SSR marker and primer pair for distinguishing different varieties of medicago sativa and application of SSR marker and primer pair

By designing SSR markers and primer pairs, combined with PCR amplification and gel electrophoresis technology, the problem of distinguishing alfalfa varieties is solved, especially in salt tolerance, and the identification and breeding efficiency of germplasm resources are improved.

CN120249541AActive Publication Date: 2025-07-04BEIJING WELL GRASS CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510403031.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-01
Publication Date
2025-07-04
Estimated Expiration
2045-04-01

AI Technical Summary

Technical Problem

The prior art is difficult to effectively distinguish different varieties of alfalfa, especially in terms of salt tolerance, which affects the mining and breeding process of alfalfa germplasm resources.

Method used

A series of SSR labeling and corresponding primer pairs are designed and provided. Through PCR amplification and gel electrophoresis technology, it can specifically distinguish different alfalfa varieties, especially salt-resistant and salt-sensitive varieties.

Benefits of technology

The accurate distinction between different varieties of alfalfa is achieved, the efficiency of identification of germplasm resources and the pertinence of breeding is improved, and the market demand is met.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249541A_ABST
    Figure CN120249541A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of agricultural breeding, and particularly relates to an SSR marker for distinguishing different varieties of medicago sativa, a primer pair and application of the SSR marker and the primer pair. The SSR marker is selected from any one or a combination of a plurality of SSR (Simple Sequence Repeat)-121, SSR-122, SSR-125, SSR-127, SSR-165, SSR-191 or SSR-231. The SSR marker can be used for distinguishing different varieties of medicago sativa.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of PCR, and specifically relates to an SSR marker, a primer pair for distinguishing different varieties of alfalfa, and their applications. Background Art

[0002] Alfalfa (Medicago sativa L.) is an important forage crop worldwide and is known as the "king of forages" due to its strong stress resistance, high nutritional value, and high protein content. The germplasm resources of alfalfa are rich and have broad development prospects. To meet the domestic market demand for alfalfa, it is of great significance to explore high-quality germplasm resources and genes of alfalfa.

[0003] Simple sequence repeats (SSRs) are tandem repeat sequences composed of several nucleotides as repeat units, with lengths of dozens of nucleotides. They have characteristics such as good repeatability, rich polymorphism, co-dominance, high reliability, and easy amplification and analysis. The SSR molecular marker technology has now been widely applied in agricultural production, such as in multiple fields including genetic diversity research, germplasm resource evaluation, genetic map construction, gene mapping, and molecular marker-assisted selection breeding. Exploring more SSR markers related to species traits is of great significance for the genetic breeding of species. Summary of the Invention

[0004] Based on the problems existing in the prior art, the present invention provides an SSR marker for distinguishing different varieties of alfalfa, and this SSR marker can be used to distinguish different varieties of alfalfa.

[0005] The specific technical solutions provided by the present invention are as follows:

[0006] In the first aspect of the present invention, there is provided an SSR marker for distinguishing different varieties of alfalfa, and the SSR marker is selected from any one or a combination of several of SSR-121, SSR-122, SSR-125, SSR-127, SSR-165, SSR-191, and SSR-231;

[0007] The repeat unit of SSR-121 is T, and the repeat number is 14;

[0008] The repeat unit of SSR-122 is A, and the repeat number is 10;

[0009] The repeat unit of SSR-125 is T, and the repeat number is 11;

[0010] The repeat sequence of SSR-127 is (A)11tccaaaccatagcaaagcaacttgcttattcctttgaagatatttacttatctcctctagaacccaaacaaagaacacca cgtacaaattaacc(A)15ccacgtaaacaagtgcagcacagggcaagaacaaccaaaacattctcttatgctttcatcttca(TTG)6; where the numbers represent the repeat times of the bases within the parentheses in front of them;

[0011] The repeat unit of SSR-165 is CTT, and the repeat times is 5;

[0012] The repeat unit of SSR-191 is AG, and the repeat times is 10;

[0013] The repeat unit of SSR-231 is AAT, and the repeat times is 9.

[0014] In the second aspect of the present invention, a primer pair for detecting the SSR marker is provided, and the sequences of the primer pair are as follows:

[0015] The forward primer sequence for detecting SSR-121 is as shown in SEQ ID NO.3, and the reverse primer sequence is as shown in SEQ ID NO.4;

[0016] The forward primer sequence for detecting SSR-122 is as shown in SEQ ID NO.5, and the reverse primer sequence is as shown in SEQ ID NO.6;

[0017] The forward primer sequence for detecting SSR-125 is as shown in SEQ ID NO.11, and the reverse primer sequence is as shown in SEQ ID NO.12;

[0018] The forward primer sequence for detecting SSR-127 is as shown in SEQ ID NO.15, and the reverse primer sequence is as shown in SEQ ID NO.16;

[0019] The forward primer sequence for detecting SSR-165 is as shown in SEQ ID NO.19, and the reverse primer sequence is as shown in SEQ ID NO.20;

[0020] The forward primer sequence for detecting SSR-191 is as shown in SEQ ID NO.21, and the reverse primer sequence is as shown in SEQ ID NO.22;

[0021] The forward primer sequence for detecting SSR-231 is as shown in SEQ ID NO.23, and the reverse primer sequence is as shown in SEQ ID NO.24.

[0022] In the third aspect of the present invention, a kit for distinguishing different varieties of alfalfa is provided, and the kit includes the primer pairs described above.

[0023] In the fourth aspect of the present invention, there is provided a use of the SSR marker or the primer pair or the kit in distinguishing different varieties of alfalfa.

[0024] As a preferred embodiment of the present invention, the SSR marker or the primer pair or the kit is used to distinguish salt-tolerant varieties and salt-sensitive varieties of alfalfa.

