A molecular marker, primer and application of a corn anti-lodging related gene Zmlrs1

Abstract

The application relates to the field of biotechnology, and particularly relates to a molecular marker, a primer and an application of a maize lodging-resistant related gene ZmLRS1. The nucleotide sequence of the gene ZmLRS1 is shown in SEQ ID NO. 1, the molecular marker Indel-1538 is subjected to deletion mutation of 26-37th 'AACAGCAGCAGC' in SEQ ID NO. 1, before the mutation, the nucleotide sequence is shown in SEQ ID NO. 4, and the Hap1 haplotype is strong in lodging resistance; after the mutation, the nucleotide sequence is shown in SEQ ID NO. 5, and the Hap2 haplotype is weak in lodging resistance. The molecular marker provided by the application can screen new maize varieties with lodging resistance through the nucleotide sequences of different haplotypes, and has important application value in improving the lodging resistance of maize.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a molecular marker, primers, and applications of the maize lodging resistance-related gene ZmLRS1. Background Technology

[0002] As one of the three major food crops, maize has developed into an important feed, industrial raw material, and biomass energy crop, playing a vital role in ensuring food security and promoting national economic development. However, with the frequent occurrence of natural disasters and increased planting density, lodging has become a major factor restricting safe maize production. Every 1% increase in lodging rate results in a yield reduction of approximately 108 kg / ha. -2 Each year, lodging of corn results in a yield reduction of 5% to 35%. Lodging can also cause mold growth in the kernels, reducing the quality of the corn. In addition, lodging hinders mechanization and increases harvesting costs.

[0003] Therefore, identifying molecular markers of lodging resistance genes in maize is of great significance for high and stable maize yields and mechanized harvesting. Summary of the Invention

[0004] To discover molecular markers for lodging resistance genes in maize, this invention provides a molecular marker Indel-1538 for the maize lodging resistance-related gene ZmLRS1, primers, and applications. The gene ZmLRS1 provided by this invention has the ability to regulate the lodging resistance of maize, and the molecular marker Indel-1538 developed from it can be used to screen new lodging-resistant maize varieties and germplasm, which has important application value for improving the lodging resistance of maize.

[0005] This invention provides a molecular marker, Indel-1538, for the maize lodging resistance-related gene ZmLRS1. The nucleotide sequence of the gene ZmLRS1 is shown in SEQ ID NO.1. The molecular marker Indel-1538 has a deletion mutation at positions 26-37 of SEQ ID NO.1, which is "AACAGCAGCAGC". Before the mutation, it is a Hap1 haplotype with a nucleotide sequence shown in SEQ ID NO.4, exhibiting strong lodging resistance. After the mutation, it is a Hap2 haplotype with a nucleotide sequence shown in SEQ ID NO.5, exhibiting weak lodging resistance.

[0006] The molecular marker Indel-1538 of the lodging-resistance-related gene ZmLRS1 provided by this invention is associated with the lodging resistance of maize. The lodging resistance trait of maize can be determined by examining the genotype and corresponding haplotype of the maize molecular marker Indel-1538; the Hap1 haplotype, with its nucleotide sequence shown in SEQ ID NO.4, exhibits strong lodging resistance, while the Hap2 haplotype, with its nucleotide sequence shown in SEQ ID NO.5, exhibits weak lodging resistance and can be used for breeding lodging-resistant maize varieties.

[0007] The present invention also provides a primer pair for amplifying the molecular marker Indel-1538, the sequence of which is shown in SEQ ID NO.2 to SEQ ID NO.3.

[0008] This invention also provides a method for identifying lodging-resistant maize varieties using the molecular marker Indel-1538 or the primer pair, characterized by comprising the following steps:

[0009] Genomic DNA was extracted from the maize sample to be tested;

[0010] Using maize genomic DNA as a template, PCR amplification was performed using the primer pairs shown in SEQ ID No. 2 to SEQ ID No. 3 to obtain PCR amplification products;

[0011] When the PCR amplification product fragment size is 160bp and the sequence is as shown in SEQ ID No.4, it is identified as haplotype Hap1, and maize exhibits strong lodging resistance. When the PCR amplification product fragment size is 148bp and the sequence is as shown in SEQ ID No.5, it is identified as haplotype Hap2, and maize exhibits weak lodging resistance.

[0012] Furthermore, the PCR amplification includes a PCR mix, a DNA template, primers Indel-1538-F and Indel-1538-R, and ddH2O.

[0013] Furthermore, the amplification procedure for the PCR amplification is as follows:

[0014] Pre-denaturation at 96℃ for 5 min; denaturation at 96℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 20 s, 36 cycles; termination reaction at 72℃ for 5 min, 12℃ for 10 min.

