Detection system and product of burkholderia gladioli (Pseudomonas coconut poison subsp. Oryzae) and application of detection system and product
By combining RPA amplification and CRISPR/Cas12a systems, specific RPA primers and crRNA were designed to solve the problem of time-consuming and insufficient sensitivity of Cypress Holderia gladiolus in the prior art, and achieved high sensitivity, strong specificity and low-priced on-site detection.
Patent Information
- Application Number
- CN202510431586.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-08
- Publication Date
- 2025-07-04
AI Technical Summary
The prior art is difficult to detect Cyclotridia Gladiolus (Pseudomonas coconut fermented rice and flour subspecies) quickly, simple and highly sensitively on site, the traditional biochemical separation method takes time, PCR requires expensive instruments, isothermal amplification method requires subsequent gel electrophoresis analysis, and the sensitivity of the CRISPR-Cas system is insufficient.
Combined with RPA amplification and CRISPR/Cas12a system, specific RPA primers and crRNA are designed, and ssDNA is identified and cleaved under crRNA guidance using Cas12a protein, and combined with visual detection technology such as nucleic acid side flow chromatography test strips, to achieve fast and simple detection.
It realizes on-site detection with high sensitivity, strong specificity and low price, and can accurately identify C. Gladiolus (Pseudomonas coconut fermented rice and flour subspecies) in a short period of time, which is suitable for grassroots laboratories and on-site applications.
Smart Images
Figure CN120249525A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of food detection, and particularly to a detection system, product and application thereof for Burkholderia gladioli (Pseudomonas cocovenenans subsp. farino fermentans). Background Art
[0002] Burkholderia gladioli is a type of Gram-negative short bacillus without spores, which is widely distributed in natural soil, water bodies, plants and foods. Its pathogenic variant, Burkholderia gladioli (Pseudomonas cocovenenans subsp. farino fermentans), produces bongkrekic acid toxin. This toxin is a highly unsaturated fatty acid, heat-resistant, and its toxicity will not be destroyed even after being treated at a high temperature of 120 °C for 1 hour. In the human body, it is mainly absorbed through the digestive tract mucosa and enters the body through blood circulation. The main target organs are the liver, brain, kidneys and other organs. The onset is acute, seriously endangering human health. Burkholderia gladioli (Pseudomonas cocovenenans subsp. farino fermentans) is currently the most lethal foodborne pathogen in China, with a lethality rate as high as over 40%, far higher than that of common foodborne pathogens such as Salmonella and Staphylococcus aureus. It mainly exists in cereal fermented products, deteriorated Tremella fuciformis, potato products and the surrounding environment. The food poisoning incidents caused by this bacterium have significant regional characteristics, and there are more reports in Guangxi Zhuang Autonomous Region, Yunnan Province, Guizhou Province and the Northeast region of China.
[0003] At present, the laboratory mainly detects Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans) in food by traditional biochemical separation methods. However, this method has the defect of long time consumption and is not suitable for rapid detection. With the development of social technology, various rapid detection technologies have been developed, including immunology, molecular biology, and biosensor technologies. Molecular biology methods based on the nucleic acid level are widely used for the detection of Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans) due to their advantages of high sensitivity, strong specificity, and rapidity, such as polymerase chain reaction (PCR), quantitative fluorescence PCR, digital PCR (ddPCR), etc. PCR requires expensive instruments and is not suitable for grass-roots laboratories lacking equipment and on-site detection. Isothermal amplification technologies based on nucleic acid detection, such as recombinase polymerase amplification (RPA) and loop-mediated isothermal amplification (LAMP), are methods that work under isothermal conditions and do not require expensive instruments, which is of great significance for on-site detection. However, the amplification products need to be analyzed by subsequent gel electrophoresis, making it difficult to truly achieve rapid detection. Therefore, it is necessary to develop a simpler, more convenient, and less instrument-dependent technology to achieve the rapid diagnosis of Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans) under on-site conditions.