[0025] Further preferably, SSR-121 is used to distinguish four varieties: Gannong No. 3, Gannong No. 5, Polar Bear and Lion;

[0026] SSR-122 is used to distinguish Gannong No. 3 and Gannong No. 5;

[0027] SSR-125 is used to distinguish Gannong No. 3 and Lion, Gannong No. 3 and Gannong No. 5, GIB and Lion, Polar Bear and Gannong No. 5;

[0028] SSR-127 and SSR-165 are used to distinguish three varieties: Lion, Gannong No. 5 and Polar Bear from Gannong No. 3;

[0029] SSR-191 is used to distinguish Gannong No. 3 and Lion, Gannong No. 3 and Gannong No. 5, Gannong No. 3 and Polar Bear;

[0030] SSR-231 is used to distinguish Gannong No. 5 and Gannong No. 3, Gannong No. 5 and Polar Bear, Gannong No. 5 and Lion;

[0031] The combinations of SSR-121 and SSR-122, SSR-121 and SSR-125, and SSR-122 and SSR-165 are used to distinguish four varieties: Gannong No. 3, Gannong No. 5, Polar Bear and Lion.

[0032] In the fifth aspect of the present invention, a method for distinguishing different varieties of alfalfa is provided, which is characterized by including the following steps:

[0033] Extract the genomic DNA of the sample to be tested;

[0034] Perform PCR amplification on the genomic DNA using the primer pairs;

[0035] Perform gel electrophoresis on the amplification products, and determine different varieties of alfalfa according to the electrophoresis results.

[0036] As a preferred embodiment of the present invention, the determined different varieties of alfalfa are Gannong No. 3, Gannong No. 5, Polar Bear and Lion;

[0037] When using the primer pair of SSR-121 to amplify four varieties, namely Gannong No. 3, Gannong No. 5, Polar Bear, and Lion, simultaneously, specific bands appear at 240 bp in the amplification products, which are determined to be Gannong No. 3; specific bands appear at 230 bp, 240 bp, and 265 bp, which are determined to be Gannong No. 5; specific bands appear at 230 bp, 240 bp, 250 bp, and 265 bp, which are determined to be Polar Bear; specific bands appear at 240 bp and 250 bp, which are determined to be Lion;

[0038] When using the primer pair of SSR-122 to amplify Gannong No. 3 and Gannong No. 5 simultaneously, specific bands appear at 270 bp, 280 bp, 800 bp, and 1200 bp in the amplification products, which are determined to be Gannong No. 3; specific bands appear at 270 bp, 280 bp, and 1200 bp, which are determined to be Gannong No. 5;

[0039] When using the primer pair of SSR-125 to amplify Gannong No. 5 and Polar Bear simultaneously, specific bands appear at 250 bp and 480 bp in the amplification products, which are determined to be Polar Bear; a specific band appears at 265 bp, which is determined to be Gannong No. 5;

[0040] When using the primer pair of SSR-125 to amplify Gannong No. 3 and Gannong No. 5 simultaneously, specific bands appear at 260 bp and 480 bp in the amplification products, which are determined to be Gannong No. 3; a specific band appears at 265 bp, which is determined to be Gannong No. 5;

[0041] When using the primer pair of SSR-125 to amplify Polar Bear and Lion simultaneously, specific bands appear at 250 bp and 480 bp in the amplification products, which are determined to be Polar Bear; a specific band appears at 270 bp, which is determined to be Lion;

[0042] When using the primer pair of SSR-125 to amplify Polar Bear and Gannong No. 5 simultaneously, specific bands appear at 250 bp and 480 bp in the amplification products, which are determined to be Polar Bear; a specific band appears at 265 bp, which is determined to be Gannong No. 5;

[0043] When using the primer pair of SSR-127 to amplify four varieties, namely Lion, Gannong No. 5, Polar Bear, and Gannong No. 3, simultaneously, a specific band appears at 270 bp in the amplification products, which are determined to be Lion;

[0044] When using the primer pair of SSR-165 to amplify four varieties, namely Lion, Gannong No. 5, Polar Bear, and Gannong No. 3, simultaneously, specific bands appear at 270 bp, 480 bp, 490 bp, 500 bp, and 590 bp in the amplification products, which are determined to be Lion;

[0045] When using the primer pair of SSR-191 to amplify Gannong No. 3 and Lishi simultaneously, specific bands appear at 220bp, 260bp, 270bp, 280bp, 480bp and 700bp in the amplification products, which is determined as Gannong No. 3; specific bands appear at 220bp, 260bp, 280bp, 480bp and 700bp, which is determined as Lishi;

[0046] When using the primer pair of SSR-191 to amplify Gannong No. 3 and Gannong No. 5 simultaneously, specific bands appear at 220bp, 260bp, 270bp, 280bp, 480bp and 700bp in the amplification products, which is determined as Gannong No. 3; specific bands appear at 220bp, 260bp, 270bp, 480bp and 700bp, which is determined as Gannong No. 5;

[0047] When using the primer pair of SSR-191 to amplify Gannong No. 3 and Polar Bear simultaneously, specific bands appear at 220bp, 260bp, 270bp, 280bp, 480bp and 700bp in the amplification products, which is determined as Gannong No. 3; specific bands appear at 220bp, 260bp, 270bp, 480bp and 700bp, which is determined as Polar Bear;

[0048] When using the primer pair of SSR-231 to amplify Gannong No. 5 and Gannong No. 3 simultaneously, a specific band appears at 230bp in the amplification products, which is determined as Gannong No. 3; specific bands appear at 200bp, 230bp and 240bp, which is determined as Gannong No. 5;

[0049] When using the primer pair of SSR-231 to amplify Gannong No. 5 and Polar Bear simultaneously, a specific band appears at 200bp in the amplification products, which is determined as Polar Bear; specific bands appear at 200bp, 230bp and 240bp, which is determined as Gannong No. 5;

[0050] When using the primer pair of SSR-231 to amplify Gannong No. 5 and Lishi simultaneously, a specific band appears at 190bp in the amplification products, which is determined as Lishi; specific bands appear at 200bp, 230bp and 240bp, which is determined as Gannong No. 5;

[0051] When using SSR-231 to amplify the four varieties of Gannong No. 3, Gannong No. 5, Polar Bear and Lishi simultaneously, a specific band appears at 190bp in the amplification products, which is determined as Lishi; a specific band appears at 200bp, which is determined as Polar Bear; a specific band appears at 230bp, which is determined as Gannong No. 3; specific bands appear at 200bp, 230bp and 240bp, which is determined as Gannong No. 5.

