SSR markers, primer pairs and their applications for distinguishing different alfalfa varieties

Abstract

The present invention belongs to the field of agricultural breeding technology and specifically relates to a single-stranded short-chain susceptor (SSR) marker, a primer pair, and applications thereof for distinguishing different alfalfa varieties. The SSR marker is selected from any one or a combination of SSR-121, SSR-122, SSR-125, SSR-127, SSR-165, SSR-191, or SSR-231. The SSR marker can be used to distinguish different alfalfa varieties.

Description

Technical Field

[0001] The invention belongs to the field of PCR technology, and particularly relates to an SSR marker, a primer pair and an application thereof for distinguishing different varieties of alfalfa. Background Art

[0002] Alfalfa (Medicago sativa L.) is an important forage crop worldwide, known as the "King of Forages" for its strong stress resistance, nutritional value, and high protein content. Alfalfa germplasm resources are abundant and offer broad development prospects. To meet domestic market demand for alfalfa, exploring high-quality alfalfa germplasm resources and their genes is crucial.

[0003] Simple sequence repeat (SSR) markers are a class of tandemly repeated sequences consisting of several nucleotides, each dozens of nucleotides long. They are characterized by good reproducibility, rich polymorphism, codominance, high reliability, and ease of amplification and analysis. SSR molecular marker technology is now widely used in agricultural production, for example in genetic diversity research, germplasm resource evaluation, genetic map construction, gene mapping, and marker-assisted selection breeding. Uncovering more SSR markers associated with species traits is of great significance to species genetics and breeding. Summary of the Invention

[0004] Based on the problems existing in the prior art, the present invention provides an SSR marker for distinguishing different varieties of alfalfa. The SSR marker can be used to distinguish different varieties of alfalfa.

[0005] The specific technical solutions provided by the present invention are as follows:

[0006] In a first aspect of the present invention, an SSR marker for distinguishing different varieties of alfalfa is provided, wherein the SSR marker is selected from any one or a combination of SSR-121, SSR-122, SSR-125, SSR-127, SSR-165, SSR-191 and SSR-231;

[0007] The repeating unit of SSR-121 is T, with 14 repeats;

[0008] The repeating unit of SSR-122 is A, and the number of repeats is 10;

[0009] The repeating unit of SSR-125 is T, and the number of repeats is 11;

[0010] The repeat sequence of SSR-127 is (A)11tccaaaccatagcaaagcaacttgcttattcctttgaagatatttacttatctcctctagaacccaaacaaagaacacca cgtacaaattaacc(A)15ccacgtaaacaagtgcagcacagggcaagaacaaccaaaacattctcttatgctttcatcttca(TTG)6; wherein the number represents the number of repetitions of the base in the preceding brackets;

[0011] The repeating unit of SSR-165 is CTT, with 5 repeats;

[0012] The repeating unit of SSR-191 is AG, with 10 repeats;

[0013] The repeating unit of SSR-231 is AAT, and the number of repeats is 9.

[0014] In a second aspect of the present invention, a primer pair for detecting the SSR marker is provided, wherein the sequence of the primer pair is as follows:

[0015] The forward primer sequence for detecting SSR-121 is shown in SEQ ID NO.3, and the reverse primer sequence is shown in SEQ ID NO.4;

[0016] The forward primer sequence for detecting SSR-122 is shown in SEQ ID NO.5, and the reverse primer sequence is shown in SEQ ID NO.6;

[0017] The forward primer sequence for detecting SSR-125 is shown in SEQ ID NO.11, and the reverse primer sequence is shown in SEQ ID NO.12;

[0018] The forward primer sequence for detecting SSR-127 is shown in SEQ ID NO. 15, and the reverse primer sequence is shown in SEQ ID NO. 16;

[0019] The forward primer sequence for detecting SSR-165 is shown in SEQ ID NO. 19, and the reverse primer sequence is shown in SEQ ID NO. 20;

[0020] The forward primer sequence for detecting SSR-191 is shown in SEQ ID NO. 21, and the reverse primer sequence is shown in SEQ ID NO. 22;

[0021] The forward primer sequence for detecting SSR-231 is shown in SEQ ID NO. 23, and the reverse primer sequence is shown in SEQ ID NO. 24.

