Composition and kit for detecting klebsiella pneumoniae, enterococcus faecalis and drug resistance of klebsiella pneumoniae and enterococcus faecalis and application

Abstract

The invention relates to the technical field of biological detection, and discloses a composition for detecting klebsiella pneumoniae, enterococcus faecalis and drug resistance thereof, a kit and application. The composition provided by the invention comprises a primer pair capable of simultaneously and rapidly amplifying klebsiella pneumoniae, enterococcus faecalis and drug-resistant genes contained in the klebsiella pneumoniae and the enterococcus faecalis. By utilizing the composition disclosed by the invention, accurate detection of target bacteria and drug resistance thereof can be realized by adopting an in-vitro nucleic acid amplification means, and a new detection means is provided for work in the fields of scientific research, clinic and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, and particularly relates to a composition, a kit and an application for detecting Klebsiella pneumoniae and Enterococcus faecalis and their drug resistance. Background Art

[0002] Klebsiella pneumoniae is a Gram-negative bacillus of the genus Klebsiella in the Enterobacteriaceae family. It can cause respiratory tract infections, urinary tract infections, bloodstream infections, wound infections, etc. Diseases caused by Klebsiella pneumoniae account for more than 95% of diseases caused by Klebsiella infections.

[0003] Enterococcus faecalis is a facultative anaerobic Gram-positive bacterium. During the process of evolution, it will produce a certain amount of virulence genes, thus causing corresponding infections. The most common one is nosocomial infection, such as urinary tract infection, pelvic infection, abdominal cavity infection, infection after surgery, etc.

[0004] At present, one of the most effective treatment methods for infections caused by Klebsiella pneumoniae and Enterococcus faecalis is antibiotic treatment. However, the drug resistance of Klebsiella pneumoniae and Enterococcus faecalis to antibiotics is a serious problem, and the continuous increase of multi-drug resistant strains often leads to the failure of clinical antibacterial drug treatment and the prolongation of the disease course.

[0005] In order to improve the treatment efficiency, before treating infections caused by Klebsiella pneumoniae and Enterococcus faecalis, doctors usually consider the results of drug sensitivity tests and select appropriate antibiotics for treatment. However, the operation requirements of drug sensitivity tests are strict and the operation conditions are high. It can only be carried out in some medical institutions with conditions. Moreover, the interpretation of the results of drug sensitivity tests requires certain professional knowledge and experience. Therefore, its application is restricted by operation sites, equipment and personnel in many aspects. More importantly, the results of drug sensitivity tests generally take 3 - 5 days to come out, with slow detection speed and low efficiency, and it is difficult to meet the needs of clinical emergency patients for detection and medication.

[0006] Therefore, there is an urgent need to develop methods and related products that can quickly, accurately and highly sensitively detect Klebsiella pneumoniae and Enterococcus faecalis infections and determine their drug resistance. Summary of the Invention

[0007] The purpose of the present invention is to overcome the above problems existing in the prior art, and provide a composition, a kit and an application for detecting Klebsiella pneumoniae and Enterococcus faecalis and their drug resistance. The composition provided by the present invention and the kit based on this composition can realize the simultaneous, rapid and accurate detection of Klebsiella pneumoniae and Enterococcus faecalis and their drug resistance.

[0008] To achieve the above purpose, on the one hand, the present invention provides a composition, and the composition includes the following combination of primer A and primer B:

[0009] Primer A: selected from primers targeting target sequences in Klebsiella pneumoniae and / or Enterococcus faecalis, wherein the target sequence of Klebsiella pneumoniae is selected from the 600-750th nucleotides or fragments thereof of the ATPase-encoding gene in its genome, and the target sequence of Enterococcus faecalis is selected from the 250-450th nucleotides or fragments thereof of ftsH;

[0010] Primer B: selected from primers targeting at least one of the target sequences of third-generation cephalosporin resistance genes, fosfomycin resistance genes, and trimethoprim resistance genes, wherein the target sequence of the third-generation cephalosporin resistance gene is selected from at least one of the 1st-120th nucleotides or fragments thereof of CTX-M, the 800-1100th nucleotides or fragments thereof of AmpC, and the 180-380th nucleotides or fragments thereof of TEM; the target sequence of the fosfomycin resistance gene is selected from at least one of the 10-180th nucleotides or fragments thereof of fosA, the 1150-1380th nucleotides or fragments thereof of GlpT, and the 800-1050th nucleotides or fragments thereof of UhpT; the target sequence of the trimethoprim resistance gene is selected from the 1st-150th nucleotides or fragments thereof of dfr.

[0011] The second aspect of the present invention provides a kit, which contains the composition described in the first aspect.

[0012] The third aspect of the present invention provides the application of the composition described in the first aspect, or the kit described in the second aspect, in the combined detection of pathogens and their drug resistance.

[0013] The fourth aspect of the present invention provides a method for jointly detecting pathogens and their drug resistance in a sample, which includes performing nucleic acid amplification on the sample to be tested by using the composition described in the first aspect or the kit described in the second aspect.

[0014] By the above technical solutions, the present invention can at least achieve the following beneficial effects:

[0015] (1) The composition and kit provided by the present invention can at most simultaneously detect two different pathogenic bacteria and their three different drug resistances respectively. The detection process is only carried out by one PCR, which greatly improves the detection efficiency and reduces the detection cost.