[0052] As a preferred embodiment of the present invention, each 10 μL PCR reaction system consists of the following components: 25 mmol·L -1 magnesium salt 0.8 μL - 1.1 μL, 100 μmol·L -1 each of the forward and reverse primers in Claim 1 is 0.4 μL - 1.0 μL, 10 mmol·L - 1 dNTPs 0.2 μL - 0.4 μL, 30 ng / μL DNA template 0.6 μL - 0.8 μL, 5 U / μL Taq DNA polymerase 0.1 μL and 10×Taq Buffer 1.0 μL, supplemented with water.

[0053] Further preferably, each 10 μL reaction system contains 25 mmol·L -1 Mg 2+ 0.8 μL, 10 mmol·L -1 dNTPs 0.2 μL, 10 μmol·L -1 each of the upstream and downstream primers is 0.4 μL, 30 ng / μL template DNA 0.8 μL, 5 U / μL Taq DNA polymerase 0.1 μL, 10×Taq Buffer 1.0 μL, ddH2O 6.3 μL.

[0054] As a preferred embodiment of the present invention, the PCR amplification program is: pre-denaturation at 95°C for 50 s, denaturation at 59°C for 40 s, extension at 72°C for 1 min, for 35 cycles.

[0055] The SSR markers provided by the present invention can be used to distinguish different varieties of alfalfa. Through experimental verification, SSR-121, SSR-125 and SSR-231 are used to distinguish alfalfa varieties Gannong No. 3, Gannong No. 5, Polar Bear and Lion; SSR-122 is used to distinguish the alfalfa salt-sensitive variety Gannong No. 3 from varieties Gannong No. 5, Polar Bear and Lion; SSR-127 and SSR-165 are used to distinguish the alfalfa salt-sensitive variety Lion from varieties Gannong No. 3, Gannong No. 5 and Polar Bear; SSR-191 is used to distinguish the alfalfa salt-tolerant varieties Polar Bear and Gannong No. 5 from the alfalfa salt-sensitive varieties Gannong No. 3 and Lion. Description of the Drawings

[0056] Figure 1 It is the electrophoresis result of alfalfa DNA quality detection. 1 - 8 are alfalfa varieties, referring to GN5 T , GN3 CK , GN3 T , LS CK , GIB T , GN5 CK , GIB CK, LS T ;

[0057] Figure 2 is the optimization of the SSR-PCR system; M refers to DNA Marker (100 - 2000 bp); 1 - 5 in A respectively refer to 25 mmol·L -1 ; Mg 2+ The dosages are 0.2, 0.5, 0.8, 1.1, 1.4 μL, with each level repeated twice; 1 - 5 in B respectively refer to 10 mmol·L - 1 The dosages of dNTPs are 0.2, 0.4, 0.6, 0.8, 1.0 μL, with each level repeated twice; 1 - 5 in C respectively refer to 100 μmol·L -1 The primers are each 0.2, 0.4, 0.6, 0.8, 1.0 μL, with each level repeated twice; 1 - 5 in D respectively refer to the template DNA content of 30 ng / μL being 0.6, 0.8, 1.0, 1.2 μL, with each level repeated twice; 1 - 5 in E respectively refer to the annealing temperatures of: 53 °C, 55 °C, 57 °C, 59 °C, 61 °C, with each level repeated twice; 1 - 4 in F respectively refer to the number of cycles of: 33 times, 34 times, 35 times, 36 times, with each level repeated twice.

[0058] Figure 3 are the functional classification (A) of differentially expressed functional genes containing SSR loci related to salt stress response and the gene region positions (B) of SSR repeat motifs in each functional category of genes related to salt stress response.

[0059] Figure 4 is the distribution map of SSR markers related to salt stress response on 30 Medicago sativa chromosomes.

[0060] Figure 5 are the amplification maps of 7 pairs of key salt-tolerant polymorphic SSR markers screened from Medicago sativa; four bands in the figure are in a group (a - d), and the order of each group is GN3, GIB, LS, and GN5 in sequence, and M is the molecular weight marker.

[0061] Figure 6 is the UPGMA cluster map of Nei's genetic distance of 4 alfalfa varieties. Specific Embodiments

[0062] To make the above objects, features, and advantages of the present invention more obvious and understandable, the specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings of the specification.

[0063] In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. However, the present invention may be practiced in other ways than those specifically described herein, and those skilled in the art may make similar generalizations without departing from the spirit of the present invention. Therefore, the present invention is not limited by the specific embodiments disclosed below.

[0064] Secondly, as used herein, "one embodiment" or "an embodiment" refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor is it an individual or alternative embodiment that is mutually exclusive with other embodiments. The present invention provides the following embodiments.

[0065] Example 1

[0066] Screening of SSR Locus Markers

[0067] 1. DNA Extraction and Detection of Alfalfa

[0068] Using the M5 Plant Genomic DNA Kit (MF070 - 01, unit of 50T) from Beijing Polymer Beauty Biotechnology Co., Ltd., DNA was extracted from 8 samples of 4 alfalfa varieties under 0 (CK) and 200 mmol·L -1 NaCl (T) treatments, including: Gannong No. 3 (control group marked as GN3 CK , sample group marked as GN3 T ), Gannong No. 5 (control group marked as GN5 CK , sample group marked as GN5 T ), Lishi (control group marked as LS CK , sample group marked as LS T ), and Polar Bear (control group marked as GIB CK , sample group marked as GIB T ). Fresh young leaf tissues were selected as materials, added with liquid nitrogen and ground thoroughly to break them, and extraction was carried out with reference to the DNA extraction kit instruction manual. The DNA solution was stored at -20 °C for later use. The quality of the extracted DNA was detected using 1% agarose gel, and the gel imaging system was used for identification and photography. The DNA concentration was detected by a ultra - micro spectrophotometer. 1 μL of the eluent was used for zero adjustment, and the concentration of 1 μL of the DNA sample solution and the OD 260nm / OD 280nm value were measured. For subsequent experiments, DNA with OD values in the range of 1.8 - 2.0 was taken, and the concentration of double - stranded DNA was estimated based on the fact that an optical density of 1 OD value is equivalent to 50 μg·mL -1 .