[0015] The present invention also provides an application of the molecular marker Indel-1538 or the primer pair described herein in maize breeding, using the molecular marker Indel-1538 or the primer pair to select lodging-resistant maize varieties.

[0016] Furthermore, the molecular marker Indel-1538 was amplified using the primer pairs shown in SEQ ID No. 2 to SEQ ID No. 3. The nucleotide sequence of haplotype Hap1 of molecular marker Indel-1538 is shown in SEQ ID No. 4, with a sequence length of 160 bp; the nucleotide sequence of haplotype Hap2 of molecular marker Indel-1538 is shown in SEQ ID No. 5, with a sequence length of 148 bp. Haplotype Hap1 has significantly higher lodging resistance than haplotype Hap2. The maize variety that amplifies the Hap1 haplotype is a lodging-resistant variety and can be used for later breeding.

[0017] Furthermore, the maize in question is a maize inbred line.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0019] This invention reveals for the first time that the gene ZmLRS1 participates in regulating the lodging stress response of maize and can enhance the lodging resistance of maize. The molecular marker Indel-1538 of the maize lodging resistance-related gene ZmLRS1 provided by this invention can be used to breed lodging-resistant maize varieties. Lodging-resistant maize varieties can be bred by using the nucleotide sequences corresponding to different genotypes of the molecular marker Indel-1538.

[0020] Haplotype analysis also revealed significant differences in lodging resistance among different haplotypes. The nucleotide sequence of haplotype Hap1 of the molecular marker Indel-1538 is shown in SEQ ID No. 4, with a sequence length of 160 bp; the nucleotide sequence of haplotype Hap2 of the molecular marker Indel-1538 is shown in SEQ ID No. 5, with a sequence length of 148 bp. Haplotype Hap1 exhibits significantly higher lodging resistance than haplotype Hap2. Maize varieties that amplify the Hap1 haplotype are lodging-resistant varieties and can be used for later breeding. Hap1 exhibits stronger lodging resistance than Hap2. Lodging resistance traits in maize can be determined by examining the genotype and corresponding haplotype of the maize molecular marker Indel-1538. This can be used for breeding lodging-resistant maize varieties. It can be used to screen new lodging-resistant maize germplasm and varieties, and has important application value for improving maize lodging resistance. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1Genome-wide association analysis of lodging traits in maize; in the figure, A is the .QQ plot; B is the Manhattan plot.

[0023] Figure 2 For candidate gene association analysis; in the figure, A represents candidate gene association analysis and LD analysis; B represents lodging phenotype difference analysis of different haplotypes; Note: *** represents P<0.001; R 2 It represents the degree of chain connection.

[0024] Figure 3 Analysis of root projected area for different haplotypes; Note: ** represents P<0.01.

[0025] Figure 4 The image shows the SDS-PAGE electrophoresis result of the Indel-1538 molecular label. Detailed Implementation

[0026] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0027] Example 1: Lodging resistance candidate genes were obtained by using genome-wide association analysis of lodging traits in natural populations in the field.

[0028] To identify genes controlling lodging in maize, this invention initially used 441 maize inbred lines as materials and employed a four-level evaluation index to investigate lodging occurrence. Genome-wide association analysis (GWAS) was conducted using 1.25 million SNP markers. A mixed linear model (MLM) was used to perform GWAS on lodging traits, identifying 11 QTL loci, named qLRS1.01, qLRS2.01, qLRS3.01, qLRS4.01, qLRS6.01, qLRS6.02, qLRS7.01, qLRS8.01, qLRS9.01, qLRS10.01, and qLRS10.02. Within 50 kb upstream and downstream of the qLRS4.01 locus, a gene encoding a transcription factor was found and named ZmLRS1. Figure 1 As shown.

[0029] Example 2: Association analysis of candidate gene ZmLRS1

[0030] To clarify whether the ZmLRS1 gene is associated with lodging resistance phenotype, this invention extracted SNPs and Indels from the resequencing data, specifically from the upstream 2kb, the ZmLRS1 region, and the downstream 0.5kb of the ZmLRS1 gene. After analyzing the sequencing results and removing SNPs with a minimum allele (MAF) < 0.05, 58 valid SNPs and Indels were identified. Using a general linear model, association analysis was performed on all SNPs and Indels with natural lodging, identifying 29 significant SNPs and Indels at the threshold (-log(p) > 4). Among these, SNP-1515, Indel-1538, SNP-1550, and Indel-1865 caused amino acid alterations. A change from G to C at position 1515 results in a change from glutamine (Gln) to histidine (His); a deletion of AACAGCAGCAGC at position 1538 leads to a deletion of four glutamine (Gln) bases; a change from T to C at position 1550 results in a change from valine (Val) to alanine (Ala); and a deletion of three ATG bases at position 1865 results in a deletion of one aspartic acid (Asp). SNP-1515 is most strongly associated with spontaneous lodging. Linkage disequilibrium analysis revealed a high degree of linkage among SNP-1515, Indel-1538, SNP-1550, and Indel-1865. Therefore, as... Figure 2 As shown, haplotypes are classified based on four SNPs / Indels, resulting in two haplotypes: haplotype 1 (Hap1) and haplotype 2 (Hap2). Haplotype 1 exhibits stronger lodging resistance than haplotype 2. The root projection area of ​​different haplotypes was also analyzed. Figure 3 As shown, the root area of ​​Hap1 was significantly higher than that of Hap2, indicating that Hap1 type materials have larger root systems and stronger lodging resistance. All these results demonstrate that the gene ZmLRS1 regulates the lodging resistance of maize. The nucleotide sequence of the gene ZmLRS1 is shown in SEQ ID No. 1.