[0004] The CRISPR-Cas system is an immune defense system formed by the long-term evolution of archaea and bacteria. It has high-efficiency specific sequence recognition and cleavage activity and powerful gene editing functions, providing a new technology for the rapid, specific, and accurate detection of foodborne pathogenic bacteria. The effector protein Cas12a recognizes the target DNA under the guidance of crRNA and activates the activity of non-specifically cleaving ssDNA. This indiscriminate cleavage ability makes the CRISPR-Cas system an important tool for signal amplification and output, such as using ssDNA labeled with fluorophore and quencher as a reporter. Although the CRISPR-Cas system can signal using the trans-cleavage activity method, its sensitivity is not sufficient to directly detect Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans). Therefore, it is necessary to find a method for highly sensitive detection of Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans). Summary of the Invention
[0005] The purpose of the present invention is to provide a detection system, product, and its application for Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans) to solve the problems existing in the above-mentioned prior art.
[0006] To achieve the above purpose, the present invention provides the following solutions:
[0007] The present invention provides a detection system for Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans) based on RPA-CRISPR / Cas12a. The detection system includes an RPA amplification system and a CRISPR-Cas12 system. The RPA amplification system includes an RPA primer pair. The RPA primer pair includes RPA1-F with a nucleotide sequence as shown in SEQ ID NO.3 and RPA1-R with a nucleotide sequence as shown in SEQ ID NO.4.
[0008] The CRISPR-Cas12 system includes crRNA and ssDNA. The nucleotide sequence of the crRNA is as shown in SEQ ID NO.7. The nucleotide sequence of the ssDNA is as shown in SEQ ID NO.8 or SEQ ID NO.9.
[0009] Preferably, the RPA amplification system further includes Rehydration buffer and RPA enzyme.
[0010] The CRISPR-Cas12 system further includes NEBuffer r2.1 and Cas12a protein.
[0011] The present invention provides the application of the above detection system in the preparation of a detection product for Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans).
[0012] Preferably, the detection product includes a detection kit, a detection reagent or a test strip.
[0013] The present invention provides a detection product for Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans) based on RPA-CRISPR / Cas12a. The detection product includes the above detection system.
[0014] Preferably, the detection product includes a detection kit, a detection reagent or a test strip.
[0015] Preferably, when the detection product is a kit, the detection product further includes an AP probe, a TCP probe and a CCP probe. The nucleotide sequence of the AP probe is as shown in SEQ ID NO.1. The nucleotide sequence of the TCP probe is as shown in SEQ ID NO.2. The nucleotide sequence of the CCP probe is Biotin-ATACAGAC.
[0016] The present invention provides the application of the above detection system or the above detection product in the detection of Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans).
[0017] The present invention provides a method for visual detection of Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans), comprising the following steps:
[0018] Using the DNA of the sample to be tested as a template, performing RPA amplification with the RPA primer pair described above to obtain an amplification product; mixing the amplification product with the CRISPR-Cas12 system described above, performing CRISPR reaction detection, and reading the detection signal to obtain the result.
[0019] Preferably, the reading of the detection signal includes reading a fluorescence signal or using a test strip to judge the result.
[0020] More preferably, the test strip comprises the detection system described above.
[0021] More preferably, the test strip further comprises an AP probe, a TCP probe, and a CCP probe; the nucleotide sequence of the AP probe is as shown in SEQ ID NO.1; the nucleotide sequence of the TCP probe is as shown in SEQ ID NO.2; the nucleotide sequence of the CCP probe is Biotin-ATACAGAC.
[0022] More preferably, when only the C line appears on the test strip, it indicates that the FB-ssDNA is completely cleaved, which means that the sample to be tested contains Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans); when both the C line and the T line appear on the test strip and the T line of the sample is lighter in color than that of the control group, it indicates that the FB-ssDNA is partially cleaved, which means that the sample to be tested contains Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans); if both the C line and the T line appear and the color intensity of the T line of the sample is similar to that of the control group, it indicates that the FB-ssDNA is not cleaved, which means that the sample to be tested does not contain Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans).