[0069] The results showed ( Figure 1), 8 sample strips were clear and complete without obvious trailing, indicating that the extracted DNA had good quality. After detection by a ultra-micro spectrophotometer, the OD 260nm / OD 280nm value of Medicago sativa GN3T sample DNA was between 1.8 and 2.0, and its DNA had high purity, which was selected for subsequent experiments. The DNA concentration of each sample was about 30 ng / g.

[0070] 2. Primer Design

[0071] Primer 5.0 software was used for primer design, and the main reference values for primer synthesis were selected: (1) The primer length was preferably about 20 bp; (2) The annealing temperature (Tm) was between 55 °C and 65 °C, and the annealing temperature difference between the upstream and downstream primers was less than 0.5 °C; (3) The GC content was not less than 40%; (4) The length of the PCR product was in the range of 100 - 300 bp. The primers were entrusted to General Biology (Anhui) Co., Ltd. for synthesis.

[0072] 3. Detection of Amplification Products

[0073] The SSR-PCR amplification products were subjected to non-denaturing polyacrylamide gel electrophoresis (PAGE). 20 ml of the gel contained: Arc:Bis (29:1, mass ratio) 4 ml, 5×TBE 4 ml, TEMED 13 μl, 10% APS 0.14 ml; The PCR products were separated on a 6.0% polyacrylamide gel. The pre-electrophoresis voltage was 60 V, current was 55 mA, power was 60 W. After 30 min, the samples were loaded, and the electrophoresis was carried out at a voltage of 120 V, current of 100 mA, and power of 65 W for 2.5 - 3.0 h; The gel was fixed with a fixing solution (25 mL of absolute ethanol + 1.25 mL of glacial acetic acid + 223.75 mL of ddH2O made up to 250 mL in a volumetric flask) for 13 - 18 min; Stained with 0.1% AgNO3 solution for 15 min; After washing twice with distilled water, developed in a developing solution (3.75 g of NaOH + 2 mL of formaldehyde + 100 μL of 1% sodium thiosulfate solution + 244.53 mL of ddH2O made up to 250 mL in a volumetric flask); Photographed.

[0074] 4. Data Analysis

[0075] During statistics, according to the agarose gel electrophoresis pattern of SSR-PCR, the bands at the same migration position were considered as the same genetic locus. At the same locus, a clear, non-trailing, and easily distinguishable band was recorded as "1", and no band was recorded as "0". According to the artificial band reading results, in the Excel table, the row name was the band name, and the column name was the sample name, to construct a "0 - 1" matrix diagram. PopGene32 software was used to calculate the Nei's genetic distance and Nei's genetic similarity of each variety; The formula for Nei's genetic similarity (S) is: Sxy = 2N xy / (N x + N y ), where S xy is the genetic similarity coefficient between variety x and variety y, N xy is the number of bands shared by varieties x and y, N x and N y are the polymorphic band numbers of varieties x and y respectively; the calculation formula for the Nei's genetic distance (D) between varieties is: D = -ln I, where x i and y i represent the frequencies of the i-th band in varieties x and y respectively. The unweighted pair group method with arithmetic means (UPGMA) dendrogram of the Nei's genetic distance of each variety was constructed using NTSYS2.10e software.

[0076] 5. Experimental design for optimizing the SSR-PCR reaction system

[0077] Select the DNA of GN3 with better quality from the extracted DNA as the experimental template, and optimize the PCR reaction system using the designed SSR-120 primer pair. The target amplification fragment length is 274 bp. T The forward primer sequence of SSR-120 is: 5'-TGGATGTTGAACCATGGCCT-3', SEQ ID NO.1; the reverse primer sequence is: 5'-GCCAACCCAATCAAAAGGACA-3', SEQ ID NO.2.

[0078] The initial reaction system: 0.1 μL of 5 U / μL Taq DNA polymerase, 0.8 μL of 25 mmol·L

[0079] Mg -1 0.8 μL, 0.2 μL of 10 mmol·L 2+ dNTPs, 0.4 μL each of the upstream and downstream primers, 1.0 μL of 30 ng·μL - 1 template DNA, 1.0 μL of 10× TaqBuffer, 1.0 μL. The experiment uses a 10 μL system, and the insufficient part is made up with ddH2O. -1 The initial PCR amplification program: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 50 s, annealing at 60°C for 40 s, extension at 72°C for 1 min, set 35 cycles of denaturation-annealing-extension, then continue at 72°C for 5 min, and store at 10°C. -1 The initial reaction system: 0.1 μL of 5 U / μL Taq DNA polymerase, 0.8 μL of 25 mmol·L

[0080] The initial PCR amplification program: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 50 s, annealing at 60°C for 40 s, extension at 72°C for 1 min, set 35 cycles of denaturation-annealing-extension, then continue at 72°C for 5 min, and store at 10°C.

[0081] Using the single-factor experiment method, six factors in the SSR-PCR reaction system, namely dNTP concentration, Mg 2+ concentration, primer concentration, DNA template concentration, annealing temperature, and number of cycles, were optimized. Five levels were set for each factor (Table 1), and each level was repeated twice to determine the optimal 10-μL SSR-PCR reaction system suitable for alfalfa.

[0082] Table 1 Factors and levels of the single-factor experiment for the SSR-PCR reaction system of alfalfa

[0083]

[0084] As can be seen from Figure 2 A in it, when the Mg 2+ dosage was 0.2 μL, no bands were amplified; when the dosage was 1.4 μL, the bands were weak and the amplification products were unstable; when the Mg 2+ dosage was 0.5 - 1.1 μL, the amplified bands were obvious and the amplification products were stable. However, when the dosage was 0.5 μL, there were obvious extra miscellaneous bands in the amplification background; when the dosage was 1.1 μL, the bands had a trailing phenomenon and the repeatability was not high. Therefore, in the SSR-PCR amplification system (10 μL), 25 mmol·L -1 Mg 2+ dosage of 0.8 μL was selected as the optimal dosage.

