Gene chip for rapidly detecting enterotoxigenic escherichia coli

Abstract

The invention belongs to the technical field of biological detection, and particularly relates to a gene chip for rapidly detecting enterotoxigenic escherichia coli. A detection reagent used by the gene chip disclosed by the invention comprises seven sets of LAMP detection primers aiming at escherichia coli specific genes 16S, iucC, iSS, ibeA, sitA, papC and hlyD, and each set of LAMP detection primers comprises an FIP primer, a BIP primer, an F3 primer, a B3 primer, an LB primer and an LF primer which are used for LAMP specific amplification. Wherein 16S is used for determining whether the virus is escherichia coli or not, and if three or more other virulence genes are positive, the virus is determined to be exotoxin escherichia coli (ExPEC). When the gene chip is applied to detection of enterotoxin escherichia coli, excellent specificity and sensitivity appear, meanwhile, the gene chip has good anti-interference capacity and detection stability, and visual LAMP rapid detection of escherichia coli enterotoxin is achieved.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and particularly relates to a gene chip for rapid detection of enterotoxigenic Escherichia coli. Background Art

[0002] Escherichia coli is usually referred to as E. coli, which is a normal inhabitant in the intestines of humans and animals. Some special serotypes of E. coli are highly pathogenic to humans and animals. Among them, the pathogenic substances produced by diarrheogenic Escherichia coli mainly include colonization factors, adhesins, exotoxins, and enterotoxins, etc. The detection standard of E. coli in food is one of the important indicators in the field of food safety. Traditional methods for detecting and differentiating E. coli mainly include selective isolation, biochemical identification, serological identification, etc. However, these methods have a long experimental period, and it is difficult for general laboratories to have a complete set of E. coli diagnostic sera. In recent years, techniques such as single PCR, multiplex PCR, real-time fluorescence PCR, and gene chips have been used to detect enterotoxigenic E. coli in order to detect its virulence genes and distinguish different pathogenic types. These methods have greatly improved timeliness, efficiency, and sensitivity compared with traditional methods. However, such methods have cumbersome sample addition steps, require professional personnel to operate, need electrophoresis detection, and the instruments used in fluorescence PCR and gene chips are relatively expensive. At the same time, although the detection time has been shortened, it still takes 2 - 4 hours or longer. Therefore, it is of great significance to further develop a more efficient E. coli detection method.

[0003] The loop-mediated isothermal amplification (LAMP) method is usually carried out under isothermal conditions of 60 °C to 66 °C to rapidly and effectively amplify gene fragments. It has strong specificity, high sensitivity, good repeatability, simple result interpretation, does not require special equipment, is easy to operate, and can meet the requirements of on-site operation at the grass-roots level, etc. However, there are few LAMP rapid detection methods for enterotoxins of E. coli at present. Summary of the Invention

[0004] In order to overcome the above-mentioned deficiencies of the prior art, the present invention provides a rapid detection method for 7 pathogenic type genes of E. coli. By designing 7 sets of LAMP detection primers, each set of LAMP detection primers includes 6 primers, thereby realizing the visual LAMP rapid detection of enterotoxins of E. coli.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is:

[0006] The present invention provides a gene chip for rapid detection of enterotoxigenic Escherichia coli, and the gene chip includes LAMP primers for detecting specific genes 16S, iucC, iSS, ibeA, sitA, papC, and hlyD of enterotoxigenic Escherichia coli.

[0007] Preferably, the LAMP detection primers for each gene include 6 primers.

[0008] More preferably, the gene chip includes FIP, BIP, B3, F3, LF, and LB for detecting the 16S gene as shown in SEQ ID No: 1-7, FIP, BIP, B3, F3, LF, and LB for detecting the ISS gene as shown in SEQ ID No: 7-12, FIP, BIP, B3, F3, LF, and LB for detecting the ibeA gene as shown in SEQ ID No: 13-18, FIP, BIP, B3, F3, LF, and LB for detecting the iucC gene as shown in SEQ ID No: 19-24, FIP, BIP, B3, F3, LF, and LB for detecting the sitA gene as shown in SEQ ID No: 25-30, FIP, BIP, B3, F3, LF, and LB for detecting the papC gene as shown in SEQ ID No: 31-36, and FIP, BIP, B3, F3, LF, and LB for detecting the hlyD gene as shown in SEQ ID No: 37-42.