[0022] In a third aspect, the present invention provides a kit for distinguishing different varieties of alfalfa, the kit comprising the primer pair.

[0023] In a fourth aspect, the present invention provides a use of the SSR marker, the primer pair, or the kit in distinguishing different varieties of alfalfa.

[0024] As a preferred embodiment of the present invention, the SSR marker or the primer pair or the kit is used to distinguish salt-tolerant and salt-sensitive alfalfa varieties.

[0025] Further preferably, SSR-121 is used to distinguish the four varieties of Gannong No. 3, Gannong No. 5, Polar Bear and Lion;

[0026] SSR-122 is used to distinguish Gannong 3 from Gannong 5;

[0027] SSR-125 is used to distinguish Gannon 3 from Legacy, Gannon 3 from Gannon 5, GIB from Legacy, and Polar Bear from Gannon 5;

[0028] SSR-127 and SSR-165 are used to distinguish Legacy from Gannong No. 5, Polar Bear, and Gannong No. 3 varieties;

[0029] SSR-191 is used to distinguish Gannon 3 from Legacy, Gannon 3 from Gannon 5, and Gannon 3 from Polar Bear;

[0030] SSR-231 is used to distinguish Gannon 5 from Gannon 3, Gannon 5 from Polar Bear, and Gannon 5 from Legacy;

[0031] The combinations of SSR-121 and SSR-122, SSR-121 and SSR-125, and SSR-122 and SSR-165 are used to distinguish the four varieties: Gannong No. 3, Gannong No. 5, Polar Bear, and Lion.

[0032] A fifth aspect of the present invention provides a method for distinguishing different varieties of alfalfa, characterized in that it comprises the following steps:

[0033] Extracting whole genomic DNA from the sample to be tested;

[0034] performing PCR amplification on whole genomic DNA using the primer pairs;

[0035] The amplified products were subjected to gel electrophoresis, and different varieties of alfalfa were identified based on the electrophoresis results.

[0036] As a preferred embodiment of the present invention, the different varieties of alfalfa determined are Gannong No. 3, Gannong No. 5, Polar Bear and Lion;

[0037] When the primer pair of SSR-121 was used to amplify Gannong 3, Gannong 5, Polar Bear and Lion, the amplified product showed a specific band at 240bp, which was identified as Gannong 3; specific bands appeared at 230bp, 240bp and 265bp, which was identified as Gannong 5; specific bands appeared at 230bp, 240bp, 250bp and 265bp, which was identified as Polar Bear; specific bands appeared at 240bp and 250bp, which was identified as Lion.

[0038] When the primer pair of SSR-122 was used to amplify Gannong 3 and Gannong 5 at the same time, the amplified products showed specific bands at 270bp, 280bp, 800bp and 1200bp, which was identified as Gannong 3; the amplified products showed specific bands at 270bp, 280bp and 1200bp, which was identified as Gannong 5;

[0039] When the primer pair of SSR-125 was used to amplify Gannong 5 and Polar Bear simultaneously, the amplified product showed specific bands at 250bp and 480bp, which was determined to be Polar Bear; the specific band appeared at 265bp, which was determined to be Gannong 5;

[0040] When the primer pair of SSR-125 was used to amplify Gannong 3 and Gannong 5 simultaneously, the amplified product showed specific bands at 260bp and 480bp, which was identified as Gannong 3; the specific band appeared at 265bp, which was identified as Gannong 5;

[0041] When the SSR-125 primer pair was used to amplify both polar bear and lion, the amplified product showed specific bands at 250bp and 480bp, which was determined to be polar bear; the specific band appeared at 270bp, which was determined to be lion;

[0042] When the primer pair of SSR-125 was used to amplify both Polar Bear and Gannong No. 5, the amplified product showed specific bands at 250bp and 480bp, which was determined to be Polar Bear; the specific band appeared at 265bp, which was determined to be Gannong No. 5;