[0085] As can be seen from Figure 2 B in it, when the dNTP dosage was 0.2 - 0.4 μL, the amplified bands were clear and bright with fewer miscellaneous bands. Starting from 0.4 μL, the amplified bands were not clear enough and lacked integrity. When the dosage reached 1.0 μL, the cleanliness of the amplification background was not good and there was a trailing phenomenon. Therefore, in the SSR-PCR amplification system (10 μL), 10 mmol·L -1 dNTP dosage of 0.2 μL was selected as the optimal dosage.

[0086] As can be seen from Figure 2 C in it, when the upper and lower primer dosages were less than 0.4 μL, no bands could be amplified; when the upper and lower primer dosages reached 0.4 μL, the amplified bands were clear and bright and had a high repeatability. As the primer dosage increased, the electrophoresis results changed little. Therefore, in the SSR-PCR amplification system (10 μL), the optimal upper and lower primer dosage was selected as 0.4 μL.

[0087] As can be seen from Figure 2As can be seen from Figure D, when the amount of template DNA is 0.6 μL, the amplified bands are relatively weak and the products are difficult to detect; when the template content increases to 0.8 μL, clear bands can appear, showing the best amplification effect; as the amount of template DNA further increases, bands can be amplified, but the bands are not clear and bright enough and the repeatability is also poor. Therefore, in the SSR-PCR amplification system (10 μL), the amount of template DNA is selected as 0.8 μL, that is, 24 ng, which is the best.

[0088] As can be seen from Figure 2 Figure E, when the annealing temperature is 53 - 57 °C, the mismatch rate of the amplified products is high, the amplified products are not obvious, and no clear and stable bands appear; when the annealing temperature is 59 °C, there are relatively stable visible bands, there are no miscellaneous bands in the band background, and the amplification result is relatively good; when the annealing temperature reaches 61 °C, the amplification efficiency is low and no bands can be observed. Therefore, the optimal annealing temperature in the SSR-PCR amplification system (10 μL) is 59 °C.

[0089] As can be seen from Figure 2 Figure F, when the number of cycles is 33, 34, and 36 times, the amplified bands are blurred or cannot be shown; when the number of cycles is 35 times, the amplified bands are clear and distinguishable, and the repeatability is excellent. Therefore, 35 times is selected as the optimal number of cycles for the PCR program in the SSR-PCR amplification system (10 μL).

[0090] In summary, the SSR-PCR amplification system (10 μL) consists of the following components: in each 10 μL reaction system, it contains 25 mmol·L - 1 Mg 2+ 0.8 μL, 10 mmol·L -1 dNTPs 0.2 μL, 10 μmol·L -1 0.4 μL of each of the upstream and downstream primers, 0.8 μL of 30 ng / μL template DNA, 0.1 μL of 5 U / μL Taq DNA polymerase, 1.0 μL of 10× Taq Buffer, and 6.3 μL of ddH2O.

[0091] The optimal reaction cycling conditions are: 95 °C for 50 s, 59 °C for 40 s, 72 °C for 1 min, for 35 cycles.

[0092] 6. Development of SSR Polymorphic Loci

[0093] 6.1 Analysis of Differential Expression of Genes Containing SSR Loci

[0094] Based on transcriptome data, 22,445 genes were successfully screened from 28,039 genes containing SSR loci. Differential expression analysis was performed on 22,445 Unigenes containing SSR loci (screening criteria: |log2(fold change)|≥1 and Q<0.05), and a total of 1,947 differentially expressed genes were obtained. Under control conditions, between two alfalfa varieties, GIB (salt-tolerant alfalfa variety) and LS (salt-sensitive alfalfa variety), 407 differentially expressed genes (96 up-regulated and 311 down-regulated) were identified in leaves, and 311 differentially expressed genes (99 up-regulated and 212 down-regulated) were identified in roots; under 200 mmol / L NaCl treatment, the value in leaves was 152 differentially expressed functional genes (27 up-regulated and 125 down-regulated), and the value in roots was 172 differentially expressed genes (99 up-regulated and 73 down-regulated). In addition, compared with the control group, in GIB under NaCl treatment, 430 genes (291 up-regulated and 139 down-regulated) in leaves and 219 genes (130 up-regulated and 89 down-regulated) in roots were differentially expressed. In contrast, in LS, there were 655 differentially expressed genes (464 up-regulated and 191 down-regulated) in leaves and 409 differentially expressed genes (157 up-regulated and 252 down-regulated) in roots.

[0095] 6.2 Functional analysis of differentially expressed genes containing SSR loci

[0096] The damage of salt stress to plants mainly includes ion toxicity effect, osmotic stress effect and a series of secondary stress effects such as oxidative stress caused by the action of both on plants. Plants adapt to these stress effects through intracellular regulation. Based on GO and KEGG analysis, a total of 192 differentially expressed functional genes containing SSR loci involved in signal transduction pathways (37), metabolic synthesis (29), reactive oxygen species (ROS) scavenging (20), transcription factors (68) and ion transport (34) were identified ( Figure 3 in A).