[0016] (2) The composition of the present invention can detect pathogenic bacteria and their drug resistance in a sample by using in vitro nucleic acid amplification technologies such as fluorescence quantitative PCR. The operation is relatively simple, the detection process takes a short time, the detection specificity is strong, and this technology has relatively low requirements for the professional knowledge and experience of the detection personnel, and is suitable for application in primary medical detections.

[0017] (3) The primer pairs and probes included in the composition provided by the present invention will not aggregate with each other, and have good specificity, high detection sensitivity, convenient operation, and are suitable for large-scale popularization and application. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is a result diagram of detecting a mixed sample by using the kit of Example 1 in Example 2.

[0019] Figure 2 It is a result diagram of specifically testing multiple infectious pathogens by using the kit of Example 1 in Example 2.

[0020] Figure 3 It is a result diagram of separately detecting the fosA gene by using the corresponding primers and probes in Table 1 and Table 8 in Comparative Example 1.

[0021] Figure 4 It is a result diagram of detecting a mixed sample by using the kit of Comparative Example 1. DETAILED DESCRIPTION OF THE INVENTION

[0022] In the ranges disclosed herein, the endpoints and any values are not limited to the exact ranges or values. These ranges or values should be understood to include values close to these ranges or values. For numerical ranges, between the endpoint values of each range, between the endpoint values of each range and individual point values, and between individual point values, they can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.

[0023] The inventors of the present invention ingeniously designed a series of PCR primers and probes respectively according to specific target sequences in Klebsiella pneumoniae and Enterococcus faecalis and three common drug resistance genes in these two pathogenic bacteria during the research. These primers and probes will not produce non-specific binding or dimers, can coexist in the reaction system, and simultaneously perform PCR amplification on multiple target sequences, thereby realizing the simultaneous multiplex detection of different pathogenic bacteria and their drug resistance.

[0024] Based on this, the first aspect of the present invention provides a composition, and the composition includes the following combination of primer A and primer B:

[0025] Primer A: A primer selected from primers targeting target sequences in Klebsiella pneumoniae and / or Enterococcus faecalis, wherein the target sequence of Klebsiella pneumoniae is selected from the ATPase-encoding gene in its genome, and the target sequence of Enterococcus faecalis is selected from ftsH;

[0026] Primer B: A primer selected from at least one of primers targeting target sequences of third-generation cephalosporin resistance genes, fosfomycin resistance genes, and trimethoprim resistance genes, wherein the target sequence of the third-generation cephalosporin resistance gene is selected from at least one of CTX-M, AmpC, and TEM; the target sequence of the fosfomycin resistance gene is selected from at least one of fosA, GlpT, and UhpT; the target sequence of the trimethoprim resistance gene is selected from dfr.

[0027] In the present invention, the ATPase-encoding gene serving as the Klebsiella pneumoniae target sequence may be an ATPase-encoding gene involved in chromosome segregation. Those skilled in the art can obtain the corresponding gene sequence according to the species and the enzyme through commonly used databases in the art such as NCBI. For example, the gene with GeneID: 11850120 can be selected as the target sequence of Klebsiella pneumoniae (its specific sequence can be directly obtained from NCBI and will not be elaborated here).

[0028] In the present invention, the italicized ftsH, CTX-M, AmpC, TEM, fosA, GlpT, UhpT, dfr, etc. are gene names, and those skilled in the art can obtain the specific sequences of the corresponding genes by themselves through public databases such as NCBI. It should be noted that in the present invention, the target sequences of primer A and primer B can be the complete sequences of the above genes, or partial fragments of the above genes can be selected as the target sequences.

[0029] According to some preferred embodiments of the present invention, wherein, the target sequence of primer A can be at least one of the following:

[0030] Klebsiella pneumoniae target sequence: nucleotides 600-750 or a fragment thereof of the ATPase-encoding gene (GeneID: 11850120) involved in chromosome segregation in Klebsiella pneumoniae;

[0031] Enterococcus faecalis target sequence: nucleotides 250-450 or a fragment thereof of ftsH.

[0032] Preferably, the Klebsiella pneumoniae target sequence can be nucleotides 613-732 of the ATPase-encoding gene (Gene ID: 11850120) in Klebsiella pneumoniae.

[0033] Preferably, the Enterococcus faecalis target sequence can be nucleotides 268-429 of ftsH.

[0034] According to a preferred embodiment of the present invention, wherein, the Klebsiella pneumoniae target sequence can be as shown in SEQ ID NO: 31.

[0035] ATCCATCGTGATGAAAGCGTGGTGGAGGCCAATGCCTCGCAGAA GTCGATCCTGGACTTTAACGCTTCCTCGGCAGCGGCCTTCGATATTGA AATCATGGCTAAAAAAATATCTTCGCTG (SEQ ID NO: 31)

[0036] According to a preferred embodiment of the present invention, the Enterococcus faecalis target sequence may be as shown in SEQ ID NO: 32.