[0043] When the primer pair of SSR-127 was used to amplify the four varieties of Lishi, Gannong 5, Polar Bear, and Gannong 3, a specific band appeared at 270 bp in the amplified product, which was determined to be Lishi;

[0044] When the primer pair of SSR-165 was used to amplify the four varieties of Lishi, Gannong No. 5, Polar Bear, and Gannong No. 3, the amplified products showed specific bands at 270bp, 480bp, 490bp, 500bp, and 590bp, and were determined to be Lishi;

[0045] When the primer pair of SSR-191 was used to amplify Gannong 3 and Lishi at the same time, the amplified products showed specific bands at 220bp, 260bp, 270bp, 280bp, 480bp and 700bp, and were identified as Gannong 3; the amplified products showed specific bands at 220bp, 260bp, 280bp, 480bp and 700bp, and were identified as Lishi;

[0046] When the primer pair of SSR-191 was used to amplify Gannong 3 and Gannong 5 at the same time, the amplified products showed specific bands at 220bp, 260bp, 270bp, 280bp, 480bp and 700bp, and were identified as Gannong 3; the amplified products showed specific bands at 220bp, 260bp, 270bp, 480bp and 700bp, and were identified as Gannong 5.

[0047] When the primer pair of SSR-191 was used to amplify Gannong 3 and Polar Bear simultaneously, the amplified products showed specific bands at 220bp, 260bp, 270bp, 280bp, 480bp and 700bp, and were identified as Gannong 3; the amplified products showed specific bands at 220bp, 260bp, 270bp, 480bp and 700bp, and were identified as Polar Bear;

[0048] When the primer pair of SSR-231 was used to amplify Gannong 5 and Gannong 3 simultaneously, a specific band appeared at 230 bp in the amplified product, which was identified as Gannong 3; specific bands appeared at 200 bp, 230 bp, and 240 bp, which was identified as Gannong 5;

[0049] When the primer pair of SSR-231 was used to amplify Gannong 5 and Polar Bear at the same time, a specific band appeared at 200bp in the amplified product, which was determined to be Polar Bear; specific bands appeared at 200bp, 230bp, and 240bp, which was determined to be Gannong 5;

[0050] When the primer pair of SSR-231 was used to amplify Gannong 5 and Lishi at the same time, a specific band appeared at 190bp in the amplified product, which was identified as Lishi; specific bands appeared at 200bp, 230bp, and 240bp, which was identified as Gannong 5;

[0051] When SSR-231 was used to amplify four varieties, Gannong No. 3, Gannong No. 5, Polar Bear and Li Shi, a specific band appeared at 190bp in the amplified product, which was identified as Li Shi; a specific band appeared at 200bp, which was identified as Polar Bear; a specific band appeared at 230bp, which was identified as Gannong No. 3; specific bands appeared at 200bp, 230bp and 240bp, which was identified as Gannong No. 5.

[0052] As a preferred embodiment of the present invention, each 10 μL PCR reaction system consists of the following components: 25 mmol·L -1 Magnesium salt 0.8 μL to 1.1 μL, 100 μmol·L -1 0.4 μL to 1.0 μL of each forward and reverse primer in claim 1, 10 mmol·L - 1 dNTPs 0.2μL~0.4μL, 30ng / μL DNA template 0.6μL~0.8μL, 5U / μL Taq DNA polymerase 0.1μL and 10× Taq Buffer 1.0μL, make up with water.

[0053] More preferably, each 10uL reaction system contains 25mmol·L -1 Mg 2+ 0.8 μL, 10 mmol·L -1 dNTPs 0.2 μL, 10 μmol·L -1 0.4 μL of each upper and lower primers, 0.8 μL of 30 ng / μL template DNA, 0.1 μL of 5 U / μL Taq DNA polymerase, 1.0 μL of 10× Taq Buffer, and 6.3 μL of ddH2O.