[0097] In addition, the present invention also analyzed the distribution of SSR repeat motifs in the gene regions (exons, 3'UTR and 5'UTR) of five functional classifications ( Figure 3 in B). The position of the largest number of SSR repeat motifs in the three gene regions is transcriptional regulation ( Figure 3 in B). Among the 192 salt stress-related differentially expressed functional genes, some genes contain two or more SSR loci. According to the criteria for SSR primer design, a total of 211 pairs of SSR primers were designed. At the same time, based on local BLAST sequence alignment, 155 functional genes containing SSR loci were successfully matched with the reference genome of cultivated alfalfa, and 200 SSR loci among the 211 SSR markers were successfully mapped on 30 alfalfa chromosomes.Figure 4 )

[0098] 6.3 Detection of Key SSRs Involved in the Salt Stress Response of Alfalfa

[0099] PCR amplification was performed on 211 pairs of SSR primers designed with the established optimal SSR-PCR reaction system in 4 alfalfa varieties (LS, GN3, GN5, GIB). The results of SSR-PCR amplification showed that 7 pairs of SSR primers (SSR121, SSR122, SSR125, SSR127, SSR165, SSR191, SSR231) amplified obvious characteristic bands among the varieties. In the Excel table, the row names were the band names and the column names were the sample names, and a "0-1" matrix was constructed (Table 2) for the purity and salt tolerance identification of each variety. The previous research results of the research team of the present invention showed that the salt tolerance characteristics of each variety at the seedling stage were LS < GN3 < GN5 < GIB in turn; the salt tolerance characteristics of each variety at the germination stage were LS < GN5 < GN3 < GIB in turn. Among them, GIB was salt-tolerant, GN5 was salt-tolerant, GN3 was salt-tolerant at the germination stage but salt-sensitive at the seedling stage, and LS was salt-sensitive. According to the amplification band pattern distribution of 7 pairs of polymorphic SSR primers, there were obvious separations of the relevant bands among the tested varieties of GN3, GN5, GIB and LS ( Figure 5 ), and it was more reliable to use them to identify the variety purity and screen the markers related to salt tolerance.

[0100] Table 2 "0-1" Matrix Table of PCR Amplification of 7 Pairs of SSR Primers

[0101]

[0102]

[0103] The SSR121 primer located on chromosome 2 amplified a band at 1 locus (about 240 bp) in GN3; 4 bands (about 230 bp, 240 bp, 250 bp and 265 bp) were amplified at 4 loci in GIB; 2 bands (about 240 bp and 250 bp) were amplified at 2 loci in LS; 3 bands (about 230 bp, 240 bp and 265 bp) were amplified at 3 loci in GN5 ( Figure 5 ; Table 3).

[0104] The SSR122 primer located on chromosome 3 amplified bands at 4 loci (about 270 bp, 280 bp, 800 bp and 1200 bp) in GN3; 1 band (about 270 bp) was amplified at 1 locus in GIB and LS; 3 bands (about 270 bp, 280 bp and 1200 bp) were amplified at 3 loci in GN5 ( Figure 5 ; Table 3).

[0105] The SSR125 primer located on chromosome 5 amplified bands at 2 loci (around 260bp and 480bp) in GN3; 2 loci (around 250bp and 480bp) in GIB; 1 locus (around 270bp) in LS; and 1 locus (around 265bp) in GN5. Figure 5 ; Table 3).

[0106] For the SSR127 primer located on chromosome 5, only LS amplified a band at 1 locus, distributed around 270bp Figure 5 ; Table 3), and no bands were amplified in the other three varieties.

[0107] The SSR165 primer located on chromosome 8 amplified bands at 5 loci (around 270bp, 480bp, 485bp, 500bp, and 600bp) in GN3, GIB, and GN5 respectively; and LS amplified bands at 5 loci (around 270bp, 480bp, 490bp, 500bp, and 590bp) Figure 5 ; Table 3).

[0108] The SSR191 located on chromosome 4 amplified bands at 6 loci (around 220bp, 260bp, 270bp, 280bp, 480bp, and 700bp) in GN3; 5 loci (around 220bp, 260bp, 270bp, 480bp, and 700bp) in GIB and GN5; and 5 loci (around 220bp, 260bp, 270bp, 480bp, and 700bp) in LS Figure 5 ; Table 3).

[0109] The lengths of the bands amplified by the SSR231 primer located on chromosome 8 varied greatly among the varieties. GN3 amplified a specific band around 230bp, GIB amplified a specific band around 200bp, LS amplified a specific band around 190bp, and GN5 amplified relatively faint specific bands at 3 loci (around 200bp, 230bp, and 240bp) Figure 5 ; Table 3).

[0110] Based on the above analysis, SSR121 can separately distinguish the four varieties, SSR122 can separately distinguish GN3 and GN5, and SSR125 can distinguish GN3 from LS, GN3 from GN5, GIB from LS, and GIB from GN5; SSR127 and SSR165 can each distinguish LS from the other three varieties; SSR191 can distinguish GN3 from LS, GN3 from GN5, and GN3 from GIB; SSR231 can separately distinguish the four varieties.

[0111] Table 3 Key SSR Molecular Markers for Salt Tolerance in Alfalfa

[0112]

[0113]

[0114] The primer pair sequences of different SSR markers are as follows:

[0115] The forward primer sequence of SSR-121 is 5’-TGGGACATATGCATGCATCT-3’, SEQ ID NO.3; the reverse primer sequence is 5’-GCAGAAACTAAAATGACAGCACC-3’, SEQ ID NO.4;

[0116] The forward primer sequence of SSR-122 is 5’-CAGTGTGGCACCCTTGTAGA-3’, SEQ ID NO.5; the reverse primer sequence is 5’-TGTCGGAGGCGATGCATTAT-3’, SEQ ID NO.6;

[0117] The forward primer sequence of SSR-125 is 5’-CGGCTATGGGCTTCTGTACA-3’, SEQ ID NO.7; the reverse primer sequence is 5’-TACAGGGGCGGATCTGAGAT-3’, SEQ ID NO.8;

[0118] The forward primer sequence of SSR-127 is 5’-TGGCACAAAAGGCGACTACT-3’, SEQ ID NO.9; the reverse primer sequence is 5’-CGCTCATGATAACTTCGTCGC-3’, SEQ ID NO.10;

[0119] The forward primer sequence of SSR-165 is 5’-CGCGAAATAGCCACGGTATC-3’, SEQ ID NO.11; the reverse primer sequence is 5’-TCCGTGGTATGTTGGGTGTC-3’, SEQ ID NO.12;

[0120] The forward primer sequence of SSR-191 is 5’-CTGTGAACCCCTCAGCTGAG-3’, SEQ ID NO.13; the reverse primer sequence is 5’-CGAAAAGAGAGCCGTGTTGC-3’, SEQ ID NO.14;

[0121] The forward primer sequence of SSR-231 is 5’-TGCACAATGCTCTCAATCCA-3’, SEQ ID NO.15; the reverse primer sequence is 5’-AGACTGGGGGAAGGTTTCTG-3’, SEQ ID NO.16.