[0037] CAAGCGTCGTCAAAAGGCTTCACAACAACCGTTTTACCTAGTGATACAACCTTAGCTGGCATTCAAGATGCGGCACAAAATAACAAGGTGAAGCTAGTTGTCAAAGAACAATCAACAAGTGGTGCTTGGTTGTCACTGTTGTTTAGTTTCTTACCATTAGTG(SEQ ID NO: 32)

[0038] According to some preferred embodiments of the present invention, the target sequence of primer B may be at least one of the following:

[0039] Target sequence of third-generation cephalosporin resistance gene: at least one of nucleotides 1-120 or its fragment of CTX-M, nucleotides 800-1100 or its fragment of AmpC, and nucleotides 180-380 or its fragment of TEM;

[0040] Target sequence of fosfomycin resistance gene: at least one of nucleotides 10-180 or its fragment of fosA, nucleotides 1150-1380 or its fragment of GlpT, and nucleotides 800-1050 or its fragment of UhpT;

[0041] Target sequence of trimethoprim resistance gene: nucleotides 1-150 or its fragment of dfr.

[0042] Preferably, the target sequence of the third-generation cephalosporin resistance gene may be at least one of nucleotides 1-95 in CTX-M, nucleotides 851-1038 in AmpC, and nucleotides 216-340 in TEM.

[0043] Preferably, the target sequence of the fosfomycin resistance gene may be at least one of nucleotides 43-167 of fosA, nucleotides 1195-1347 of GlpT, and nucleotides 851-1015 of UhpT.

[0044] Preferably, the target sequence of the trimethoprim resistance gene may be nucleotides 1-123 of dfr.

[0045] According to a preferred embodiment of the present invention, the target sequence of the third-generation cephalosporin resistance gene may be shown as at least one of SEQ ID NO: 33-35.

[0046] ATGATGACTCAGAGCATTCGCCGCTCAATGTTAACGGTGATGGCG ACGCTACCCCTGCTATTTAGCAGCGCAACGCTGCATGCGCAGGCGAA CAG(SEQ ID NO:33, CTX-M target sequence)

[0047] GYCTGGGCTGGGAAATGCTGGACTGGCCGGTAAATCCTGACAKCATCRTTAACGGCAGYGACAATAAAATTGCACTGGCRGCACGYCCCGTAAAAGCGATTACGCCCCCARCKCCTGCAGTRCGCGCATCATGGGTACATAAAACRGGGGCGACCGGCGGATTTGGTAGCTATGTCGCGTTTATYCCA(SEQ ID NO:34, AmpC target sequence, which is described in the form of degenerate bases. Here, Y represents C or T, K represents G or T, R represents A or G. Any sequence formed by any base represented by the above degenerate bases in this sequence can be used as the AmpC target sequence)

[0048] TCTGCTATGTGGTGCGGTATTATCCCGTGTTGACGCCGGGCAAGA GCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTRAGTA CTCACCAGTCACAGAAAAGCATCTTACGGATG(SEQ ID NO:35, TEM target fragment, which is described in the form of degenerate bases. Here, R represents A or G. Any sequence formed by any base represented by the above degenerate bases in this sequence can be used as the TEM target sequence)

[0049] According to a preferred embodiment of the present invention, the fosfomycin resistance gene target sequence can be shown as at least one of SEQ ID NO:36 - 38.

[0050] CTGCAAAAAAGCGTCACCTTCTGGCACGAGCTGCTGGGTCTGACC CTGCACGCCCGCTGGAATACCGGGGCCTATCTCACCTGCGGCGATCTG TGGGTCTGCCTGTCGTACGACGAGGCGCGCCA(SEQ ID NO:36, fosA target sequence)

[0051] GCCGCGAGCGCCATTGTTGGCTATACCGTCGATTTCTTCGGCTGGGATGGCGGCTTCATGGTGATGATTGGCGGTAGCGTACTGGCGGTACTGCTGTTGATTATCGTCATGCTTGGCGAGCGTCGCCATCATCAACAACTGAAACAAGCCTAA(SEQ ID NO:37, GlpT target sequence)

[0052] TATACGCGTTCCAGGAACTGAAACTCTCTAAAGCGGTGGCGATTCAGGGCTTTACGCTGTTTGAAGCTGGTGCGCTGGTCGGTACGCTGCTGTGGGGCTGGCTCTCTGACCTGGCGAACGGTCGCCGTGGCCTGGTGGCCTGCATCGCGCTGGCGCTGATTATCG(SEQ ID NO:38, UhpT target sequence)

[0053] According to a preferred embodiment of the present invention, the trimethoprim resistance gene target sequence can be as shown in SEQ ID NO:39.

[0054] ATGTTAGCAGCCATTTGGGCCCAAGATGAACAAGGAGTGATTGG TAAAGAAGGCAAATTGCCTTGGCATTTACCCAACGACTTGAAATTTTT CAAGGAAAAAACAATTCATAATACATTGGTC(SEQ ID NO:39, dfr target fragment)

[0055] Preferably, no dimerization occurs between primer A and primer B. When primer A and / or primer B contains two or more primers, no dimerization occurs between the primers it contains.

[0056] Any primer that can be used to simultaneously amplify at least one target sequence targeted by primer A and at least one target sequence targeted by primer B above and does not dimerize is applicable to the present invention.

[0057] According to the preferred embodiment of the present invention, primer A includes primer pairs SEQ ID NO:1 and SEQ ID NO:2, and / or primer pairs SEQ ID NO:4 and SEQ ID NO:5.

[0058] According to a preferred embodiment of the present invention, primer B includes at least one pair selected from the primer pairs SEQ ID NO:7 and SEQ ID NO:8, primer pairs SEQ ID NO:10 and SEQ ID NO:11, primer pairs SEQ ID NO:13 and SEQ ID NO:14, primer pairs SEQ ID NO:16 and SEQ ID NO:17, primer pairs SEQ ID NO:19 and SEQ ID NO:20, primer pairs SEQ ID NO:22 and SEQ ID NO:23, and primer pairs SEQ ID NO:25 and SEQ ID NO:26.

[0059] According to a preferred embodiment of the present invention, the composition further includes the following combinations of probe A and probe B:

[0060] Probe A: a probe selected from probes targeting target sequences in Klebsiella pneumoniae and / or Enterococcus faecalis;

[0061] Probe B: a probe selected from at least one of probes targeting target sequences of third-generation cephalosporin resistance genes, fosfomycin resistance genes, and trimethoprim resistance genes.

[0062] In the present invention, the selected probe A and probe B need to correspond to the aforementioned primer A and primer B, that is, the target sequences targeted by probe A and primer A are the same, and the target sequences targeted by probe B and primer B are the same.

[0063] According to some preferred embodiments of the present invention, probe A includes SEQ ID NO:3 and / or SEQ ID NO:6.

[0064] According to some preferred embodiments of the present invention, probe B includes at least one of SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:24, and SEQ ID NO:27.

[0065] In the composition of the present invention, when a specific primer pair is used in combination with a specific probe, it has a good detection effect. For example, according to a preferred embodiment of the present invention, the composition includes any of the following combinations of primers and probes:

[0066] (1) A combination of primers and probes for detecting Klebsiella pneumoniae and primers and probes for detecting drug resistance genes,

[0067] Among them, the primers and probes for detecting Klebsiella pneumoniae are selected from the primer pair SEQ ID NO:1 and SEQ ID NO:2, and probe SEQ ID NO:3;

[0068] The primers and probes for drug resistance gene detection are selected from:

[0069] At least one set from primer pair SEQ ID NO:7 and SEQ ID NO:8, probe SEQ ID NO:9; primer pair SEQ ID NO:10 and SEQ ID NO:11, probe SEQ ID NO:12; primer pair SEQ ID NO:13 and SEQ ID NO:14, probe SEQ ID NO:15; and / or,

[0070] At least one set from primer pair SEQ ID NO:16 and SEQ ID NO:17, probe SEQ ID NO:18; primer pair SEQ ID NO:19 and SEQ ID NO:20, probe SEQ ID NO:21; primer pair SEQ ID NO:22 and SEQ ID NO:23, probe SEQ ID NO:24; and / or,

[0071] Primer pair SEQ ID NO:25 and SEQ ID NO:26, probe SEQ ID NO:27;

[0072] (2) The combination of primers and probes for Enterococcus faecalis detection and primers and probes for drug resistance gene detection,

[0073] Among them, the primers and probes for Enterococcus faecalis detection are selected from primer pair SEQ ID NO:4 and SEQ ID NO:5, probe SEQ ID NO:6;

[0074] The primers and probes for drug resistance gene detection are selected from:

[0075] At least one set from primer pair SEQ ID NO:7 and SEQ ID NO:8, probe SEQ ID NO:9; primer pair SEQ ID NO:10 and SEQ ID NO:11, probe SEQ ID NO:12; primer pair SEQ ID NO:13 and SEQ ID NO:14, probe SEQ ID NO:15; and / or,

[0076] At least one set from primer pair SEQ ID NO:16 and SEQ ID NO:17, probe SEQ ID NO:18; primer pair SEQ ID NO:19 and SEQ ID NO:20, probe SEQ ID NO:21; primer pair SEQ ID NO:22 and SEQ ID NO:23, probe SEQ ID NO:24; and / or,

[0077] Primer pair SEQ ID NO:25 and SEQ ID NO:26, probe SEQ ID NO:27;

[0078] (3) A combination of primers and probes for detecting Klebsiella pneumoniae, primers and probes for detecting Enterococcus faecalis, and primers and probes for detecting drug resistance genes,

[0079] wherein the primers and probes for detecting Klebsiella pneumoniae are selected from primer pair SEQ ID NO:1 and SEQ ID NO:2, probe SEQ ID NO:3;

[0080] The primers and probes for detecting Enterococcus faecalis are selected from primer pair SEQ ID NO:4 and SEQ ID NO:5, probe SEQ ID NO:6;

[0081] The primers and probes for detecting drug resistance genes are selected from:

[0082] At least one set of primer pair SEQ ID NO:7 and SEQ ID NO:8, probe SEQ ID NO:9; primer pair SEQ ID NO:10 and SEQ ID NO:11, probe SEQ ID NO:12; primer pair SEQ ID NO:13 and SEQ ID NO:14, probe SEQ ID NO:15; and / or,

[0083] At least one set of primer pair SEQ ID NO:16 and SEQ ID NO:17, probe SEQ ID NO:18; primer pair SEQ ID NO:19 and SEQ ID NO:20, probe SEQ ID NO:21; primer pair SEQ ID NO:22 and SEQ ID NO:23, probe SEQ ID NO:24; and / or,

[0084] Primer pair SEQ ID NO:25 and SEQ ID NO:26, probe SEQ ID NO:27.

[0085] According to a preferred embodiment of the present invention, wherein the probe is modified with a labeling group, preferably a fluorescent labeling group.

[0086] Preferably, different fluorescent labeling groups are modified on the probes (5'-ends) for different target sequences. Preferably, the different fluorescent labeling groups can be simultaneously detected through different channels. In some preferred embodiments, fluorescent labeling groups that can be detected using the same channel can be modified on the probes for different drug resistance genes of the same drug.

[0087] According to some preferred embodiments of the present invention, the fluorescent labeling group may be selected from at least one of ATTO 425, HEX, FAM, ROX, CY5, and Quasar705.

[0088] Preferably, a fluorescence quenching group is further modified on the probe (3' end). Preferably, the fluorescence quenching group is selected from at least one of BHQ1, BHQ2, and BHQ3.

[0089] In the above composition provided by the present invention, each primer and probe can be independently packaged or mixedly packaged. Since non-specific binding does not occur between the primers and probes in the above composition provided by the present invention, preferably, in order to save packaging materials and reduce production and use costs, the composition exists in a form of mixed packaging.

[0090] According to some preferred embodiments of the present invention, primers and probes for detecting internal standards may further be included in the composition.

[0091] There is no particular limitation in the present invention on the specific selection of the detection internal standard, and it can be selected by referring to the conventional methods in the art. Preferably, the detection internal standard may be at least one of human housekeeping genes.

[0092] The second aspect of the present invention provides a kit, which contains the composition described in the first aspect.

[0093] According to a preferred embodiment of the present invention, the kit further contains at least one of a buffer, an enzyme, and deoxynucleoside triphosphate.

[0094] Preferably, the buffer includes tris(hydroxymethyl)aminomethane hydrochloride buffer (Tris-HCl buffer).

[0095] Preferably, the enzyme includes at least one of UNG enzyme and DNA polymerase.

[0096] The present invention has no particular limitation on the source of deoxynucleoside triphosphate used in the kit, which can be a self-prepared or formulated product, or a finished product purchased through commercial channels. For example, commercially available dNTPs reagents (containing dATP, dTTP, dGTP, dCTP), dNTPs(U) reagents (containing dATP, dTTP, dGTP, dCTP, dUTP), etc.

[0097] More preferably, the kit further includes a positive control reagent and a negative control reagent.

[0098] The present invention has no particular limitation on the specific selection of the reagents used as positive control and negative control in the kit, and can be selected according to the conventional techniques in the art. For example, reagents such as physiological saline and buffer solution that do not contain the target sequence can be used as negative control, or internal standard gene pseudovirus can also be used as negative control. For another example, mixed plasmids containing the corresponding specific gene target sequences, DNA or RNA of the target gene fragment, pseudovirus, etc. can be used as positive control.

[0099] The third aspect of the present invention provides the use of the composition described in the first aspect, or the kit described in the second aspect, in the combined detection of pathogens and their drug resistance.

[0100] The composition and kit provided by the present invention can simultaneously detect two kinds of pathogenic bacteria, or can simultaneously detect one kind of pathogenic bacteria and its drug resistance to at least one class of drugs, or can also simultaneously detect two kinds of pathogenic bacteria and their drug resistance to at least one class of drugs, and at most can simultaneously detect two kinds of pathogenic bacteria and their drug resistance to three classes of drugs. Those skilled in the art can adjust the specific primer combinations contained in the kit according to the actual needs and the target sequences targeted by the specific primers in the foregoing composition, which will not be elaborated herein.

[0101] The fourth aspect of the present invention provides a method for jointly detecting pathogens and their drug resistance in a sample, the method comprising performing nucleic acid amplification on the sample to be tested using the composition described in the first aspect or the kit described in the second aspect.

[0102] Preferably, the method further includes analyzing the amplification result. In a preferred embodiment, since the probe is modified with a labeling substance such as a fluorescent labeling group, the pathogen or drug resistance gene can be qualitatively or quantitatively detected by fluorescence detection or other detection methods for the labeling substance.

[0103] The probe of the present invention is modified with different fluorescent labeling groups according to the types of pathogens (Klebsiella pneumoniae, Enterococcus faecalis) and drug resistance (third-generation cephalosporin resistance, fosfomycin resistance, trimethoprim resistance). Therefore, when the kit of the present invention contains primers and probes for detecting multiple pathogens and / or multiple drug resistances, the types of pathogens and drug resistance in the sample can be simultaneously detected by one nucleic acid amplification. For example, in some preferred embodiments of the present invention, the sample to be tested, the primers and probes for detecting the types of pathogens and different drug resistances in the kit can be added to the same PCR tube for in vitro nucleic acid amplification, and then the types of pathogens and drug resistance in the sample can be analyzed through the amplification results of different channels.

[0104] The present invention will be described in detail below through examples. It should be understood that the following examples are only used to further explain and illustrate the content of the present invention by way of example, and are not used to limit the present invention.

[0105] In the following examples, unless otherwise specified, the reagents and materials used are commercially available products purchased from regular chemical or biological reagent / material suppliers, and the reagents are all of analytical grade.

[0106] Example 1

[0107] This example is used to illustrate the preparation of the kit provided by the present invention.

[0108] 1. Prepare primers and probes

[0109] Entrust Hunan Kangde Biotechnology Co., Ltd. to synthesize primers and probes according to the sequences in Table 1.

[0110] Table 1

[0111]

[0112]

[0113] * In Table 1, the AmpC probe sequence is described in the form of degenerate bases, where K represents G or T, and R represents A or G. This probe is a mixture of sequences in which the nucleotides at the corresponding positions contain multiple bases corresponding to the degenerate bases.

[0114] 2. Prepare the unit reaction reagent set for PCR reaction

[0115] Prepare the corresponding reagents according to the amounts of reagents required for the unit reaction reagent set in Table 2 (i.e., the reagent set for detecting 1 sample in 1 PCR reaction).

[0116] Table 2

[0117]

[0118]

[0119] * In Table 2, the PCR buffer is the PCR buffer (S09) purchased from Hunan Kangde Biotechnology Co., Ltd.; the amounts of the upstream primer, downstream primer, and probe are the amounts for one sequence.

[0120] 3. Prepare control reagents

[0121] Negative control: Sterile normal saline.

[0122] Positive control: Target sequence mixed plasmid, which is made by inserting the target sequence into the pCDH plasmid. The target sequence is shown in Table 3 below.

[0123] Table 3

[0124] Name Sequence Klebsiella pneumoniae target sequence SEQ ID NO:31 Enterococcus faecalis target sequence SEQ ID NO:32 CTX-M target sequence SEQ ID NO:33 AmpC target sequence SEQ ID NO:34 TEM target sequence SEQ ID NO:35 fosA target sequence SEQ ID NO:36 GlpT target sequence SEQ ID NO:37 UhpT target sequence SEQ ID NO:38 drf target sequence SEQ ID NO:39

[0125] 4. Preparation of the kit

[0126] According to the target detection amount of a single kit, the reagents prepared in Steps 1-3 are combined and packaged.

[0127] Example 2

[0128] This example is used to illustrate the combined detection effect of the kit provided by the present invention on Klebsiella pneumoniae, Enterococcus faecalis and their drug resistance in samples.

[0129] In this example, the sample bacteria used as detection samples all come from Hunan Shengweier Medical Laboratory Center and have obtained the informed consent of relevant personnel. The sample bacteria have been verified by sequencing to contain the target sequences in Table 3.

[0130] (I) PCR detection

[0131] 300 μL of the sample bacteria suspension, negative control, and positive control were respectively taken into 1.5 mL centrifuge tubes, and nucleic acid extraction and purification were carried out using the nucleic acid extraction and purification reagents of Shengxiang Biotech Co., Ltd. according to the instructions. The purified DNA of each sample bacteria was mixed to form a mixed sample.

[0132] 10 μL of the processed mixed sample, 10 μL of the negative control, and 10 μL of the positive control were respectively added to PCR reaction tubes, and 40 μL of the unit PCR reaction reagent set (specific components refer to Table 2) was added to each tube. After mixing, it was placed in a fully automatic medical PCR analyzer (SALN-48S, Shanghai Hongshi Medical Technology Co., Ltd.) and PCR reaction was carried out according to the reaction conditions in Table 4.

[0133] Table 4

[0134]

[0135] Detection standard: Referring to Table 5, if there are obvious S-shaped amplification curves in the FAM, HEX, ROX, CY5, and 705 channels and the Ct value ≤ 38, it is judged as positive; if there is no amplification curve (No Ct) or the Ct value > 38 in the FAM, HEX, ROX, CY5, and 705 channels, it is judged as negative.

[0136] Table 5

[0137]

[0138] The detection results are as Figure 1 shown, which are consistent with the detection results of the positive control. According to the judgment criteria in Table 5, it is determined that all detections of this simulated sample to be detected are positive.

[0139] (II) Sensitivity test

[0140] The sensitivity (LOD) of each target was detected, and the specific method is as follows:

[0141] Gradient dilution solutions of each target sequence were prepared using the positive control plasmid prepared in Example 1, and the concentrations were diluted to 500, 300, and 100 copies / mL respectively. Then, the gradient dilution solutions of each target sequence were detected using the method in Experiment (1), and the detection limit of each target sequence was determined to be 500 copies / mL. The specific detection results (number of detections / number of repetitions) are shown in Table 6.

[0142] Table 6

[0143]

[0144] (3) Specificity test

[0145] Samples of infectious pathogens such as Staphylococcus aureus, Escherichia coli, Neisseria gonorrhoeae, Mycoplasma, Chlamydia, Citrobacter, Enterococcus faecalis, and Pseudomonas aeruginosa were detected using the method in Experiment (1). The results are as Figure 2 shown. It can be seen from the figure that the kit of the present invention shows obvious negative detection results for these infectious pathogens.

[0146] (4) Anti-interference test

[0147] The processed mixed samples were detected using the method in Experiment (1). The difference is that the interfering substances in Table 7 were added to them respectively, and the detection results are shown in Table 7.

[0148] Table 7

[0149] Interferent FAM Ct value HEX Ct value ROX Ct value CY5 Ct value Control (interferent-free mixed sample) 34.09 34.02 35.15 35.08 Dexamethasone (50 μg / mL) 34.59 34.19 35.93 35.26 Gentamicin (50 μg / mL) 34.34 35.28 35.51 35.83 Vancomycin (50 μg / mL) 35.81 34.47 34.74 34.44 Cefmenoxime hydrochloride (50 μg / mL) 35.27 35.30 35.23 35.82 Ciprofloxacin (50 μg / mL) 35.53 35.28 34.94 35.24 Compound sulfamethoxazole (50 μg / mL) 34.58 35.22 34.59 34.79 Clindamycin (50 μg / mL) 34.47 34.48 34.73 34.54 Hemin (10 μg / mL) 35.60 35.83 34.27 34.76 Hemoglobin (10 wt%) 34.90 34.77 35.69 35.20

[0150] It can be seen from the data in Table 7 that when the kit of the present invention is used for sample detection, it has good tolerance to PCR inhibitors / interfering substances.

[0151] (5) Stability test

[0152] Using the method in Experiment (1), the mixed samples and the positive control (a mixture of plasmids of each target sequence) were detected respectively, and each sample was detected 10 times repeatedly.

[0153] The detection results of the mixed samples and the positive control were similar and highly consistent (their amplification curves were Figure 1 similar), indicating that the kit of the present invention has good detection stability.

[0154] Comparative Example 1

[0155] The kit was prepared in the same manner as in Example 1, except that the detection primers and probes for the fosA gene conferring resistance to fosfomycin were replaced with the primers and probes shown in Table 8.

[0156] Table 8

[0157]

[0158] Using the method in Example 2, the fosA gene was separately detected using the primers and probes in the above table (SEQ ID NO: 28 - 30) and the primers and probes in Table 1 (SEQ ID NO: 16 - 18) (using the fosA gene plasmid used as a positive control in Example 1 as the detection sample). The results are shown in Figure 3 . As can be seen from the figure, the detection effects of the two are similar.

[0159] Using the method in Example 2, the kit of this comparative example was used to detect the mixed sample. The results are as shown in Figure 4 . By comparing the test results in Figure 1 and Figure 4 , it can be seen that when using the kit of this comparative example for detection, the fluorescence increment decreases and the Ct value is delayed, indicating that if an ideal detection effect (able to quickly and accurately detect Klebsiella pneumoniae, Enterococcus faecalis and their resistance to three different drugs in the sample simultaneously) is to be achieved, the primer and probe sequences selected in the kit provided by the present invention cannot be replaced.

[0160] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited thereto. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, including any other suitable combination of each technical feature. These simple modifications and combinations should also be regarded as the content disclosed by the present invention and fall within the protection scope of the present invention.

Claims

1. A composition, characterized in that, The composition comprises the following combination of primer A and primer B: Primer A: a primer selected from primers targeting target sequences in Klebsiella pneumoniae and / or Enterococcus faecalis, wherein the target sequence of Klebsiella pneumoniae is selected from the 600-750th nucleotides or fragments thereof of the ATPase-encoding gene in its genome, and the target sequence of Enterococcus faecalis is selected from the 250-450th nucleotides or fragments thereof of ftsH; Primer B: a primer selected from at least one of primers targeting target sequences of third-generation cephalosporin resistance genes, fosfomycin resistance genes, and trimethoprim resistance genes, wherein the target sequence of the third-generation cephalosporin resistance gene is selected from at least one of the 1-120th nucleotides or fragments thereof of CTX-M, the 800-1100th nucleotides or fragments thereof of AmpC, and the 180-380th nucleotides or fragments thereof of TEM; the target sequence of the fosfomycin resistance gene is selected from at least one of the 10-180th nucleotides or fragments thereof of fosA, the 1150-1380th nucleotides or fragments thereof of GlpT, and the 800-1050th nucleotides or fragments thereof of UhpT; the target sequence of the trimethoprim resistance gene is selected from the 1-150th nucleotides or fragments thereof of dfr.

2. The composition according to claim 1, wherein, The target sequence of Klebsiella pneumoniae is as shown in SEQ ID NO:31; and / or, the target sequence of Enterococcus faecalis is as shown in SEQ ID NO:32; and / or, the target sequence of the third-generation cephalosporin resistance gene is as shown in at least one of SEQ ID NO:33-35; and / or, the target sequence of the fosfomycin resistance gene is as shown in at least one of SEQ ID NO:36-38; and / or, the target sequence of the trimethoprim resistance gene is as shown in SEQ ID NO:39; Preferably, primer A comprises primer pairs SEQ ID NO:1 and SEQ ID NO:2, and / or, primer pairs SEQ ID NO:4 and SEQ ID NO:5; Preferably, primer B comprises at least one pair of primer pairs selected from primer pairs SEQ ID NO:7 and SEQ ID NO:8, primer pairs SEQ ID NO:10 and SEQ ID NO:11, primer pairs SEQ ID NO:13 and SEQ ID NO:14, primer pairs SEQ ID NO:16 and SEQ ID NO:17, primer pairs SEQ ID NO:19 and SEQ ID NO:20, primer pairs SEQ ID NO:22 and SEQ ID NO:23, and primer pairs SEQ ID NO:25 and SEQ ID NO:

26.

3. The composition according to claim 1 or 2, wherein, The composition further comprises the following combination of probe A and probe B: Probe A: a probe selected from probes targeting target sequences in Klebsiella pneumoniae and / or Enterococcus faecalis; Probe B: a probe selected from at least one of probes targeting target sequences of third-generation cephalosporin resistance genes, fosfomycin resistance genes, and trimethoprim resistance genes.

4. The composition according to claim 3, wherein Probe A comprises SEQ ID NO:3 and / or SEQ ID NO:6; And / or, probe B comprises at least one of SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:24, and SEQ ID NO:

27.

5. The composition according to any one of claims 1-4, wherein The composition comprises any one of the following combinations of primer and probe sets: (1) A combination of Klebsiella pneumoniae detection primers and probes and drug resistance gene detection primers and probes, wherein the Klebsiella pneumoniae detection primers and probes are selected from primer pair SEQ ID NO:1 and SEQ ID NO:2, and probe SEQ ID NO:3; The drug resistance gene detection primers and probes are selected from: primer pair SEQ ID NO:7 and SEQ ID NO:8, probe SEQ ID NO:9; primer pair SEQ ID NO:10 and SEQ ID NO:11, probe SEQ ID NO:12; primer pair SEQ ID NO:13 and SEQ ID NO:14, probe SEQ ID NO:15, at least one set; and / or, primer pair SEQ ID NO:16 and SEQ ID NO:17, probe SEQ ID NO:18; primer pair SEQ ID NO:19 and SEQ ID NO:20, probe SEQ ID NO:21; primer pair SEQ ID NO:22 and SEQ ID NO:23, probe SEQ ID NO:24, at least one set; and / or, primer pair SEQ ID NO:25 and SEQ ID NO:26, probe SEQ ID NO:27; (2) A combination of Enterococcus faecalis detection primers and probes and drug resistance gene detection primers and probes, wherein the Enterococcus faecalis detection primers and probes are selected from primer pair SEQ ID NO:4 and SEQ ID NO:5, and probe SEQ ID NO:6; The drug resistance gene detection primers and probes are selected from: primer pair SEQ ID NO:7 and SEQ ID NO:8, probe SEQ ID NO:9; primer pair SEQ ID NO:10 and SEQ ID NO:11, probe SEQ ID NO:12; primer pair SEQ ID NO:13 and SEQ ID NO:14, probe SEQ ID NO:15, at least one set; and / or, primer pair SEQ ID NO:16 and SEQ ID NO:17, probe SEQ ID NO:18; primer pair SEQ ID NO:19 and SEQ ID NO:20, probe SEQ ID NO:21; primer pair SEQ ID NO:22 and SEQ ID NO:23, probe SEQ ID NO:24, at least one set; and / or, primer pair SEQ ID NO:25 and SEQ ID NO:26, probe SEQ ID NO:27; (3) Combinations of primers and probes for detecting Klebsiella pneumoniae, primers and probes for detecting Enterococcus faecalis, and primers and probes for detecting drug resistance genes, wherein the primers and probes for detecting Klebsiella pneumoniae are selected from the primer pair SEQ ID NO:1 and SEQ ID NO:2, and the probe SEQ ID NO:3; the primers and probes for detecting Enterococcus faecalis are selected from the primer pair SEQ ID NO:4 and SEQ ID NO:5, and the probe SEQ ID NO:6; the primers and probes for detecting drug resistance genes are selected from: the primer pair SEQ ID NO:7 and SEQ ID NO:8, and the probe SEQ ID NO:9; the primer pair SEQ ID NO:10 and SEQ ID NO:11, and the probe SEQ ID NO:12; the primer pair SEQ ID NO:13 and SEQ ID NO:14, and the probe SEQ ID NO:15, at least one group of which; and / or, the primer pair SEQ ID NO:16 and SEQ ID NO:17, and the probe SEQ ID NO:18; the primer pair SEQ ID NO:19 and SEQ ID NO:20, and the probe SEQ ID NO:21; the primer pair SEQ ID NO:22 and SEQ ID NO:23, and the probe SEQ ID NO:24, at least one group of which; and / or, the primer pair SEQ ID NO:25 and SEQ ID NO:26, and the probe SEQ ID NO:

27.

6. The composition according to any one of claims 1-5, wherein, The probe is modified with a fluorescent labeling group.

7. A kit, characterized in that, The kit contains the composition according to any one of claims 1-6.

8. The kit according to claim 7, wherein, The kit further contains at least one of a buffer, an enzyme, and deoxyribonucleoside triphosphate; The buffer includes a tris(hydroxymethyl)aminomethane hydrochloride buffer; The enzyme includes at least one of UNG enzyme and DNA polymerase; Preferably, the kit further contains a positive control reagent and a negative control reagent.

9. Use of the composition according to any one of claims 1-6, or the kit according to claim 7 or 8 in the combined detection of pathogens and their drug resistance.

10. A method for jointly detecting pathogens and their drug resistance in a sample, characterized in that, The method includes performing nucleic acid amplification on a sample to be tested using the composition according to any one of claims 1-6 or the kit according to claim 7 or 8.

Images