[0054] As a preferred embodiment of the present invention, the PCR amplification program is: 95° C. pre-denaturation for 50 s, 59° C. denaturation for 40 s, 72° C. extension for 1 min, and 35 cycles.

[0055] The SSR markers provided by the present invention can be used to distinguish different alfalfa varieties. Experimental verification shows that SSR-121, SSR-125, and SSR-231 can be used to distinguish the alfalfa varieties Gannong No. 3, Gannong No. 5, Polar Bear, and Legacy; SSR-122 can be used to distinguish the salt-sensitive alfalfa variety Gannong No. 3 from the varieties Gannong No. 5, Polar Bear, and Legacy; SSR-127 and SSR-165 can be used to distinguish the salt-sensitive alfalfa variety Legacy from the varieties Gannong No. 3, Gannong No. 5, and Polar Bear; and SSR-191 can be used to distinguish the salt-tolerant alfalfa varieties Polar Bear and Gannong No. 5 from the salt-sensitive alfalfa varieties Gannong No. 3 and Legacy. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 The electrophoresis results of alfalfa DNA quality test, 1 to 8 are alfalfa varieties, GN5 T GN3 CK GN3 T LS CK 、GIB T GN5 CK 、GIB CKLS T ;

[0057] Figure 2 is the optimization of the SSR-PCR system; M refers to DNA Marker (100-2000 bp); 1-5 in A refer to 25 mmol·L -1 Mg 2+ The dosage was 0.2, 0.5, 0.8, 1.1, and 1.4 μL, and each level was repeated twice; 1 to 5 in B refer to 10 mmol·L - 1 The dosage of dNTPs was 0.2, 0.4, 0.6, 0.8, and 1.0 μL, and each level was repeated twice; 1 to 5 in C refer to 100 μmol·L -1 The primers were 0.2, 0.4, 0.6, 0.8, and 1.0 μL, respectively, and each level was repeated twice; 1 to 5 in D refer to 30 ng / μL template DNA contents of 0.6, 0.8, 1.0, and 1.2 μL, respectively, and each level was repeated twice; 1 to 5 in E refer to annealing temperatures of 53°C, 55°C, 57°C, 59°C, and 61°C, respectively, and each level was repeated twice; 1 to 4 in F refer to the number of cycles of 33, 34, 35, and 36, respectively, and each level was repeated twice.

[0058] Figure 3 Figure 3 is the functional classification of differentially expressed functional genes containing SSR sites related to salt stress response (A) and the gene region location of SSR repeat motifs in each functional category of functional genes related to salt stress response (B).

[0059] Figure 4 This is the distribution map of SSR markers related to salt stress response on 30 alfalfa chromosomes.

[0060] Figure 5 This is the amplification map of 7 pairs of key salt-tolerant polymorphic SSR markers screened in alfalfa; the four bands in the figure are a group (a~d), and the order of each group is GN3, GIB, LS and GN5, and M is a molecular weight marker.

[0061] Figure 6 This is the Nei's genetic distance UPGMA cluster diagram of four alfalfa varieties. DETAILED DESCRIPTION

[0062] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0063] In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention may also be implemented in other ways different from those described herein. Those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0064] Secondly, the term "one embodiment" or "embodiment" herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in various places throughout this specification does not necessarily refer to the same embodiment, nor does it refer to a single or selective embodiment that is mutually exclusive of other embodiments. The present invention provides the following embodiments.