[0122] Based on the data of 7 pairs of SSR primers, the Nei's genetic distances and genetic similarities of different alfalfa varieties were calculated using Popgene 32 software (Table 4). The genetic distances and genetic similarities were 0.2958 - 0.7949 and 0.4516 - 0.7419 respectively. The genetic distance between GIB and GN5 was the smallest (0.2985) and the genetic similarity was the highest (0.7419); the genetic distance between GN5 and LS was the largest (0.7949) and the genetic similarity was the lowest (0.4516).

[0123] Table 4 Nei's genetic distances among 4 alfalfa varieties

[0124]

[0125]

[0126] Note: The above is Nei's genetic similarity, and the below is Nei's genetic distance

[0127] To further analyze the genetic relationships among the 4 varieties, the UPGMA clustering diagram of Nei's genetic distances of the 4 varieties was constructed using NTsys software ( Figure 6 ). As Figure 6 can be seen, at a genetic distance of 0.31, the 4 alfalfa varieties were divided into 3 groups. The first group was LS (salt-sensitive), and GIB (salt-tolerant) and GN5 (salt-tolerant) were grouped into the second group, and the third group was GN3 (salt-sensitive at the seedling stage and salt-tolerant at the germination stage). This was similar to the salt tolerance characteristics of each variety. Therefore, these SSR primers can be used for the identification of the purity and salt tolerance characteristics of GN3, GIB, LS, and GN5 varieties.

[0128] The above content further elaborates on the present invention in combination with specific implementation manners. It cannot be determined that the specific implementation of the present invention is only limited to these descriptions. For those of ordinary skill in the technical field to which the present invention pertains, without departing from the concept of the present invention, several simple deductions or substitutions can still be made, and all should be regarded as falling within the protection scope determined by the claims submitted for the present invention.

Claims

1. An SSR marker for distinguishing different varieties of alfalfa, characterized in that, The SSR markers are selected from any one or a combination of several of SSR-121, SSR-122, SSR-125, SSR-127, SSR-165, SSR-191 and SSR-231; The repeat unit of SSR-121 is T, and the repeat number is 14; The repeat unit of SSR-122 is A, and the repeat number is 10; The repeat unit of SSR-125 is T, and the repeat number is 11; The repeat sequence of SSR-127 is (A)11tccaaaccatagcaaagcaacttgcttattcctttgaagatatttacttatctcctctagaacccaaacaaagaacacca cgtacaaattaacc(A)15ccacgtaaacaagtgcagcacagggcaagaacaaccaaaacattctcttatgctttcatcttca(TTG)6; where the numbers represent the repeat numbers of the bases in the parentheses in front of them; The repeat unit of SSR-165 is CTT, and the repeat number is 5; The repeat unit of SSR-191 is AG, and the repeat number is 10; The repeat unit of SSR-231 is AAT, and the repeat number is 9.

2. A primer pair for detecting the SSR marker described in claim 1, characterized in that, The sequences of the primer pairs are as follows: The forward primer sequence for detecting SSR-121 is as shown in SEQ ID NO.3, and the reverse primer sequence is as shown in SEQ ID NO.4; The forward primer sequence for detecting SSR-122 is as shown in SEQ ID NO.5, and the reverse primer sequence is as shown in SEQ ID NO.6; The forward primer sequence for detecting SSR-125 is as shown in SEQ ID NO.7, and the reverse primer sequence is as shown in SEQ ID NO.8; The forward primer sequence for detecting SSR-127 is as shown in SEQ ID NO.9, and the reverse primer sequence is as shown in SEQ ID NO.10; The forward primer sequence for detecting SSR-165 is as shown in SEQ ID NO.11, and the reverse primer sequence is as shown in SEQ ID NO.12; The forward primer sequence for detecting SSR-191 is as shown in SEQ ID NO.13, and the reverse primer sequence is as shown in SEQ ID NO.14; The forward primer sequence for detecting SSR-231 is as shown in SEQ ID NO.15, and the reverse primer sequence is as shown in SEQ ID NO.

16.

3. A kit for distinguishing different varieties of alfalfa, characterized in that, The kit includes the primer pair described in claim 2.

4. Use of the SSR marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in differentiating different varieties of alfalfa.

5. The use according to claim 4, wherein The SSR marker, the primer pair, or the kit is used to differentiate salt-tolerant varieties and salt-sensitive varieties of alfalfa.

6. According to the application described in claim 4, characterized in that SSR-121 is used to differentiate four varieties: Gannong No. 3, Gannong No. 5, Polar Bear, and Lion; SSR-122 is used to differentiate Gannong No. 3 and Gannong No. 5; SSR-125 is used to distinguish Gannong No. 3 from Lishi, Gannong No. 3 from Gannong No. 5, Polar Bear from Lishi, and Polar Bear from Gannong No. 5; SSR-127 and SSR-165 are used to distinguish the three varieties of Lishi, Gannong No. 5, and Polar Bear from Gannong No. 3; SSR-191 is used to distinguish Gannong No. 3 from Lishi, Gannong No. 3 from Gannong No. 5, and Gannong No. 3 from Polar Bear; SSR-231 is used to distinguish Gannong No. 5 from Gannong No. 3, Gannong No. 5 from Polar Bear, and Gannong No. 5 from Lishi; The combinations of SSR-121 and SSR-122, SSR-121 and SSR-125, and SSR-122 and SSR-165 are used to distinguish the four varieties of Gannong No. 3, Gannong No. 5, Polar Bear, and Lishi.

7. A method for differentiating different varieties of alfalfa, characterized in that, It includes the following steps: Extract the genomic DNA of the sample to be tested; Perform PCR amplification on the genomic DNA using the primer pairs described in claim 2; Perform gel electrophoresis on the amplification product, and determine different varieties of alfalfa according to the electrophoresis results.