[0009] Preferably, the method for using the gene chip is as follows: Mix the primers FIP / BIP, F3 / B3, and LF / LB for detecting the specific genes 16S, iucC, iSS, ibeA, sitA, papC, and hlyD of ExPEC, add the DNA of the sample to be tested or the bacterial suspension of the sample to be tested, and then use the BeyoColor TM Isothermal Amplification Color Change Detection Kit for testing.

[0010] More preferably, the concentration of the primer FIP / BIP is 16 μM, the concentration of F3 / B3 is 2 μM, and the concentration of LF / LB is 4 μM.

[0011] More preferably, the reading standard for the detection result is: Use 16S to determine whether it is Escherichia coli, and if there are 3 or more positive results for other virulence genes, it is determined to be ExPEC.

[0012] More preferably, the lowest detection limit of the DNA of the sample to be tested is 10 -2 ng / μL.

[0013] More preferably, the lowest detection limit of the bacterial suspension of the sample to be tested is 10 -1 cfu / mL.

[0014] Compared with the prior art, the beneficial effects of the present invention are:

[0015] The present invention discloses a gene chip for detecting extraintestinal toxin Escherichia coli based on LAMP. The detection reagents used in the gene chip include 7 sets of LAMP detection primers targeting specific genes of Escherichia coli, namely 16S, iucC, iSS, ibeA, sitA, papC, and hlyD. Each set of LAMP detection primers includes 6 primers, that is, each set of LAMP detection primers includes FIP, BIP, F3, B3, LB, and LF primers for specific amplification of LAMP. Among them, 16S is used to determine whether it is Escherichia coli, and if 3 or more of the other virulence genes are positive, it is determined to be extraintestinal toxin Escherichia coli (ExPEC) (for example, for R382, if 16S, ibeA, iucC, and sitA are all positive, then it is extraintestinal toxin Escherichia coli). When the gene chip is applied to detect extraintestinal toxin Escherichia coli, it shows excellent specificity and sensitivity, and at the same time has good anti-interference ability and detection stability, realizing the visual LAMP rapid detection of Escherichia coli extraintestinal toxin. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Photo for verifying the specificity of the 16S primer;

[0017] Figure 2 Photo for verifying the specificity of the ibeA primer;

[0018] Figure 3 Photo for verifying the specificity of the iucC primer;

[0019] Figure 4 Photo for verifying the specificity of the sitA primer;

[0020] Figure 5 Photo for verifying the specificity of the ISS primer;

[0021] Figure 6 Photo for verifying the specificity of the papC primer;

[0022] Figure 7 Photo for verifying the specificity of the hlyD primer;

[0023] Figure 8 Photo for verifying the anti-interference ability of the ibeA primer (tube 1 is R382 + R375, tube 2 is R382 + Salmonella, tube 3 is R382 + Proteus mirabilis, tube 4 is R382 + R375 + Salmonella, tube 5 is R382 + R375 + Proteus mirabilis, tube 6 is R382 + Salmonella + Proteus mirabilis, tube 7 is R382 + R375 + Salmonella + Proteus mirabilis, tube 8 is the negative control of dd water);

[0024] Figure 9Photo for verifying the anti-interference ability of the iucC primer (Tube 1 is R382 + R375, Tube 2 is R382 + Salmonella, Tube 3 is R382 + Proteus mirabilis, Tube 4 is R382 + R375 + Salmonella, Tube 5 is R382 + R375 + Proteus mirabilis, Tube 6 is R382 + Salmonella + Proteus mirabilis, Tube 7 is R382 + R375 + Salmonella + Proteus mirabilis, Tube 8 is the negative control of dd water);

[0025] Figure 10 Photo for verifying the anti-interference ability of the sitA primer (Tube 1 is R382 + R350, Tube 2 is R382 + Salmonella, Tube 3 is R382 + Proteus mirabilis, Tube 4 is R382 + R350 + Salmonella, Tube 5 is R382 + R350 + Proteus mirabilis, Tube 6 is R382 + Salmonella + Proteus mirabilis, Tube 7 is R382 + R350 + Salmonella + Proteus mirabilis, Tube 8 is the negative control of dd water);

