Application of SNP (Single Nucleotide Polymorphism) marker site in evaluating waist angle width of Dabie mountain cattle

By applying the SNP marker site at chromosome 122442807 of the cattle reference genome ARS1.2 in Dabie Mountain cattle, GG, GA or AA genotypes were detected, and the early accurate selection of the wide trait of the horn of the bullock in Dabie Mountain was achieved, which solved the accuracy of the selection and breeding of the cattle in Dabie Mountain and improved the growth and development and reproduction performance.

CN120249510AActive Publication Date: 2025-07-04INST OF ANIMAL HUSBANDRY & VETERINARY MEDICINE ANHUI ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510676948.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-26
Publication Date
2025-07-04
Estimated Expiration
2045-05-26

AI Technical Summary

Technical Problem

The existing technology has not yet clarified the key genes and molecular markers of the wide waist horn of the Dabie Mountain bull, which has led to the inability to accurately carry out efficient breeding of Dabie Mountain bulls based on molecular markers, affecting its growth, development and reproduction performance.

Method used

The SNP marker site located at position 122442807 of chromosome 2 in the cattle reference genome ARS1.2 was used to detect GG, GA or AA genotypes, and individuals of GA and AA genotypes were eliminated generation by generation, increasing the frequency of GG genotypes, and PCR amplification and genotype identification were performed using primer pairs and kits to achieve early and accurate selection of the wide traits of the bullock waist in Dabie Mountain.

Benefits of technology

Improve the breeding efficiency of the wide horn trait of the Dabie Mountains, reduce the difficulty of calving, improve growth and development and reproduction performance, and enhance the competitiveness of the beef cattle industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249510A_ABST
    Figure CN120249510A_ABST
Patent Text Reader

Abstract

The invention provides application of an SNP (Single Nucleotide Polymorphism) marker site in evaluating waist angle width of Dabie mountain cattle, and belongs to the technical field of molecular markers. According to the invention, the genotype polymorphism of the 122442807th site of the chromosome 2 of the cattle reference genome ARS1.2 can be used for evaluating the waist angle width of the Dabie mountain cattle for the first time, so that the early-stage accurate selection of the waist angle width character of the Dabie mountain cattle is realized. When the SNP marker site provided by the invention is used for evaluating the waist angle width of the Dabie mountain cattle, GA and AA genotype individuals can be eliminated generation by generation, and the frequency of the dominant genotype GG of the waist angle width character can be increased generation by generation, so that the waist angle width is improved, and the breeding efficiency of the growth and development character and the reproduction character of the Dabie mountain cattle is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers, and particularly relates to the application of SNP marker loci in evaluating the hip width of Dabieshan cattle. Background Art

[0002] Dabieshan cattle are of draft and draft-meat dual-purpose types, mainly produced in the Dabieshan region, and are local yellow cattle breeds in Anhui Province included in the national livestock and poultry breed resource catalog. Dabieshan cattle are mainly raised in a free-range and grazing mode, with advantages such as being resistant to roughage, heat-resistant, agile in movement, and having tender meat. However, they also have prominent disadvantages such as relatively small body size and low slaughter rate. Limited by the backward breeding and selection technology of traditional breeding, the production efficiency of Dabieshan cattle has not been fully exerted, and the utilization efficiency of germplasm resources is low.

[0003] The rapid development of high-throughput genotyping technology has increased the feasibility of using genome-wide association studies (GWAS) for beef cattle genetic improvement. GWAS is widely used to identify genetic variations (single nucleotide polymorphisms (SNPs)) associated with specific phenotypic traits, and is an important means to mine QTLs and candidate genes related to important economic traits in livestock and poultry. The hip width of cattle refers to the maximum horizontal width of the outer edges of the two hip angles, also known as the cross width. Hip width is an important indicator in cattle body measurement, usually measured with a ruler or caliper. The size of the hip width reflects the angular width on both sides of the cattle's waist, and is an important parameter for judging the body type characteristics of cattle. The specific measurement method of hip width is to measure the maximum horizontal width from the outer edges of the two hip angles of the cattle. This indicator is of great significance in the body type identification and breeding of cattle, and can help evaluate the growth and development and body type characteristics of cattle, and is also closely related to the ease of calving. For example, a larger hip width means that the cattle have a wider pelvis, which is beneficial for the delivery of the fetus and reduces the risk of dystocia during the reproduction of cows; during the fattening process of beef cattle, the hip width is closely related to the development degree of the hindquarter muscles of the cattle. Usually, cattle with a larger hip width have more developed hindquarter muscles and higher meat production. Therefore, accurately screening out individuals of Dabieshan cattle with genetic potential for a larger hip width is of great significance for improving the overall production performance of the Dabieshan cattle population. However, there is still a large gap in the research on molecular markers related to the hip width of Dabieshan cattle. The prior art has not clarified the key genes and molecular markers of this important trait of Dabieshan cattle hip width, resulting in the inability to accurately carry out efficient breeding work of Dabieshan cattle based on molecular markers. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide the application of SNP marker loci in evaluating the hip width of Dabieshan cattle, which can increase the frequency of the advantageous allele of the SNP marker loci generation by generation by preferentially selecting the advantageous allele, improve the growth traits of Dabieshan cattle, reduce the degree of calving dystocia, accelerate the progress of genetic improvement of Dabieshan cattle, and improve the economic benefits of beef cattle breeding.

[0005] To achieve the above-mentioned invention objectives, the present invention provides the following technical solutions: The present invention provides an application of an SNP marker locus in evaluating the hip angle width of Dabieshan cattle. The SNP marker locus is located at the base position 122442807 of chromosome 2 of the bovine reference genome ARS1.2, and there is a polymorphism of G / A.

[0006] Preferably, the genotypes of the SNP marker locus are GG, GA or AA, and the hip angle width value of the GG genotype > the hip angle width value of the GA genotype > the hip angle width value of the AA genotype.

[0007] The present invention also provides a primer pair for detecting the SNP marker locus. The nucleotide sequences of the primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively; the SNP marker locus is located at the base position 122442807 of chromosome 2 of the bovine reference genome ARS1.2, and there is a polymorphism of G / A.

[0008] The present invention also provides a kit for detecting the SNP marker locus, and the kit includes the above-mentioned primer pair.

[0009] The present invention also provides an application of the above-mentioned primer pair or the above-mentioned kit in evaluating the hip angle width of Dabieshan cattle.

[0010] The present invention also provides a method for evaluating the hip angle width of Dabieshan cattle, including the following steps: using the above-mentioned primer pair or using the above-mentioned kit to perform PCR amplification on the genomic DNA of the sample to be tested to obtain an amplification product; identifying the genotype of the SNP marker locus in the amplification product; the hip angle width value of the GG genotype > the hip angle width value of the GA genotype > the hip angle width value of the AA genotype.

[0011] Preferably, the sample to be tested includes a blood sample; the method of identification includes sequencing.

[0012] Preferably, the PCR amplification program is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 5 min; preservation at 4°C.

[0013] The present invention also provides an application of any one of the following in the detection of growth and development traits, evaluation of calving difficulty or breeding of Dabieshan cattle: (1) the above-mentioned SNP marker locus; (2) the above-mentioned primer pair; (3) the above-mentioned kit; (4) the above-mentioned method.

[0014] Advantages of the present invention: The present invention first proposes that the genotype polymorphism at position 122442807 on chromosome 2 of the bovine reference genome ARS1.2 can be used to evaluate the hip width of Dabieshan cattle, thereby achieving early and accurate selection of the hip width trait of Dabieshan cattle. By using the SNP marker locus provided by the present invention to evaluate the hip width of Dabieshan cattle, individuals with GA and AA genotypes can be eliminated generation by generation, the frequency of the advantageous genotype GG for the hip width trait can be increased generation by generation, thereby improving the hip width, enhancing the growth traits of Dabieshan cattle, reducing the dystocia degree during calving, accelerating the genetic improvement progress of Dabieshan cattle, and improving the economic benefits of beef cattle breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 FIG. is the Manhattan plot of the genome-wide association analysis of the hip width trait of Dabieshan cattle; Figure 2 FIG. is the QQ plot of the genome-wide association analysis of the hip width trait of Dabieshan cattle; Figure 3 FIG. shows the hip width of Dabieshan cattle corresponding to different genotypes of the nucleotide at position 122442807 on chromosome 2, where * indicates p < 0.05 and **** indicates p < 0.0001. DETAILED DESCRIPTION OF THE INVENTION

[0016] The present invention provides an application of an SNP marker locus in evaluating the hip width of Dabieshan cattle. The SNP marker locus is located at the base position 122442807 on chromosome 2 of the bovine reference genome ARS1.2, and there is a G / A polymorphism.

[0017] The SNP marker locus of the present invention is obtained by genome-wide association analysis of the hip width trait of Dabieshan cattle. The genotypes of the SNP marker locus are GG, GA or AA, and the hip width value of the GG genotype > the hip width value of the GA genotype > the hip width value of the AA genotype. In the present invention, the SNP marker locus is the Matrilin-1 (MATN1) gene, and the nucleotide sequence is as shown in SEQ ID NO.3 (positions 122442657 - 122442957), and there is a G / A polymorphism at the base position 122442807. The present invention first identifies the MATN1 gene as a candidate gene affecting the hip width trait of Dabieshan cattle. By deeply exploring the internal relationship between the MATN1 gene and the hip width of Dabieshan cattle and developing related specific molecular markers, early and accurate selection of the hip width trait of Dabieshan cattle can be achieved.

[0018] The present invention also provides a primer pair for detecting SNP marker sites, and the nucleotide sequences of the primer pair are CATCAAGTCCGTCAGAAAGGTTTCTT (SEQ ID NO.1) and AACCAAGATCCCACATGCCATAC (SEQ ID NO.2); the SNP marker site is located at the 122442807th base of chromosome 2 of the bovine reference genome ARS1.2, and there is a polymorphism of G / A.

[0019] The present invention also provides a kit for detecting SNP marker sites, and the kit includes the above-mentioned primer pair.

[0020] The present invention also provides the application of the above-mentioned primer pair or the above-mentioned kit in evaluating the loin angle width of Dabieshan cattle.

[0021] The present invention also provides a method for evaluating the loin angle width of Dabieshan cattle, including the following steps: using the above-mentioned primer pair or using the above-mentioned kit to perform PCR amplification on the genomic DNA of the sample to be tested to obtain an amplification product; identifying the genotype of the SNP marker site in the amplification product; the loin angle width value of the GG genotype > the loin angle width value of the GA genotype > the loin angle width value of the AA genotype.

[0022] In the present invention, the sample to be tested preferably includes a blood sample; the method of identification preferably includes a sequencing method. In the present invention, the PCR amplification program is preferably: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 5 min; storage at 4°C; the reaction system of the PCR amplification is preferably: based on a reaction system of 10 μl, 1 μl of genomic cDNA, 0.6 μl of each of the upstream and downstream primers, 5 μl of 2×probe mixa solution, and sterile water is added to make up to 10 μl.

[0023] The present invention also provides the application of any one of the following in the detection of growth and development traits, evaluation of calving difficulty or breeding of Dabieshan cattle: (1) the above-mentioned SNP marker site; (2) the above-mentioned primer pair; (3) the above-mentioned kit; (4) the above-mentioned method.

[0024] Using the SNP marker loci provided by the present invention to evaluate the hip width of Dabieshan cattle can eliminate individuals with GA and AA genotypes generation by generation, increase the frequency of the dominant genotype GG for hip width trait generation by generation, thereby improving hip width and enhancing the breeding efficiency of growth and development traits and reproductive traits of Dabieshan cattle. The present invention applies SNP marker loci with significant effects to beef cattle molecular breeding, which can effectively improve the hip width trait, thereby increasing the production efficiency of beef cattle and enhancing the core competitiveness of the beef cattle industry. Compared with traditional breeding methods, the technical solution of the present invention can break through the interference of environmental factors, greatly improve the breeding efficiency and accuracy, and provide strong technical support for the cultivation of excellent varieties of Dabieshan cattle and the development of the industry.

[0025] The technical solutions provided by the present invention will be described in detail below in conjunction with embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0026] In the following embodiments, unless otherwise specified, all are conventional methods.

[0027] In the following embodiments, the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0028] Example 1 1. Phenotypic measurement: The experimental cattle population used all came from 515 Dabieshan cattle of Wanjia Modern Agriculture Co., Ltd. in Taihu County, Anhui Province. After weaning, they were uniformly fed and managed, and were slaughtered in batches after being fattened to 30 months old. Body measurements were carried out on the experimental cattle according to the "Technical Specification for Linear Evaluation of Beef Cattle Body Type (GB / T 27643-2011)", and phenotypic data of hip width trait were collected, that is, the maximum horizontal width of the outer edges of the two hips.

[0029] 2. Blood sample collection: Jugular vein blood collection was uniformly used for the individuals to be tested, and it was stored in an EDTA anticoagulant tube and placed in a -20°C refrigerator for later use.

[0030] 3. 100K chip genotyping: The above frozen blood samples were thawed at room temperature, and genomic DNA of the individuals to be tested was extracted from whole blood according to the standard phenol-chloroform method. The ratios of A260 / 280 and A260 / 230 were detected with a Nanodrop-ND1000 spectrophotometer, and electrophoresis was carried out on a 1% agarose gel to detect the concentration and quality of DNA.

[0031] The DNA samples were sent to Neogene Biotechnology (Shanghai) Co., Ltd. for genotyping of the individuals to be tested based on a 100K chip. The PLINKv1.90 software was used to perform quality control on the individual genotypes, and individuals with a detection rate lower than 90%, a minor allele frequency lower than 5%, and a Hardy-Weinberg equilibrium significance level higher than 1×10-6 SNPs, and finally 67,943 SNPs were retained.

[0032] 4. Genome-wide association study: Considering factors such as gender, year of birth, and slaughterhouse as fixed effects, and factors such as fattening days and incoming weight as covariates, phenotypic correction was performed. Based on the data of the hip angle width trait and genotypes of 515 Dabieshan cattle, a genome-wide association study was carried out using the mixed linear model (MLM) in the GCTA software. Set 1×10 -6 As the genome-wide significant level threshold for the GWAS analysis of the hip angle width trait in Dabieshan cattle.

[0033] The results of the GWAS analysis are as Figure 1 and Figure 2 shown. There is a SNP candidate locus at 122,442,807 bp on chromosome 2 that significantly affects the hip angle width trait in Dabieshan cattle. Based on the ARS1.2 genome annotation file of Ensembl, the functional genes within 1 Mb upstream and downstream of the SNP locus were annotated, and the candidate gene for this SNP locus was determined to be MATN1. Subsequently, by preferentially selecting this SNP locus, the hip angle width trait of Dabieshan cattle can be improved, and the breeding process of growth, development, and reproductive traits of Dabieshan cattle can be accelerated.

[0034] 5. Association analysis between different genotypes and hip angle width trait: To detect the effect of different genotypes of the SNP molecular marker at 122,442,807 bp on chromosome 2 on the hip angle width trait, a one-way analysis of variance between groups of the hip angle width trait with different genotypes at position 122,442,807 on chromosome 2 was performed using the anova() function in R language. The results are shown in Table 1. There are significant differences in the hip angle width among individuals with different genotypes. The phenotypic value of the hip angle width of individuals with the homozygous GG genotype is higher than that of individuals with the GA and AA genotypes, and the phenotypic value of the hip angle width of individuals with the GA genotype is higher than that of individuals with the AA genotype.

[0035] Table 1 Phenotypic values of hip angle width corresponding to different genotypes (expressed as mean ± standard deviation)

[0036] Example 2 A method for evaluating the hip angle width of Dabieshan cattle, the steps are as follows: Extract genomic DNA from bovine blood samples as follows: For the individuals to be tested, collect jugular vein blood uniformly, store it in an EDTA anticoagulant tube, and place it in a -20°C refrigerator for later use; thaw the above frozen blood samples at room temperature, extract the genomic DNA of the individuals to be tested from whole blood according to the standard phenol-chloroform method, and detect the ratios of A260 / 280 and A260 / 230 using a Nanodrop-ND1000 spectrophotometer. The A260 / A280 ratio should be greater than 1.8 (for DNA), and the A260 / 230 should be between 1.8 and 2.2. Perform electrophoresis on a 1% agarose gel, and judge the concentration and quality of DNA by observing the brightness, integrity, etc. of the DNA bands on the gel. If the DNA bands are bright, clear and have no obvious trailing or other abnormal phenomena, it indicates that the DNA quality is good, the concentration reaches a certain level, and meets the requirements of subsequent experimental applications.

[0037] Use the upstream primer primer-F: 5’-CATCAAGTCCGTCAGAAAGGTTTCTT-3’ and the downstream primer primer-R: 5’-AACCAAGATCCCACATGCCATAC-3’ to perform PCR amplification on the genomic DNA of bovine blood samples. The PCR amplification program is pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 5 min; store at 4°C. The reaction system (10 μl) for PCR amplification is 1 μl of genomic cDNA, 0.6 μl of each of the upstream and downstream primers, 5 μl of 2×probe mixa solution, and make up to 10 μl with sterile water to obtain the amplification product; Sequence the amplification product to identify the genotype of the nucleotide at position 122442807 on chromosome 2; the value of the hip width of the G / G genotype > the value of the hip width of the G / A genotype > the value of the hip width of the A / A genotype.

[0038] Example 3 Collect 80 Dabieshan cattle from Wanjia Modern Agriculture Co., Ltd. in Taihu County, Anhui Province. After weaning, carry out unified feeding management. 30 days after weaning, use the method for evaluating the hip width of Dabieshan cattle described in Example 2 to evaluate and classify the hip widths of 80 Dabieshan cattle respectively. The results show that: the genotypes of the SNP marker loci of 2 cattle are GG, the genotypes of the SNP marker loci of 29 cattle are GA, and the genotypes of the SNP marker loci of 49 cattle are AA. Mark the genotypes of the SNP marker loci of 80 Dabieshan cattle respectively.

[0039] After fattening to 30 months of age, slaughter them in batches, carry out body measurement on the experimental cattle according to the "Technical Specification for Linear Evaluation of Beef Cattle Body Type GB / T 27643-2011", and collect the phenotypic data of the hip width trait, that is, the horizontal maximum width of the outer edges of the two hips. The results are asFigure 3 As shown, the hip width of the Dabieshan cattle with the SNP marker locus genotype of GG > the hip width of the Dabieshan cattle with the SNP marker locus genotype of GA > the hip width of the Dabieshan cattle with the SNP marker locus genotype of AA, and there are significant or extremely significant differences in the phenotypic value data of hip width among groups.

[0040] Example 4 Statistics on the distribution of allele frequencies of cattle populations from different regions at position 122442807 on chromosome 2 from the BGVD database http: / / animal.omics.pro / code / index.php / BosVar are shown in Table 2. Among them, brown represents the reference allele Ref: T(A), and the variant allele Alt: C(G). In the "European_taurine(38)" European common cattle population, the frequency of the variant allele is 0.342, indicating that 34.2% of the individuals in this population carry this variant allele. In the "Chinese_indicine (19)" Chinese southern zebu population, the frequency of the variant allele is 0.000, indicating that this variant allele was not detected in this population. There are significant differences in the allele frequencies at locus 122442807 on chromosome 2 among Eurasian cattle populations, and it is consistent with the phenotypic trend of smaller body sizes in Chinese cattle.

[0041] Table 2 Distribution of allele frequencies of nucleotide at position 122442807 on chromosome 2 in 6 ancestral cattle populations in the BGVD database

[0042] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can still be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Use of SNP marker loci in evaluating the hip width of Dabieshan cattle, characterized in that, The SNP marker locus is located at the base position 122442807 on chromosome 2 of the bovine reference genome ARS1.2, and there is a G / A polymorphism.

2. The application according to claim 1, wherein The genotypes of the SNP marker locus are GG, GA or AA, and the loin angle width value of the GG genotype > the loin angle width value of the GA genotype > the loin angle width value of the AA genotype.

3. A method for evaluating the hip width of Dabieshan cattle, characterized in that, It includes the following steps: using primer pairs with nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2 respectively, performing PCR amplification on the genomic DNA of the test sample to obtain an amplification product; identifying the genotype of the SNP marker locus in the amplification product; the loin angle width value of the GG genotype > the loin angle width value of the GA genotype > the loin angle width value of the AA genotype; the SNP marker locus is located at the base position 122442807 on chromosome 2 of the bovine reference genome ARS1.2, and there is a G / A polymorphism.

4. The method according to claim 3, characterized in that The test sample includes a blood sample; the identification method includes a sequencing method.

5. The method according to claim 3, wherein The PCR amplification program is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 5 min; storage at 4°C.

6. Use of any one of the following in the evaluation of calving ease caused by the width of the cow's hip angle in the Dabie Mountains, characterized in that, (1) The SNP marker locus in claim 1; (2) The method according to any one of claims 3 to 5.

Citation Information

Patent Citations

  • Method for detecting milk production properties of dairy cows using APOM gene snps molecular marker and use

    WO2024098242A1