[0023] The present invention discloses the following technical effects:
[0024] The present invention proposes a detection system for Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans) and a new method for visual detection of Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans) based on the RPA-CRISPR / Cas12a system. Compared with the existing detection methods, the method constructed using the detection system provided by the present invention has the advantages of high sensitivity, strong specificity, rapidity, low cost, etc., and has application value in the on-site rapid detection of Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans). The combination of the RPA technology and the CRISPR / Cas system in the present invention can not only avoid non-specific amplification of RPA, but also improve the detection sensitivity, and has great potential in on-site detection. Brief Description of the Drawings
[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0026] Figure 1 For the results of RPA amplification; where M is the DNA molecular weight standard, lanes 1 and 2 are the results of RPA1 primer pair and RPA2 primer pair, and lane 3 is the negative control;
[0027] Figure 2 For the verification results of the combination of RPA primers and crRNA;
[0028] Figure 3 For the specificity results of the RPA-CRISPR-Cas12a fluorescence detection method; where the blue curve is Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans) (83756);
[0029] Figure 4 For the specificity results of the RPA-CRISPR-Cas12a nucleic acid lateral flow chromatography strip detection method; where 1-10 are Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans) (83756), Burkholderia gladioli (CICC10574), Burkholderia gladioli (laboratory isolation), Burkholderia gladioli (laboratory isolation), Burkholderia cepacia (laboratory isolation), Salmonella enteritidis (CMCC(B)50335), Staphylococcus aureus (ATCC6538), Bacillus subtilis var. niger (ATCC9372), Listeria monocytogenes (CICC21662), and Escherichia coli (ATCC25922) in sequence, and N is the negative control;
[0030] Figure 5 For the sensitivity results of the RPA-CRISPR-Cas12a fluorescence detection method; where 1-7 are 9.6×10 6 CFU / mL, 9.6×10 5 CFU / mL, 9.6×10 4 CFU / mL, 9.6×10 3 CFU / mL, 9.6×10 2 CFU / mL, 9.6×10 1 CFU / mL, and 9.6×10 0 CFU / mL in sequence, and N is the negative control;
[0031] Figure 6 Results of the specificity of the RPA-CRISPR-Cas12a nucleic acid lateral flow strip detection method; among them, 1-7 are 9.6×10 6 CFU / mL, 9.6×10 5 CFU / mL, 9.6×10 4 CFU / mL, 9.6×10 3 CFU / mL, 9.6×10 2 CFU / mL, 9.6×10 1 CFU / mL, and 9.6×10 0 CFU / mL, N is the negative control;
[0032] Figure 7 Results of detecting the sample by the RPA-CRISPR-Cas12a fluorescence detection method; among them, the two blue curves are for 2 commercially available fresh wet powder samples spiked with Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinosa) (83756);
[0033] Figure 8 Results of detecting the sample by the RPA-CRISPR-Cas12a nucleic acid lateral flow strip detection method; among them, 1-2, 4-9, and 11-20 are all commercially available fresh wet powder samples not spiked with Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinosa) (83756), 3 and 10 are 2 commercially available fresh wet powder samples spiked with Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinosa) (83756), and N is the negative control. Detailed implementation manners
[0034] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.
[0035] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.
[0036] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although this invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0037] Without departing from the scope or spirit of this invention, various improvements and changes can be made to the specific embodiments of the specification of this invention, which are obvious to those skilled in the art. Other embodiments obtained from the specification of this invention are obvious to those skilled in the art. The specification and examples of this invention are merely exemplary.
[0038] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.
[0039] Unless otherwise required, the components and strains used in this invention are all routinely purchased by those skilled in the art, the methods used in this invention are all well-known to those skilled in the art; the sequences used in this invention are all synthesized by well-known companies by those skilled in the art.
[0040] Example 1 Preparation of Nucleic Acid Lateral Flow Test Strip
[0041] 1. Sequence Synthesis
[0042] Based on the principle of nucleic acid test strip, nucleic acid sequences were designed, as shown in Table 1.
[0043] Table 1 Nucleic Acid Sequences
[0044] Name Sequence (5'-3') AP Probe SH-TTTTTTTTGTCTGTAT(SEQ ID NO.1) TCP Probe CTATCGGTACTATACA-Biotin(SEQ ID NO.2) CCP Probe Biotin-ATACAGAC
[0045] 2. Preparation of Gold Nanoparticles (AuNPs)
[0046] 190 mL of ultrapure water and 2 mL of HAuCl4 (1 wt%) solution were added to a round-bottom flask, heated to boiling, then 8 mL of trisodium citrate solution (1 wt%) was added, and heating continued for 15 min before stopping. After cooling at room temperature, the solution turned red and was dispensed to obtain AuNPs solution for standby.
[0047] 3. Preparation of AuNP-AP
[0048] The DNA was ligated to AuNPs using the freezing method. Take 100 μL of AuNPs solution and mix it with 20 μL of AP probe (100 μM), freeze it at -80 °C for 15 min, take it out and thaw it at room temperature, centrifuge it at 10000 g for 5 min, discard the supernatant, and add 45 μL of AuNP-DNA complex solution to redissolve it (20 nM Na3PO4 + 5% (v / v) BSA + 0.25% (v / v) Tween-20 + 10 wt% sucrose) to obtain AuNP-AP.
[0049] 4. Preparation of nucleic acid lateral flow chromatographic test strip
[0050] The nucleic acid lateral flow chromatographic test strip consists of five parts: a sample pad, a conjugate pad, a nitrocellulose membrane, an absorbent pad, and a PVC backing. Mix 20 μL of streptavidin (SA) with 20 μL of TCP probe (100 μM) and 20 μL of CCP probe (100 μM) respectively and incubate for 1 h to obtain SA-TCP mixture and SA-CCP mixture. Then use a scribing device to spray the SA-TCP mixture and SA-CCP mixture on the nitrocellulose membrane at a speed of 1 μL / cm respectively to form a test line (TL) and a control line (CL). Dry it in an oven at 37 °C for 1 h, assemble the sample pad, conjugate pad, nitrocellulose membrane, and absorbent pad on the PVC backing in sequence, and use a programmable strip cutter to cut it into finished products with a width of 3 mm for standby.
[0051] Example 2 Establishment of RPA-CRISPR / Cas12a method
[0052] 1. Design and screening of RPA primers and crRNA
[0053] According to the RPA primer design principle, specific amplification primers were designed based on the BonM gene of Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans) (Gene Bank accession number: JX173632.1), and the gene sequence region where the primers with strong specificity and bright bands in the RPA amplification results were located was selected to design crRNA. ssDNA was designed according to different experimental methods, with the 5' end labeled with FAM fluorophore and the 3' end labeled with BHQ1 quencher by fluorescence method, and both ends were unmodified by strip method. The primer and probe sequences are shown in Table 2.
[0054] Table 2 Primer and probe sequences
[0055] Name Sequence (5'-3') RPA1-F GCGCGAGAAGGGTTGCCTGGTCGACGGCATCACCA(SEQ ID NO.3) RPA1-R TCGGCAAGCGCGGCCTCGTGGCCCATGTGGAAGAT(SEQ ID NO.4) RPA2-F CCGCCTCCGAGCGGCTGGCGCAGATGCTGATC(SEQ ID NO.5) RPA2-R CGCGCTGCGTCGCGCCGATCTGCTGGACCTT(SEQ ID NO.6) crRNA UAAUUUCUACUAAGUGUAGAUCCGACGGCACCUACGACGGC(SEQ ID NO.7) FB-ssDNA AGTACCGATAGATACAGAC(SEQ ID NO.8) FQ-ssDNA FAM-AGTACCGATAGATACAGAC-BHQ(SEQ ID NO.9)
[0056] 2. DNA extraction
[0057] Extract DNA by boiling lysis method. Take 1 mL of GVC enrichment broth and add it to a 1.5 mL centrifuge tube. Centrifuge at 12000 g for 2 min, aspirate and discard the supernatant; add 500 μL of sterile water, mix well and centrifuge at 12000 g for 2 min, aspirate and discard the supernatant; add 100 μL of sterile water, boil in a water bath for 10 min, centrifuge at 12000 g for 2 min, and take the supernatant and store it at -20 °C for later detection.
[0058] 3. Establishment of RPA-CRISPR / Cas12a detection system
[0059] 3.1 Establishment of RPA amplification system
[0060] RPA amplification system (50 μL): Add 29.5 μL of Twist Amp rehydration buffer, 11.2 μL of sterile water, and 2.4 μL each of upstream and downstream primers (10 μM, RPA1 primer pair (RPA1-F and RPA1-R) or RPA2 primer pair (RPA2-F and RPA2-R)) to a centrifuge tube. After mixing, add it to the freeze-dried RPA enzyme powder. After fully dissolving, add 2 μL of sample DNA, then add 2.5 μL of magnesium acetate (280 mmol / L), mix well and place it in a thermostatic reactor, heat at 39 °C for 20 min. After the RPA reaction is completed, use a gel recovery kit to recover the amplification product, and take 5 μL for electrophoresis. The RPA amplification results are as Figure 1 shown. The results show that the amplification product of the RPA1 primer pair is single and the band is bright, and the amplification efficiency is the highest. Therefore, the RPA1 primer pair was selected for subsequent experiments.
[0061] 3.2 Establishment of CRISPR-Cas12 fluorescence detection system
[0062] CRISPR-Cas12 fluorescence detection system (20 μL): 2 μL of NEBuffer r2.1 (10×), 2 μL of Cas12a protein solution (1 μmol / L, purchased from New England bialabs), 2 μL of crRNA (1 μmol / L), 2.5 μL of RPA amplification product, 0.8 μL of fluorescent reporter molecule FQ-ssDNA (5 μmol / L), make up to 20 μL with sterile water. Centrifuge and mix the prepared system, transfer it to an automatic pathogenic microorganism detection system, the reaction temperature is 37 °C, collect fluorescence once every 1 min, and measure the real-time fluorescence curve.
[0063] CRISPR-Cas12a strip detection system (100 μL): 2 μL of NEBuffer r2.1 (10×), 2 μL of Cas12a protein solution (1 μmol / L), 2 μL of crRNA (1 μmol / L), 2.5 μL of RPA amplification product, 2 μL of strip reporter molecule FB-ssDNA (5 μmol / L), make up to 20 μL with sterile water. Centrifuge and mix the prepared system, then place it in a portable constant temperature reactor and incubate at 37 °C for 40 min. After the reaction, add 80 μL of buffer (4×SSC + 1% (v / v) BSA + 0.05% (v / v) Tween 20), mix well and immerse the sample end of the strip into the solution. Among them, 2.5 μL of AuNP-AP was pre-dropped onto the conjugate pad of the nucleic acid lateral flow chromatography strip prepared in Example 1, and the results were judged. If both the C line and the T line appear and the color intensity of the sample T line is similar to that of the control group, it indicates that FB-ssDNA is not cleaved, suggesting that the RPA reaction product does not contain the target bacterial DNA amplification product; if only the C line appears, it indicates that FB-ssDNA is completely cleaved, suggesting that the RPA reaction product contains the target bacterial DNA amplification product; if both the C line and the T line appear and the sample T line is lighter in color than the control group, it indicates that FB-ssDNA is partially cleaved, then it indicates that the RPA reaction product contains Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans).
[0064] The CRISPR-Cas12 fluorescence detection system established in this example was used to verify whether the RPA1 primer pair and crRNA have a synergistic effect when paired. The verification results are as Figure 2 shown. The results showed that obvious fluorescence signals could appear. Therefore, the RPA1 primer pair and crRNA provided by the present invention have a synergistic effect and can be applied.
[0065] 4. Specificity analysis
[0066] Burkholderia gladioli strain (Pseudomonas cocovenenans subsp. farinofermentans) (83756) was publicly disclosed in the literature "Establishment of a Real-Time Fluorescent PCR Method for the Detection of the Toxicogenic Type of Burkholderia gladioli" (Wang Xiaowen, Chen Jing, Chen Guopei, et al. Establishment of a Real-Time Fluorescent PCR Method for the Detection of the Toxicogenic Type of Burkholderia gladioli [J]. Food Science and Technology, 2022, 47(1): 330-335), and it was promised to be distributed externally for 20 years. In "Establishment of a Real-Time Fluorescent PCR Method for the Detection of the Toxicogenic Type of Burkholderia gladioli", the name of this strain is Burkholderia gladioli toxicogenic type strain, and the number is 83756.
[0067] The genomes of Burkholderia gladioli (CICC10574), Burkholderia gladioli (subspecies of Pseudomonas cocovenenans causing acute intoxication from fermented flour products) (83756), 2 strains of Burkholderia gladioli (isolated from the laboratory), Burkholderia cepacia (isolated from the laboratory), Salmonella enteritidis (CMCC(B)50335), Staphylococcus aureus (ATCC6538), Bacillus subtilis var. niger (ATCC9372), Listeria monocytogenes (CICC21662) and Escherichia coli (ATCC25922) were extracted by the boiling lysis method. The extracted genomes were used as RPA templates. After the amplification was completed, the RPA products were added to the CRISPR / Cas12a detection system. The detection results were judged by the two methods of fluorescence and test strip established in the examples. At the same time, the treatment without adding any strains was used as a negative control. The results are as Figure 3 and Figure 4 shown. The results of the fluorescence detection method showed ( Figure 3 ): Burkholderia gladioli (subspecies of Pseudomonas cocovenenans causing acute intoxication from fermented flour products) (83756) showed obvious fluorescence signals, while other strains did not show obvious fluorescence signals; the results of the nucleic acid lateral flow chromatographic test strip showed ( Figure 4 ): Burkholderia gladioli (subspecies of Pseudomonas cocovenenans causing acute intoxication from fermented flour products) (83756) only showed the quality control line and did not show the detection line, showing positive; other strains showed both the quality control line and the detection line at the same time and the color intensity of the T line was similar to that of the control group (N), showing negative. It can be seen that the two methods of fluorescence and test strip established in the present invention have strong specificity and are only directed against Burkholderia gladioli (subspecies of Pseudomonas cocovenenans causing acute intoxication from fermented flour products).
[0068] 5. Sensitivity analysis
[0069] Burkholderia gladioli (subspecies of Pseudomonas cocovenenans causing acute intoxication from fermented flour products) (83756) was inoculated into GVC enrichment broth and cultured at 37°C for 18 h. The bacterial suspension was diluted by ten-fold gradient (dilution gradient 10 -1 -10 -6 ), and at the same time, plate counting was performed on each gradient. 1 mL of each gradient of the bacterial solution was taken to extract genomic DNA, and 2 μL of DNA was taken as a template for RPA-CRISPR / Cas12a detection to determine the sensitivity of the method. The detection results were judged by the two methods of fluorescence and test strip established in the examples. At the same time, the treatment without adding Burkholderia gladioli (subspecies of Pseudomonas cocovenenans causing acute intoxication from fermented flour products) (83756) was used as a negative control. The results are as Figure 5 and Figure 6 shown. The results of the fluorescence detection method showed ( Figure 5 ): The bacterial solution concentration of Burkholderia gladioli (subspecies of Pseudomonas cocovenenans causing acute intoxication from fermented flour products) (83756) was 9.6×10 1The fluorescence signal that can be detected is 9.6×10 0 CFU / mL, and the fluorescence signal cannot be detected. The detection results of the nucleic acid lateral flow chromatography test strip show ( Figure 6 ): As the concentration of bacteria increases, the red color of TL gradually fades. Compared with the negative control, the change in its relative color intensity becomes more and more obvious. When the concentration is 9.6×10 1 CFU / mL, there is a weak detection band on the TL strip compared with the negative control. That is, when the concentration is 9.6×10 1 CFU / mL, compared with the negative control, a weak TL band can be observed. Moreover, compared with the 6th band, the width of the 7th band becomes wider, and the brightness is close to the control T line. The results show that the sensitivity of the CRISPR-Cas12a test strip is 9.6×10 1 CFU / mL.
[0070] 6. Detection of spiked samples
[0071] Twenty commercially available fresh wet powder samples were randomly purchased from the market as test samples. Among them, 2 samples were spiked with Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans) (83756), and the addition amount was 1 mL of the bacterial solution of Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans) (83756) (10 2 CFU / mL). 25 g of each sample was taken and added to a sterile bag containing 225 mL of GVC enrichment broth, cultured at 36 °C for 18 h, 1 mL of the enrichment broth was taken, genomic DNA was extracted by the boiling method, and the fluorescence and test strip methods established in this example were used for detection. At the same time, the treatment without adding Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans) (83756) was used as the negative control. The results are as shown in Figure 7 and Figure 8 . The results of the fluorescence detection method ( Figure 7 ) and the detection results of the nucleic acid lateral flow chromatography test strip ( Figure 8 ) are consistent, and only two positive spiked samples are detected. Therefore, the fluorescence and test strip methods established in the present invention can be used for the detection of actual samples.
[0072] Example 3 Sensitivity of the detection method disclosed in the prior art
[0073] Loop-mediated isothermal amplification (LAMP) can rapidly amplify nucleic acids under the constant temperature condition of 60-65°C by designing four specific primers for six specific regions of the target gene and with the action of strand displacement DNA polymerase. Yao Xurong et al. established a detection method based on the combination of loop-mediated isothermal amplification and fluorescence probe. Specific primers and fluorescence probes for loop-mediated isothermal amplification were designed with the bonA gene of Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinosa) as the target site. This method is specific for Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinosa) [B. gladiolipv. cocovenenans], can obtain results within 30 minutes, and can be directly observed visually. The detection sensitivity of this method is 2.7×10 2 CFU / mL.
[0074] The embodiments described above are only descriptions of the preferred modes of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention should all fall within the protection scope determined by the claims of the present invention.
Claims
1. A detection system for Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans) based on RPA-CRISPR / Cas12a, characterized in that, The detection system includes an RPA amplification system and a CRISPR-Cas12 system; the RPA amplification system includes an RPA primer pair; the RPA primer pair includes RPA1-F with a nucleotide sequence as shown in SEQ ID NO.3 and RPA1-R with a nucleotide sequence as shown in SEQ ID NO.4; The CRISPR-Cas12 system includes crRNA and ssDNA; the nucleotide sequence of the crRNA is as shown in SEQ ID NO.7; the nucleotide sequence of the ssDNA is as shown in SEQ ID NO.8 or SEQ ID NO.
9.
2. The detection system according to claim 1, characterized in that, The RPA amplification system further includes Rehydration buffer and RPA enzyme; The CRISPR-Cas12 system further includes NEBuffer r2.1 and Cas12a protein.
3. Use of the detection system according to claim 1 or 2 in the preparation of a detection product for Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans).
4. The application according to claim 3, wherein The detection product includes a detection kit, a detection reagent or a test strip.
5. A detection product for Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans) based on RPA-CRISPR / Cas12a, characterized in that, The detection product includes the detection system according to claim 1 or 2.
6. The detection product according to claim 5, characterized in that, The detection product includes a detection kit, a detection reagent or a test strip.
7. The detection product according to claim 6, wherein When the detection product is a kit, the detection product further includes an AP probe, a TCP probe and a CCP probe; the nucleotide sequence of the AP probe is as shown in SEQ ID NO.1; the nucleotide sequence of the TCP probe is as shown in SEQ ID NO.2; the nucleotide sequence of the CCP probe is ATACAGAC.
8. Use of the detection system according to claim 1 or 2 or the detection product according to any one of claims 5-7 in the detection of Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans).
9. A method for visual detection of Burkholderia gladioli (Pseudomonas cocovenenans subsp. farinofermentans), characterized in that, Comprising the following steps: Using the DNA of the sample to be tested as a template, performing RPA amplification with the RPA primer pair described in claim 1 to obtain an amplification product; mixing the amplification product with the CRISPR-Cas12 system described in claim 1, performing CRISPR reaction detection, and reading the detection signal to obtain the result.
10. The method according to claim 9, characterized in that, The reading of the detection signal includes reading a fluorescence signal or using a test strip to judge the result.