[0026] Figure 11 Photo for verifying the anti-interference ability of the ISS primer (Tube 1 is R107 + R375, Tube 2 is R107 + Salmonella, Tube 3 is R107 + Proteus mirabilis, Tube 4 is R107 + R375 + Salmonella, Tube 5 is R107 + R375 + Proteus mirabilis, Tube 6 is R107 + Salmonella + Proteus mirabilis, Tube 7 is R107 + R375 + Salmonella + Proteus mirabilis, Tube 8 is the negative control of dd water);

[0027] Figure 12 Photo for verifying the anti-interference ability of the hlyD primer (Tube 1 is R375 + R382, Tube 2 is R375 + Salmonella, Tube 3 is R375 + Proteus mirabilis, Tube 4 is R375 + R382 + Salmonella, Tube 5 is R375 + R382 + Proteus mirabilis, Tube 6 is R375 + Salmonella + Proteus mirabilis, Tube 7 is R375 + R382 + Salmonella + Proteus mirabilis, Tube 8 is the negative control of dd water);

[0028] Figure 13 Photo for verifying the anti-interference ability of the papC primer (Tube 1 is R375 + R382, Tube 2 is R375 + Salmonella, Tube 3 is R375 + Proteus mirabilis, Tube 4 is R375 + R382 + Salmonella, Tube 5 is R375 + R382 + Proteus mirabilis, Tube 6 is R375 + Salmonella + Proteus mirabilis, Tube 7 is R375 + R382 + Salmonella + Proteus mirabilis, Tube 8 is the negative control of dd water);

[0029] Figure 14 To verify the sensitivity of the 16S primer pair to the DNA concentration of Escherichia coli (the last tube is the negative control);

[0030] Figure 15 To verify the sensitivity of the ibeA primer pair to the DNA concentration of Escherichia coli (the last tube is the negative control);

[0031] Figure 16 To verify the sensitivity of the ISS primer pair to the DNA concentration of Escherichia coli (the last tube is the negative control);

[0032] Figure 17 To verify the sensitivity of the iucC primer pair to the DNA concentration of Escherichia coli (the last tube is the negative control);

[0033] Figure 18 To verify the sensitivity of the sitA primer pair to the DNA concentration of Escherichia coli (the last tube is the negative control);

[0034] Figure 19 To verify the sensitivity of the hlyD primer pair to the DNA concentration of Escherichia coli (the last tube is the negative control);

[0035] Figure 20 To verify the sensitivity of the papC primer pair to the DNA concentration of Escherichia coli (the last tube is the negative control);

[0036] Figure 21 To verify the sensitivity of the 16S primer pair to the Escherichia coli bacterial suspension (the last tube is the negative control);

[0037] Figure 22 To verify the sensitivity of the sitA primer pair to the Escherichia coli bacterial suspension (the last tube is the negative control);

[0038] Figure 23 To verify the sensitivity of the iucC primer pair to the Escherichia coli bacterial suspension (the last tube is the negative control);

[0039] Figure 24 To verify the sensitivity of the ISS primer pair to the Escherichia coli bacterial suspension (the last tube is the negative control);

[0040] Figure 25 To verify the sensitivity of the ibeA primer pair to the Escherichia coli bacterial suspension (the last tube is the negative control);

[0041] Figure 26 To verify the sensitivity of the papC primer pair to the Escherichia coli bacterial suspension (the last tube is the negative control);

[0042] Figure 27To verify the sensitivity of the hlyD primer pair to the Escherichia coli bacterial suspension (the last tube is the negative control);

[0043] Figure 28 To verify the reproducibility photo of the 16S primer pair for the Escherichia coli R382 bacterial solution;

[0044] Figure 29 To verify the reproducibility photo of the iucC primer pair for the Escherichia coli R382 bacterial solution;

[0045] Figure 30 To verify the reproducibility photo of the ibeA primer pair for the Escherichia coli R382 bacterial solution;

[0046] Figure 31 To verify the reproducibility photo of the sitA primer pair for the Escherichia coli R382 bacterial solution;

[0047] Figure 32 To verify the reproducibility photo of the ISS primer pair for the Escherichia coli R107 bacterial solution;

[0048] Figure 33 To verify the reproducibility photo of the papC primer pair for the Escherichia coli R375 bacterial solution;

[0049] Figure 34 To verify the reproducibility photo of the hlyD primer pair for the Escherichia coli R375 bacterial solution;

[0050] Figures 1 - 34 Among them, purple indicates that isothermal amplification did not occur, and blue indicates that isothermal amplification occurred. Detailed implementation manners

[0051] The following further describes the detailed implementation manners of the present invention. It should be noted here that the description of these implementation manners is used to help understand the present invention, but does not constitute a limitation to the present invention. In addition, the technical features involved in the various implementation manners of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0052] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and the test materials used in the following embodiments are all commercially available through conventional channels unless otherwise specified.

[0053] In the following examples, the deposit numbers of Escherichia coli strains R107, R350, R375, and R382 are GDMCC No: 1.5595, GDMCC No: 1.5596, GDMCC No: 1.5594, and GDMCC No: 1.5593, respectively; the deposit number of Proteus mirabilis is GDMCC No: 1.5599; the Salmonella is Salmonella standard strain ATCC 14028. Among them, R107 expresses ISS, iucC, and sitA, but does not express ibeA; R350 does not express sitA; R375 expresses papC and hlyD, but does not express iucC, ibeA, and ISS; R382 expresses ibeA, iucC, and sitA, but does not express ISS, papC, and hlyD.

[0054] Example 1: A gene chip for detecting extraintestinal toxin Escherichia coli based on LAMP

[0055] The detection reagents used in the gene chip include a set of LAMP amplification specific FIP, BIP, F3, B3, LB, and LF primers for detecting the specific genes 16S, iucC, iSS, ibeA, sitA, papC, and hlyD of Escherichia coli (their NCBI accession numbers are NR_024570.1, NC_007675.1, NC_000913.3, NC_007946.1, NC_007675.1, NC_000913.3, and NC_002128.1), and the base sequences of each primer are as follows:

[0056] 16S:

[0057] FIP: AATCCACTTTGGGTGGTGGTGTGCAATGTGATCCCGGTACTG (SEQ ID No: 1);

[0058] BIP: CGTGCGCCTGGTTCCTCATGGTGATGCGGCTCAACACA (SEQ ID No: 2);

[0059] B3: GCTGGTTAAAGGCTTCGGTG (SEQ ID No: 3);

[0060] F3: AAGCGTCATGGCGCAATA (SEQ ID No: 4);

[0061] LF: AGGCTGACGGCGGTACTTC (SEQ ID No: 5);

[0062] LB: ACGATGCCTCACCCGGTTA (SEQ ID No: 6).

[0063] ISS:

[0064] FIP: GTGCTACTGCTGTCTGTTTGTTTTGGCCCTGCTTATTACAGGATG (SEQ ID No: 7);

[0065] BIP: CAAAGGAAACCATCACCCATCACCGCCACAAATTTTAGCT (SEQ ID No: 8);

[0066] B3: TGTTTTAACAACATTTTCTGCG (SEQ ID No: 9);

[0067] F3: AATGCTACTCGCTACTGC (SEQ ID No: 10);

[0068] LF: TTCTTCGTTTCTGGAATTGGGC (SEQ ID No: 11);

[0069] LB: TGCTCAACAGACATTTACTGTT (SEQ ID No: 12).

[0070] ibeA:

[0071] FIP: GTAGCTGCGCCTTCACGAGCTAGTTGTTGGTGGTGGTCCA (SEQ ID No: 13);

[0072] BIP: TTGGCGGAATGATGACAACGGCGCCAGTCCACCTGACTCT (SEQ ID No: 14);

[0073] B3: GCCGTTTCTTCTATTTCGCG (SEQ ID No: 15);

[0074] F3: CTGGCAACCACGGAAGTG (SEQ ID No: 16);

[0075] LF: GCTGCGGCAATACCCGA (SEQ ID No: 17);

[0076] LB: GGCGTCGAGTCAATTGCCTGG (SEQ ID No: 18).

[0077] iucC:

[0078] FIP: ACTCCTGCGGATCCATTGCGCATATGATCTGGCGCTGTGA (SEQ ID No: 19);

[0079] BIP: AGTCAGGTCTGGCAGGAAAACGCACTGCCACGGATGTACC (SEQ ID No: 20);

[0080] B3: CAGCGATGAAGTCGGTAGC (SEQ ID No: 21);

[0081] F3: TCAGACTGCACTGGCTGG (SEQ ID No: 22);

[0082] LF: CCGTCAACAACTGATGAATATCCA (SEQ ID No: 23);

[0083] LB: GACTGGATCATAACTGGCTGC (SEQ ID No: 24).

[0084] sitA:

[0085] FIP: TCGACATAGAGCACACCACCGTCGATAAACCAGCGCGTCAG (SEQ ID No: 25);

[0086] BIP: CTGAGCACAGAAAACGGCCCGTGTACCAGCGTACTGGTAGT (SEQ ID No: 26);

[0087] B3: TTTCTCCCTTTTTCCGGCTT (SEQ ID No: 27);

[0088] F3: CGGCAGTCTTTAGCGAGAG (SEQ ID No: 28);

[0089] LF: CCGGTTTCACGCGCAAC (SEQ ID No: 29);

[0090] LB: GTACCTACGTATATCGACCTTCTGAAGGTT (SEQ ID No: 30).

[0091] papC:

[0092] FIP: CGGTCTTCCAGGTAAGGGTGCTCCATGCGCAAAGTGATTGG (SEQ ID No: 31);

[0093] BIP: TCGACCGACCGTGGTTTGTGAGGTCTTCATTTCCGCCAG (SEQ ID No: 32);

[0094] B3: CGCATTGAACGCCTTTGTC (SEQ ID No: 33);

[0095] F3: CAGCCGTCCTTATGCAGAA (SEQ ID No: 34);

[0096] LF: CCAGATTACCGTGTGCAAGGTGA (SEQ ID No: 35);

[0097] LB: CGGTGGTTTGAACATTAACCTGTT (SEQ ID No: 36).

[0098] hlyD:

[0099] FIP: GGTGAGCAGGAAGAAATGCATACTGTCTGGAAAATTCGTCACAC (SEQ ID No: 37);

[0100] BIP: ACCAGTATCCAGACGTTCTCACCAAGAACAGATAAGAGAAGAG (SEQ ID No: 38);

[0101] B3: ACTGAAACCACTTCAACTTTC (SEQ ID No: 39);

[0102] F3: CGTTATAAGACGGTTTTTTCTGAT (SEQ ID No: 40);

[0103] LF: TCTTTTTCTCTCACAGGAGCATC (SEQ ID No: 41);

[0104] LB: TTGAACTCATTGAAAC (SEQ ID No: 42).

[0105] Example 2: Use and Feasibility Verification of Gene Chip for Detection of Extrasintestinal Toxigenic Escherichia coli Based on LAMP

[0106] (1) The method for using the gene chip to detect Extrasintestinal Toxigenic Escherichia coli is as follows:

[0107] First, pretreat the sample with a pretreatment reagent (bacterial lysis solution, prepared from 0.625 mL of 10% SDS, 1.25 mL of 10% NaOH, and 23.125 mL of water) to obtain a DNA template. Then, arrange the primers in an eight-well tube in the order of 16S, iucC, iSS, ibeA, sitA, papC, hlyD. For each gene, the amount of FIP / BIP is 0.73 μL, F3 / B3 is 0.1 μL, and LF / LB is 0.18 μL. Among them, the concentration of FIP / BIP is 16 μM, the concentration of F3 / B3 is 2 μM, and the concentration of LF / LB is 4 μM. Then add 2 μL of the DNA template, or directly add 2 μL of the bacterial suspension of the sample to be tested. After that, use BeyoColor TM Isothermal Amplification Color Change Detection Kit (Supplier: Beyotime, Catalog Number: D8011S) for testing. Use 16S to determine whether it is Escherichia coli. If there are 3 or more positive results for other virulence genes, it is determined to be extraintestinal pathogenic Escherichia coli (ExPEC).

[0108] (2) Specificity experiment: Detect species specificity and specific genes. Use specific genes for positive control, and use Escherichia coli, Salmonella, and Proteus mirabilis that do not express the specific gene for negative control.

[0109] Figure 1 To verify the specificity of the 16S primer, Salmonella and Proteus mirabilis are used as negative controls to prove species specificity, and only Escherichia coli will show a positive result (the Escherichia coli isolated in the R382 laboratory, with positive ibeA, iucC, and sitA, is an extraintestinal pathogenic Escherichia coli). Figure 2 To verify the specificity of the ibeA primer, Salmonella and Proteus mirabilis are used as negative controls to prove species specificity, and Escherichia coli that does not express ibeA is used to prove the gene specificity of the primer. Only extraintestinal pathogenic Escherichia coli expressing the ibeA gene will show a positive result (R382 is the number of Escherichia coli isolated in the laboratory, with positive ibeA, iucC, and sitA, which is an extraintestinal pathogenic Escherichia coli; R107 is Escherichia coli isolated in the laboratory, which does not express ibeA). Figure 3 To verify the specificity of the iucC primer, Salmonella and Proteus mirabilis are used as negative controls to prove species specificity, and Escherichia coli that does not express iucC is used to prove the gene specificity of the primer. Only extraintestinal pathogenic Escherichia coli expressing the iucC gene will show a positive result (R382 is the number of Escherichia coli isolated in the laboratory, with positive ibeA, iucC, and sitA, which is an extraintestinal pathogenic Escherichia coli; R375 is Escherichia coli isolated in the laboratory, which does not express iucC). Figure 4To verify the specificity of the sitA primer, Salmonella and Proteus mirabilis were used as negative controls to prove species specificity, and Escherichia coli that does not express sitA was used to prove the gene specificity of the primer. Only enterotoxigenic Escherichia coli expressing the sitA gene would show a positive result (where R382 is the number of Escherichia coli isolated in the laboratory, which is positive for the expression of ibeA, iucC, and sitA, and it is an enterotoxigenic Escherichia coli; R350 is Escherichia coli isolated in the laboratory, which does not express sitA). Figure 5 To verify the specificity of the ISS primer, including species specificity and gene specificity, Salmonella and Proteus mirabilis were used as negative controls to prove species specificity, and Escherichia coli that does not express ISS was used to prove the gene specificity of the primer. Only enterotoxigenic Escherichia coli expressing the ISS gene would show a positive result (where R107 is an enterotoxigenic Escherichia coli isolated in the laboratory, which expresses ISS, iucC, and sitA, and it is an enterotoxigenic Escherichia coli; while R382 is Escherichia coli isolated in the laboratory, which is positive for the expression of ibeA, iucC, and sitA, but does not express ISS). Figure 6 To verify the specificity of the papC primer, including species specificity and gene specificity, Salmonella and Proteus mirabilis were used as negative controls to prove species specificity, and Escherichia coli that does not express papC was used to prove the gene specificity of the primer. Only enterotoxigenic Escherichia coli expressing the papC gene would show a positive result (where R375 is an enterotoxigenic Escherichia coli isolated in the laboratory, which expresses papC and hlyD; while R382 is Escherichia coli isolated in the laboratory, which is positive for the expression of ibeA, iucC, and sitA, but does not express papC). Figure 7 To verify the specificity of the hlyD primer, including species specificity and gene specificity, Salmonella and Proteus mirabilis were used as negative controls to prove species specificity, and Escherichia coli that does not express hlyD was used to prove the gene specificity of the primer. Only enterotoxigenic Escherichia coli expressing the hlyD gene would show a positive result (where R375 is an enterotoxigenic Escherichia coli isolated in the laboratory, which expresses papC and hlyD; while R382 is Escherichia coli isolated in the laboratory, which is positive for the expression of ibeA, iucC, and sitA, but does not express hlyD).

[0110] From the above Figures 1 - 7 it can be seen that the gene chip primers designed in the present invention have good specificity.

[0111] (3) Detection of anti-interference ability: Escherichia coli with the target gene was used as the target bacterium, and Escherichia coli without the target gene, Proteus mirabilis, and Salmonella were used as interfering bacteria. Each strain was mixed at a ratio of 1:1 to obtain 7 kinds of mixed bacteria to detect their anti-interference ability.

[0112] Figure 8 To verify the anti-interference ability of the ibeA primer, where R382 is Escherichia coli with the target gene, R375 is Escherichia coli isolated in the laboratory that does not express the ibeA target gene, and Salmonella and Proteus mirabilis do not express the target gene and are interference bacteria. Figure 9 To verify the anti-interference ability of the iucC primer, where R382 is Escherichia coli with the target gene, R375 is Escherichia coli isolated in the laboratory that does not express the iucC target gene, and Salmonella and Proteus mirabilis do not express the target gene and are interference bacteria. Figure 10 To verify the anti-interference ability of the sitA primer, where R382 is Escherichia coli with the target gene, R350 is Escherichia coli isolated in the laboratory that does not express the sitA target gene, and Salmonella and Proteus mirabilis do not express the target gene and are interference bacteria. Figure 11 To verify the anti-interference ability of the ISS primer, where R107 is Escherichia coli with the target gene, R375 is Escherichia coli isolated in the laboratory that does not express the ISS target gene, and Salmonella and Proteus mirabilis do not express the target gene and are interference bacteria. Figure 12 To verify the anti-interference ability of the hlyD primer, where R375 is Escherichia coli with the target gene, R382 is Escherichia coli isolated in the laboratory that does not express the hlyD target gene, and Salmonella and Proteus mirabilis do not express the target gene and are interference bacteria. Figure 13 To verify the anti-interference ability of the papC primer, where R375 is Escherichia coli with the target gene, R382 is Escherichia coli isolated in the laboratory that does not express the papC target gene, and Salmonella and Proteus mirabilis do not express the target gene and are interference bacteria.

[0113] From the above Figures 8 - 13 it can be seen that the gene chip primers designed in the present invention have good anti-interference ability.

[0114] (4) Sensitivity experiment:

[0115] 1) Primer sensitivity test for DNA concentration (R107 is used to detect the primer sensitivity to DNA concentration for 16S and ISS, R382 is used to detect the primer sensitivity to DNA concentration for iucC, sitA, and ibeA, and R375 is used to detect the primer sensitivity to DNA concentration for papC and hlyD): By adjusting the initial concentration of Escherichia coli DNA and performing 10-fold serial dilutions, DNA concentrations of 10 1 ~10 -4 ng / μL are prepared to evaluate the sensitivity of the primers. By observing the color development effect of the reaction indicator hydroxynaphthol blue (HNB), the lowest detection limit of the detection system is explored.

[0116] Figures 14 - 20 Respectively are the sensitivity photos of primers for verifying 16S, ibeA, ISS, iucC, sitA, hlyD, and papC to the DNA concentration of Escherichia coli; it can be seen that the lowest detection limit of 16S DNA is 10 -4 ng / μL, the lowest detection limit of ibeA DNA is 10 - 4 ng / μL, the lowest detection limit of ISS DNA is 10 -4 ng / μL, the lowest detection limit of iucC DNA is 10 -3 ng / μL, the lowest detection limit of sitA DNA is 10 -4 ng / μL, the lowest detection limit of hlyD DNA is 10 -2 ng / μL, the lowest detection limit of papC DNA is 10 -2 ng / μL.

[0117] 2) Primer sensitivity test for the concentration of bacterial suspension (R107 is used for 16S and ISS to detect the primer sensitivity to the concentration of bacterial suspension, R382 is used for iucC, sitA, and ibeA to detect the primer sensitivity to the concentration of bacterial suspension, and R375 is used for papC and hlyD to detect the primer sensitivity to the concentration of bacterial suspension): By adjusting the initial concentration of the Escherichia coli bacterial suspension and performing 10-fold serial dilutions, the bacterial suspension concentration is 10 2 ~10 -4 cfu / mL, and this is used to evaluate the primer sensitivity. By observing the HNB color development effect, the lowest detection limit of the detection system is explored.

[0118] Figures 21 - 27 Respectively are the sensitivity photos of primers for verifying 16S, sitA, iucC, ISS, ibeA, papC, and hlyD to the concentration of Escherichia coli bacterial suspension; it can be seen that the lowest detection limit of the 16S bacterial suspension is 10 -4 cfu / mL, the lowest detection limit of the sitA bacterial suspension is 10 -1 cfu / mL, the lowest detection limit of the iucC bacterial suspension is 10 -4 cfu / mL, the lowest detection limit of the ISS bacterial suspension is 10 -2 cfu / mL, the lowest detection limit of the ibeA bacterial suspension is 10 -4 cfu / mL, the lowest detection limit of the papC bacterial suspension is 10 -1 cfu / mL, the lowest detection limit of the hlyD bacterial suspension is 10 -4 cfu / mL.

[0119] (5) Reproducibility experiment: Directly smear the bacterial solution of R382 or R107 or R375 on chicken. Take 3 g of chicken sample and add it to 27 mL of BPW liquid medium. After mixing in a beating sterile homogenizer, take 10 mL of the liquid and culture it at 37 °C for 9 h. Use this liquid to detect the reliability and repeatability of the primer sets.

[0120] Figures 28 - 31 Photos showing the reproducibility of the primer pairs for 16S, iucC, sitA, and ibeA for the bacterial solution of Escherichia coli R382, respectively; Figure 32 Photo showing the reproducibility of the ISS primer pair for the bacterial solution of Escherichia coli R107; Figures 33 - 34 Photos showing the reproducibility of the primer pairs for papC and hlyD for the bacterial solution of Escherichia coli R375, respectively. It can be seen that the gene chip primers designed in the present invention all have good reproducibility.

[0121] The above has described the embodiments of the present invention in detail, but the present invention is not limited to the described embodiments. For those skilled in the art, without departing from the principle and spirit of the present invention, various changes, modifications, substitutions, and variations made to these embodiments still fall within the protection scope of the present invention.

Claims

1. A gene chip for rapid detection of enterotoxigenic Escherichia coli, characterized in that, The gene chip includes LAMP primers for detecting specific genes of enterotoxigenic Escherichia coli, namely 16S, iucC, iSS, ibeA, sitA, papC, and hlyD.

2. The gene chip for rapid detection of enterotoxigenic Escherichia coli according to claim 1, wherein The LAMP detection primers for each gene include 6 primers.

3. The gene chip for rapid detection of enterotoxigenic Escherichia coli according to claim 2, characterized in that, The gene chip includes FIP, BIP, B3, F3, LF, and LB for detecting the 16S gene as shown in SEQ ID No: 1-7, FIP, BIP, B3, F3, LF, and LB for detecting the ISS gene as shown in SEQ ID No: 7-12, FIP, BIP, B3, F3, LF, and LB for detecting the ibeA gene as shown in SEQ ID No: 13-18, FIP, BIP, B3, F3, LF, and LB for detecting the iucC gene as shown in SEQ ID No: 19-24, FIP, BIP, B3, F3, LF, and LB for detecting the sitA gene as shown in SEQ ID No: 25-30, FIP, BIP, B3, F3, LF, and LB for detecting the papC gene as shown in SEQ ID No: 31-36, and FIP, BIP, B3, F3, LF, and LB for detecting the hlyD gene as shown in SEQ ID No: 37-42.

4. The gene chip for rapid detection of enterotoxigenic Escherichia coli according to claim 1, characterized in that, The usage method of the gene chip is as follows: Mix the primers FIP / BIP, F3 / B3, LF / LB for detecting the specific genes 16S, iucC, iSS, ibeA, sitA, papC, hlyD of enterotoxigenic Escherichia coli, and add the DNA of the sample to be tested or the bacterial suspension of the sample to be tested, and then use the BeyoColor TM isothermal amplification color change detection kit for inspection.

5. A gene chip for rapid detection of enterotoxigenic Escherichia coli according to claim 4, characterized in that, The concentration of primers FIP / BIP is 16 μM, the concentration of F3 / B3 is 2 μM, and the concentration of LF / LB is 4 μM.

6. The gene chip for rapid detection of enterotoxigenic Escherichia coli according to claim 4, characterized in that, The reading standard for the detection results is: 16S is used to determine whether it is Escherichia coli, and if 3 or more of the other virulence genes are positive, it is determined to be enterotoxigenic Escherichia coli.

7. A gene chip for rapid detection of enterotoxigenic Escherichia coli according to claim 4, characterized in that, The minimum detection limit of the DNA of the sample to be tested is 10 -2 ng / μL.

8. A gene chip for rapid detection of enterotoxigenic Escherichia coli according to claim 4, characterized in that The minimum detection limit of the bacterial suspension of the sample to be tested is 10 -1 cfu / mL.

Images