[0065] Example 1

[0066] Screening of SSR locus markers

[0067] 1. Alfalfa DNA extraction and detection

[0068] The M5 Plant Genomic DNA Kit (MF070-01, unit 50T) of Beijing Jumei Biotechnology Co., Ltd. was used to extract the DNA of four alfalfa varieties at 0 (CK) and 200 mmol·L -1 8 samples of DNA under NaCl (T) treatment, including: Gannong No. 3 (control group marked as GN3 CK , the sample group is labeled GN3 T ), Gannong 5 (the control group was marked as GN5 CK , the sample group is labeled GN5 T ), Lion (the control group was marked as LS CK , the sample group is labeled LS T ), polar bears (the control group was marked as GIB CK , the sample group is labeled GIB T ). Fresh young leaf tissue was selected as the material, and liquid nitrogen was added to fully grind and crushed. The DNA extraction kit was referred to for extraction. The DNA solution was stored at -20 ° C for later use. The quality of the extracted DNA was detected using a 1% agarose gel, and the gel imaging system was used to identify and photograph the DNA. The DNA concentration was detected by an ultra-micro spectrophotometer. 1 μL of eluate was used for zero adjustment, and the concentration of 1 μL of DNA sample solution and OD were measured. 260nm / OD 280nm In subsequent experiments, DNA with an OD value of 1.8 to 2.0 was used, and the optical density of 1 OD value was equivalent to 50 μg mL -1 The concentration of double-stranded DNA was estimated.

[0069] The results show that ( Figure 1), the 8 sample bands were clear and complete, without obvious tailing, indicating that the extracted DNA was of good quality. After detection by ultra-micro spectrophotometer, the OD 260nm / OD 280nm The DNA concentration of each sample was approximately 30 ng / g.

[0070] 2. Primer design

[0071] Primer design was performed using Primer 5.0 software. The key parameters for primer synthesis were as follows: (1) a primer length of approximately 20 bp was optimal; (2) the annealing temperature (Tm) was between 55°C and 65°C, with the annealing temperature difference between the upstream and downstream primers less than 0.5°C; (3) the GC content was not less than 40%; and (4) the PCR product length was between 100 and 300 bp. Primers were synthesized by General Biotech (Anhui) Co., Ltd.

[0072] 3. Amplification product detection

[0073] SSR-PCR amplification products were separated on a 6.0% polyacrylamide gel using non-denaturing polyacrylamide gel electrophoresis (PAGE). 20 ml of gel contained: 4 ml of Arc:Bis (29:1, mass ratio), 4 ml of 5×TBE, 13 μl of TEMED, and 0.14 ml of 10% APS. Pre-electrophoresis voltage is 60V, current is 55mA, and power is 60W. After 30 minutes, the sample is loaded and the voltage, current, and power are set to 120V, 100mA, and 65W for electrophoresis for 2.5-3.0 hours. The gel is fixed with a fixing solution (25mL anhydrous ethanol + 1.25mL glacial acetic acid + 223.75mL ddH2O in a volumetric flask to a volume of 250mL) for 13-18 minutes; 0.1% AgNO3 solution is stained for 15 minutes; after washing twice with distilled water, the gel is developed in a developer (3.75g NaOH + 2mL formaldehyde + 100μL 1% sodium thiosulfate solution + 244.53mL ddH2O in a volumetric flask to a volume of 250mL); and photographed.

[0074] 4. Data Analysis

[0075] When counting, based on the agarose gel electrophoresis pattern of SSR-PCR, bands at the same migration position were considered to be the same genetic locus. A clear, unstuck, and easily distinguishable band at the same locus was recorded as "1", and no band was recorded as "0". Based on the results of manual band reading, a "0-1" matrix was constructed in an Excel table with the row name as the band name and the column name as the sample name. PopGene32 software was used to calculate the Nei's genetic distance and Nei's genetic similarity of each variety; the Nei's genetic similarity (S) formula is: Sxy =2N xy / (N x +N y ), where S xy is the genetic similarity coefficient between varieties x and y, N xy is the number of bands common to varieties x and y, N x and N y are the numbers of polymorphic bands of varieties x and y, respectively; the Nei's genetic distance (D) between varieties is calculated as: D = -ln I, Among them, x i and y i The frequencies of band i in varieties x and y are respectively.NTSYS2.10e software was used to construct Nei's genetic distance unweighted group average method (UPGMA) cluster dendrograms of each variety.

[0076] 5. Experimental design for optimization of SSR-PCR reaction system

[0077] Select GN3 with better quality from the extracted DNA T The DNA was used as the experimental template, and the PCR reaction system was optimized using the designed SSR-120 primers. The target amplified fragment length was 274 bp.

[0078] The forward primer sequence of SSR-120 is: 5'-TGGATGTTGAACCATGGCCT-3', SEQ ID NO. 1; the reverse primer sequence is: 5'-GCCAACCCAATCAAAAGGACA-3', SEQ ID NO. 2.

[0079] Initial reaction system: 5U / μL Taq DNA polymerase 0.1μL, 25mmol·L -1 Mg 2+ 0.8 μL, 10 mmol·L - 1 dNTPs 0.2 μL, 100 μmol·L -1 0.4 μL each of upstream and downstream primers, 30 ng·μL -1 Template DNA 1.0 μL, 10× TaqBuffer 1.0 μL, the experiment uses a 10 μL system, and the insufficient part is supplemented with ddH2O.

[0080] The initial PCR amplification program was as follows: pre-heat at 94°C for 3 min, denaturation at 94°C for 50 s, annealing at 60°C for 40 s, extension at 72°C for 1 min, 35 cycles of denaturation-annealing-extension, then at 72°C for 5 min, and storage at 10°C.

[0081] The single factor experiment method was used to determine the concentration of dNTPs, Mg 2+ Six factors, including concentration, primer concentration, DNA template concentration, annealing temperature, and cycle number, were optimized. Five levels were set for each factor (Table 1), and each level was repeated twice to determine the optimal 10 μL SSR-PCR reaction system suitable for alfalfa.

[0082] Table 1 Factors and levels of single factor experiment in alfalfa SSR-PCR reaction system

[0083]

[0084] Depend on Figure 2 From A, we can see that Mg 2+ No band was amplified when the dosage was 0.2 μL, and the band was weak when the dosage was 1.4 μL, indicating that the amplified product was unstable; Mg 2+ When the dosage was 0.5-1.1 μL, the amplified bands were obvious and the amplified products were stable. However, when the dosage was 0.5 μL, the amplified background had obvious extraneous bands. When the dosage was 1.1 μL, the spectrum had tailing and the reproducibility was not high. Therefore, 25 mmol·L was selected in the SSR-PCR amplification system (10 μL). -1 Mg 2+ The optimal dosage is 0.8 μL.

[0085] Depend on Figure 2 As shown in Figure B, when the dNTP dosage was between 0.2 and 0.4 μL, the amplified bands were clear and bright with fewer miscellaneous bands. The amplified bands from 0.4 μL were not clear enough and lacked integrity. When the dosage reached 1.0 μL, the amplified background was not clean enough and there was a tailing phenomenon. Therefore, 10 mmol·L was selected in the SSR-PCR amplification system (10 μL). -1 The optimal dNTP dosage is 0.2 μL.

[0086] Depend on Figure 2 As shown in Figure C, when the amount of upper and lower primers is less than 0.4 μL, no bands are amplified. When the amount of upper and lower primers reaches 0.4 μL, the amplified bands are clear and bright, with high reproducibility. The electrophoresis results do not change much with increasing primer amount. Therefore, the optimal amount of upper and lower primers in the SSR-PCR amplification system (10 μL) is 0.4 μL.

[0087] Depend on Figure 2As shown in Figure D, when the template DNA amount was 0.6 μL, the amplified band was faint and the product was difficult to detect. When the template content was increased to 0.8 μL, clear bands appeared, indicating the best amplification effect. As the template DNA amount was further increased, amplified bands were observed, but the bands were less clear and bright, and the reproducibility was poor. Therefore, in the SSR-PCR amplification system (10 μL), the optimal template DNA amount was 0.8 μL, or 24 ng.

[0088] Depend on Figure 2 Figure E shows that at annealing temperatures of 53-57°C, the mismatch rate of the amplified product was high, the amplified product was not obvious, and no clear, stable bands appeared. At 59°C, relatively stable, visible bands appeared, with no background bands, indicating excellent amplification results. When the annealing temperature reached 61°C, the amplification efficiency was low, and no bands were observed. