Make up to 10 μL

[0112] 2) Prepare the reaction premix on ice according to the components in Table 9. Appropriately increase the amount by 1 to 2 according to the number of reactions required to prepare the MasterMix. After centrifugation, incubate at 37°C for 15 minutes, then at 85°C for 5 seconds to complete reverse transcription. The cDNA can be placed in a 4°C refrigerator for a short time. If long-term storage is required, it should be placed in a -20°C refrigerator.

[0113] Table 9 Premix

[0114]

[0115]

[0116] 3) q-PCR experiment:

[0117] Dilute the reverse-transcribed cDNA reaction solution with double-distilled water at a ratio of 1:20. Prepare the reaction solution on ice according to the following components, and appropriately increase the amount by 1 to 2 according to the number of reactions required.

[0118] Table 10 Reaction Solution

[0119]

[0120] Add the prepared reaction solution into a 96-well plate, seal it with a film, centrifuge at low speed for 1 minute, and then place it in a fluorescence quantitative PCR instrument. Use the q-PCR method to verify the overexpression efficiency of 4 miRNAs. The results are as Figure 5 shown.

[0121] Figure 5 It shows that these 4 miRNAs have high expression efficiency in these two cell lines, and the P value < 0.05.

[0122] (5) Further, after transfection for 48 hours respectively, treat the cells with 2 μg / ml LPS for 24 hours, then collect the cells for q-PCR detection to detect the expression of IL-6, TNF-α and IL-1β genes. The primers used are shown in Table 10. The results are as Figure 6 shown.

[0123] Figure 6 It shows that compared with the transfection control group, the expression of these factors in the mimic transfection group has no obvious change; compared with the control group, the expression of these genes is significantly up-regulated after LPS treatment. The q-PCR results of HK-2 cells transfected with these 4 miRNA mimics after LPS treatment show that only the overexpression of miR-490-5p helps to inhibit the inflammatory response activated by LPS, while the other three miRNAs have no significant effect on the expression of LPS-activated inflammatory genes.

[0124] (6) miR-490-5p in podocytes inhibits the mRNA expression of LPS-activated inflammation-related genes:

[0125] Since miR-503-5p / miR-660-3p / miR-3198 had little effect on the expression of LPS-activated inflammatory factors in HK-2, while miR-490-5p could significantly inhibit the expression of related inflammatory factors, miR-490-5p was overexpressed in mouse podocytes. Cells were harvested 24 h after treatment with 25 μg / ml LPS for 48 h after transfection. The expression of mRNA of IL-6, MCP-1, CD80 and ICAM-1 was detected by q-PCR. The results were as Figure 7 shown.

[0126] Figure 7 It was shown that compared with the transfection control group, the expression of these factors did not change significantly in the miR-490-5p mimic transfection group; compared with the control group, the expression of these genes was significantly up-regulated in the LPS treatment group; the q-PCR results showed that the LPS-activated inflammatory factors were inhibited in the miR-490-5p overexpression group, which was consistent with the experimental results in HK-2 cells, suggesting that miR-490-5p may play an important role in inhibiting the LPS-activated inflammatory response.

[0127] Table 11 Primer sequences

[0128]

[0129]

[0130] (7) Overexpression of miR-490-5p in podocytes and HK-2 cells inhibits the expression of LPS-activated inflammatory proteins:

[0131] 1) Protein extraction

[0132] For the cells in the six-well plate, aspirate the medium, wash twice with PBS, add 100 μL of protein lysate containing protease inhibitor, phosphatase inhibitor and PMSF and place on ice; scrape the protein with a protein scraper and transfer it to a 1.5 mL centrifuge tube; lyse on ice for half an hour, take it out every once in a while and invert and mix well for sufficient lysis; centrifuge at low temperature for 10 min, transfer the supernatant to a new centrifuge tube; add 20 μL of 5X protein loading Buffer and mix well; after the temperature of the metal bath reaches 100 °C, put the centrifuge tube in and boil for 8 min to denature the protein; the denatured protein sample is stored in a -80 °C refrigerator.

[0133] 2) Western Blot

[0134] Install the prepared 10% protein gel in the electrophoresis tank and add electrophoresis buffer; pull out the electrophoresis comb, and sequentially add protein Marker and denatured protein samples into the sample wells; turn on the power of the protein electrophoresis instrument, set the voltage to 80V constant voltage to start electrophoresis. When the bands of the protein Marker are clearly separated, the voltage can be adjusted to 120V to continue electrophoresis to further separate the bands; according to the indication of the protein Marker, stop electrophoresis when the protein samples are separated to an appropriate extent and the target protein does not run out. Use a gel stripping plate to strip the protein gel and lay it flat on the filter paper required for membrane transfer. Cut a PVDF membrane of appropriate size and activate it with methanol solution. Cover the PVDF membrane flat on the protein gel, drive away the excess bubbles, tighten the membrane transfer clip, place it in the membrane transfer tank in the correct way, add cold membrane transfer solution, connect the power supply, set the appropriate membrane transfer voltage and membrane transfer time to perform membrane transfer. During membrane transfer, place the membrane transfer instrument in ice to prevent the temperature of the membrane transfer solution from being too high; after membrane transfer is completed, take out the PVDF membrane and block it in 5% skim milk for 1h; dilute the primary antibody with the primary antibody diluent according to the dilution ratio in the antibody instruction manual, and wash the blocked PVDF membrane with TBST to wash away the milk during the blocking process. Cut the protein bands of different molecular weights according to the position indicated by the protein Marker, add the corresponding antibodies to different target bands, and place them in a shaker at 4°C to incubate overnight; the next day, recover the primary antibody and wash it 3 times with TBST, 10 minutes each time; add the secondary antibody diluted with 5% skim milk and incubate for 1h; wash with TBST 3 times, 10 minutes each time; place the PVDF membrane in a chemiluminescent imaging instrument and drop the freshly prepared ECL developing solution, and set the appropriate exposure time for exposure.

[0135] Adopt the above method to overexpress miR-490-5p in HK-2 and podocytes respectively. After LPS treatment for 24 hours, collect cells to extract proteins, and detect the protein expression levels of IL-6, TNF-α and phosphorylated NF-κBp65 (p-p65) by WB. The results are as Figure 8 shown.

[0136] Figure 8 It shows that compared with the transfection control group, there is no significant difference in the expression of these factor proteins in the miR-490-5p overexpression group (TNF-α is not expressed or expressed very low in podocytes). After LPS treatment, the expression of these factors in the transfection control group increased significantly, and the protein expression of these inflammatory genes in the miR-490-5p transfection group was inhibited, which was consistent with the previous q-PCR results.

[0137] The present invention first demonstrates that the expressions of miR-490-5p, miR-503-5p, miR-660-3p and miR-3198 are decreased in LPS-treated podocytes and HK-2 cells, and these miRNAs also show decreased expressions in peripheral blood mononuclear cells of patients in the relapse group of MCD. The downregulation of these four miRNAs after LPS treatment suggests that they may play certain functions in podocytes and HK-2 cells in response to inflammatory reactions. The present invention discovers that LPS induces the nuclear translocation of nuclear factor-κB (NF-κB) by activating the MyD88-dependent TLRs signaling pathway, resulting in a significant increase in the expressions of inflammatory factors such as IL-6 and MCP-1 in podocytes. Therefore, the present invention uses LPS to treat podocytes and HK-2 cells to establish an in vitro model of minimal change nephrotic syndrome, overexpresses these four miRNAs, and detects the expressions of inflammatory factors. It is found that miR-490-5p can significantly inhibit the inflammatory reaction activated by LPS, thereby playing a role in protecting podocytes and HK-2 cells.

[0138] The above are only the preferred embodiments of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A miRNA diagnostic marker related to the recurrence of minimal change nephropathy, characterized in that, The miRNA diagnostic markers include one or more of miR-490-5p, miR-503-5p, miR-660-3p, and miR-3198.

2. The miRNA diagnostic marker related to the recurrence of minimal change nephropathy according to claim 1, wherein The sequences of miR-490-5p, miR-503-5p, miR-660-3p, and miR-3198 are shown in the following table: 。 3. The miRNA diagnostic marker related to the recurrence of minimal change nephropathy according to claim 1, characterized in that, The expressions of miR-490-5p, miR-503-5p, miR-660-3p, and miR-3198 are decreased in patients with recurrent minimal change nephropathy.

4. The miRNA diagnostic marker related to the recurrence of minimal change nephropathy according to claim 1, characterized in that, The miRNA diagnostic marker includes miR-490-5p.

5. The miRNA diagnostic marker related to the recurrence of minimal change nephropathy according to claim 4, characterized in that, The miR-490-5p can significantly inhibit the inflammatory response activated by LPS.

6. Use of the miRNA diagnostic marker related to recurrent minimal change nephropathy according to any one of claims 1 to 5 in the preparation of a detection product for recurrent minimal change nephropathy.

7. A primer set for detecting miRNAs related to the recurrence of the minimal change nephropathy described in claim 1, characterized in that, It includes one or more of the following primer sequences: 。 8. A product for detecting the recurrence of minimal change nephropathy, characterized in that, The detection product for recurrent minimal change nephropathy includes the primer group according to claim 7.

9. Use of the miRNA diagnostic marker related to recurrent minimal change nephropathy according to claim 1 in the preparation of a drug for preventing recurrent minimal change nephropathy.

Images