8. According to the method described in claim 7, characterized in that The different varieties of alfalfa determined are Gannong No. 3, Gannong No. 5, Polar Bear, and Lishi; When using the primer pair of SSR-121 to amplify the four varieties of Gannong No. 3, Gannong No. 5, Polar Bear, and Lishi simultaneously, specific bands appear at 240bp in the amplification product, which is determined to be Gannong No. 3; specific bands appear at 230bp, 240bp, and 265bp, which is determined to be Gannong No. 5; Specific bands appear at 230bp, 240bp, 250bp, and 265bp, which is determined to be Polar Bear; Specific bands appear at 240bp and 250bp, which is determined to be Lishi; When using the primer pair of SSR-122 to amplify Gannong No. 3 and Gannong No. 5 simultaneously, specific bands appear at 270bp, 280bp, 800bp, and 1200bp in the amplification product, which is determined to be Gannong No. 3; Specific bands appear at 270bp, 280bp, and 1200bp, which is determined to be Gannong No. 5; When using the primer pair of SSR-125 to amplify Polar Bear and Gannong No. 5 simultaneously, specific bands appear at 250bp and 480bp in the amplification product, which is determined to be Polar Bear; a specific band appears at 265bp, which is determined to be Gannong No. 5; When using the primer pair of SSR-125 to amplify Gannong No. 3 and Gannong No. 5 simultaneously, specific bands appear at 260bp and 480bp in the amplification product, which is determined to be Gannong No. 3; a specific band appears at 265bp, which is determined to be Gannong No. 5; When using the primer pair of SSR-125 to amplify Polar Bear and Lishi simultaneously, specific bands appear at 250bp and 480bp in the amplification product, which is determined to be Polar Bear; a specific band appears at 270bp, which is determined to be Lishi; When using the primer pair of SSR-125 to amplify polar bears and Gannong No. 5 simultaneously, specific bands appeared at 250 bp and 480 bp in the amplification products, which were determined to be polar bears; a specific band appeared at 265 bp, which was determined to be Gannong No. 5; When using the primer pair of SSR-127 to amplify four varieties, namely Lishi, Gannong No. 5, polar bears, and Gannong No. 3 simultaneously, a specific band appeared at 270 bp in the amplification products, which was determined to be Lishi; When using the primer pair of SSR-165 to amplify four varieties, namely Lishi, Gannong No. 5, polar bears, and Gannong No. 3 simultaneously, specific bands appeared at 270 bp, 480 bp, 490 bp, 500 bp, and 590 bp in the amplification products, which were determined to be Lishi; When using the primer pair of SSR-191 to amplify Gannong No. 3 and Lishi simultaneously, specific bands appeared at 220 bp, 260 bp, 270 bp, 280 bp, 480 bp, and 700 bp in the amplification products, which were determined to be Gannong No. 3; Specific bands appeared at 220 bp, 260 bp, 280 bp, 480 bp, and 700 bp, which were determined to be Lishi; When using the primer pair of SSR-191 to amplify Gannong No. 3 and Gannong No. 5 simultaneously, specific bands appeared at 220 bp, 260 bp, 270 bp, 280 bp, 480 bp, and 700 bp in the amplification products, which were determined to be Gannong No. 3; Specific bands appeared at 220 bp, 260 bp, 270 bp, 480 bp, and 700 bp, which were determined to be Gannong No. 5; When using the primer pair of SSR-191 to amplify Gannong No. 3 and polar bears simultaneously, specific bands appeared at 220 bp, 260 bp, 270 bp, 280 bp, 480 bp, and 700 bp in the amplification products, which were determined to be Gannong No. 3; Specific bands appeared at 220 bp, 260 bp, 270 bp, 480 bp, and 700 bp, which were determined to be polar bears; When using the primer pair of SSR-231 to amplify Gannong No. 5 and Gannong No. 3 simultaneously, a specific band appeared at 230 bp in the amplification products, which was determined to be Gannong No. 3; specific bands appeared at 200 bp, 230 bp, and 240 bp, which were determined to be Gannong No. 5; When using the primer pair of SSR-231 to amplify Gannong No. 5 and polar bears simultaneously, a specific band appeared at 200 bp in the amplification products, which was determined to be polar bears; Specific bands appeared at 200 bp, 230 bp, and 240 bp, which were determined to be Gannong No. 5; When using the primer pair of SSR-231 to amplify Gannong No. 5 and Lishi simultaneously, a specific band appeared at 190 bp in the amplification products, which was determined to be Lishi; Specific bands appeared at 200 bp, 230 bp, and 240 bp, which were determined to be Gannong No. 5; When using SSR-231 to amplify four varieties, namely Gannong No. 3, Gannong No. 5, polar bears, and Lishi simultaneously, a specific band appeared at 190 bp in the amplification products, which was determined to be Lishi; A specific band appears at 200 bp, which is determined to be the polar bear; A specific band appears at 230 bp, which is determined to be Gannong No. 3; Specific bands appear at 200 bp, 230 bp, and 240 bp, which is determined to be Gannong No.

5.

9. The method according to claim 7, wherein Each 10 μL PCR reaction system consists of the following components: 25 mmol·L -1 magnesium salt 0.8 μL - 1.1 μL, 100 μmol·L -1 each of the forward and reverse primers in Claim 1 0.4 μL - 1.0 μL., 10 mmol·L -1 dNTPs 0.2 μL - 0.4 μL, 30 ng / μL DNA template 0.6 μL - 0.8 μL, 5 U / μL Taq DNA polymerase 0.1 μL and 10× Taq Buffer 1.0 μL, made up with water.

10. The method according to claim 7, wherein The PCR amplification program is as follows: pre-denaturation at 95 °C for 50 s, denaturation at 59 °C for 40 s, extension at 72 °C for 1 min, for 35 cycles.

Citation Information

Patent Citations

  • Method for performing SSR analysis on tetraploid alfalfa by utilizing multiple PCR

    CN106676176A

  • SNP (Single Nucleotide Polymorphism) molecular marker closely linked with alfalfa branching character and application of SNP molecular marker

    CN118813859A

  • Method for differentiating fertile and sterile plant lines by detection of polymorphic markers in chloroplast DNA

    WO2013080045A2