[0031] SEQ ID No. 1: ATGGAGAACCACCA G CTGCAGCAGC AACAGCAGCAG CC GGCCGCTCCGG TGGCCGCCGCTGCCAGCTCCCCGCAGTACCGAGGCGTGAGGCGGCGGAAGTGGGGCAAGTGGGTGTCGGAGATCCGGCAGCCCGGCACCAAGGTCCGCGTCTGGCTCGGCAGCTTCGACTCCGCCGAGGCCGCGGCCGTGGCGCACGACGTGGCCGCG CTGTGCATGCGCGGCCCGCGGGACGGCAGCTCAACTTCCCGGGGTCCGCTGGGTGGCTGCCCCGCCCGGCCAGCACCGACCCAGCCGACATCCGCGCCGCCGCTGCTGAGGCAGCCGAGCGCGTGCGCCGTGAACCGGCGCTTGTCGGCACTGATG C CGCCGCCGAGCCCGGCAGGGGCCCTGCCAGTGCCAGCCGTCTTGACCTGGCCGTGGGACGAGTTTGACGACGACCTCGAGTCGCCCAGGCTGTGGACCGAGATGGCAGAGGCCATGCTGCTGGACCCACCTAAGTGGGGCCCGGATGGTAGCGACGGTTCCGAGGGCTCTGGCTCCCAGAATTGGCCCCATGGGTCCCTGTGGGATGCATGCTGA.

[0032] In the nucleotide sequence of the gene ZmLRS1, underlined nucleotides indicate mutation sites SNP-1515, Indel-1538, SNP-1550, and Indel-1865. Specifically, SNP-1515 is a mutation of "G" to "C" at position 15 of SEQ ID No.1; Indel-1538 is a deletion mutation of "AACAGC AGCAGC" at positions 26-37 of SEQ ID No.1; SNP-1550 is a mutation of "T" to "C" at position 50 of SEQ ID No.1; and Indel-1865 is a deletion mutation of "ATG" at positions 362-364 of SEQ ID No.1.

[0033] Example 3: Molecular marker development for gene ZmLRS1

[0034] Primers were designed based on Indel-1538, as shown in Table 1. The upstream primer Indel-1538-F is shown in SEQ ID No. 2, and the downstream primer Indel-1538-R is shown in SEQ ID No. 3.

[0035] Table 1 Indel-1538 molecular marker sequence

[0036] SEQ ID No.2 Indel-1538-F TAGCTAGCTTCTCCTCTCAT SEQ ID No. 3 Indel-1538-R CCTCGGTACTGCGGGGAGC

[0037] Based on the bands on the agarose gel electrophoresis image, Hap1 and Hap2 can be identified. The product length of haplotype Hap1 is 160 bp, and the product length of haplotype Hap2 is 148 bp. The band amplified by haplotype 1 is 12 bases longer than the band amplified by haplotype 2.

[0038] Example 4: Molecular marker verification

[0039] (1) Seven maize inbred lines of haplotype 1 (Hap1) and seven maize inbred lines of haplotype 2 (Hap2) were randomly selected for genomic DNA extraction. The lodging resistance of haplotype 1 was significantly higher than that of haplotype 2. The maize inbred lines of haplotype 1 (Hap1) were CIMBL94, CF3, IRF291, ZZ01, JI63, ZHONG69 and B73, and the maize inbred lines of haplotype 2 (Hap2) were BGY, 04K5686, TX5, YE515, XI502, QI205 and CIMBL105, all of which were from the laboratory of Professor Yan Jianbing of Huazhong Agricultural University.

[0040] (2) Using maize genomic DNA as a template, PCR amplification was performed using the nucleotide fragments shown in SEQ ID No.2 to SEQ ID No.3 as primers to obtain PCR amplification products.

[0041] The total PCR reaction volume (10 μL) is shown in Table 2:

[0042] Table 2 PCR amplification system

[0043] DNA 0.5 2x Magic Green Taq SuperMix 5 Indel-1538-F 0.5 Indel-1538-R 0.5 <![CDATA[ddH2O]]> 3.5

[0044] The PCR amplification procedure is shown in Table 3:

[0045] Table 3 PCR amplification program

[0046]

[0047] (3) The PCR amplification products were detected by SDS-PAGE electrophoresis to distinguish between the two haplotypes, such as... Figure 4 As shown, when the amplified fragment is 160 bp in size and has the sequence shown in SEQ ID NO.4, it is identified as Hap1; when the amplified fragment is 148 bp in size and has the sequence shown in SEQ ID NO.5, it is identified as Hap2. This indicates that the marker can effectively distinguish lodging-resistant materials.

[0048] SEQ ID NO.4:

[0049] TAGCTAGCTCTCCTCTCATCATCCGGCCGAGCGTTACCACATTGCGGAAAAAAACGCTCACGATCGATCAGCCATGGAGAACCACCAGCTGCAGCAGCAACAGCAGCAGCCGGCCGCTCCGGTGGCCGCCGCTGCCAGCTCCCCGCAGTACCGAGG.

[0050] SEQ ID NO.5:

[0051] TAGCTAGCTCTCCTCTCATCATCCGGCCGAGCGTTACCACATTGCGGAAAAAAACGCTCACGATCGATCAGCCATGGAGAACCACCAGCTGCAGCAGCCGGCCGCTCCGGTGGCCGCCGCTGCCAGCTCCCCGCAGTACCGAGG.

[0052] Table 4. Analysis of differences in lodging severity among materials with different haplotypes

[0053]

[0054] The above results demonstrate that Hap1 type materials have stronger lodging resistance. This marking can effectively distinguish lodging-resistant materials.

[0055] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments.

[0056] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A method utilizing maize lodging resistance-related genes ZmLRS1 A method for identifying lodging-resistant maize varieties using the molecular marker Indel-1538 or its primer pairs, characterized in that... Includes the following steps: The gene ZmLRS1 The nucleotide sequence is shown in SEQ ID NO.1, and the molecular marker Indel-1538 has a deletion mutation of "AACAGCAGCAGC" at positions 26-37 in SEQ ID NO.1; the primer pair is used to amplify the molecular marker Indel-1538; Genomic DNA was extracted from the maize sample to be tested; Using maize genomic DNA as a template, PCR amplification was performed using the primer pairs shown in SEQ ID No. 2~SEQ ID No. 3 to obtain PCR amplification products; When the PCR amplification product fragment size is 160bp and the sequence is as shown in SEQ ID No.4, it is identified as haplotype Hap1, and maize exhibits strong lodging resistance. When the PCR amplification product fragment size is 148bp and the sequence is as shown in SEQ ID No.5, it is identified as haplotype Hap2, and maize exhibits weak lodging resistance.

2. The method for identifying lodging-resistant maize varieties according to claim 1, characterized in that, The PCR amplification system includes PCR mix, DNA template, primers, and ddH2O.

3. The method for identifying lodging-resistant maize varieties according to claim 2, characterized in that, The PCR amplification program was as follows: 96℃ pre-denaturation for 5 min; 96℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 20 s, 36 cycles; 72℃ for 5 min, 12℃ for 10 min to terminate the reaction.

4. A method utilizing maize lodging resistance-related genes ZmLRS1 The application of the molecular marker Indel-1538 or primer pairs in maize breeding for lodging resistance is characterized by, Using the molecular marker Indel-1538 or primer pairs to breed lodging-resistant maize varieties; the primer pairs are used to amplify the molecular marker Indel-1538; the gene ZmLRS1 The nucleotide sequence is shown in SEQ ID NO.1, and the molecular marker Indel-1538 has a deletion mutation of "AACAGCAGCAGC" at positions 26-37 in SEQ ID NO.1; the primer pair sequences are shown in SEQ ID NO.2-SEQ ID NO.

3.

5. The application according to claim 4, characterized in that, The molecular marker Indel-1538 was amplified using the primer pairs shown in SEQ ID No. 2 to SEQ ID No.

3. The nucleotide sequence of haplotype Hap1 of molecular marker Indel-1538 is shown in SEQ ID No. 4, with a sequence length of 160 bp. The nucleotide sequence of haplotype Hap2 of molecular marker Indel-1538 is shown in SEQ ID No. 5, with a sequence length of 148 bp. Haplotype Hap1 has significantly higher lodging resistance than haplotype Hap2. The maize variety that amplifies the Hap1 haplotype is a lodging-resistant variety and can be used for later breeding.

6. The application according to claim 5, characterized in that, The maize in question is a maize inbred line.

Images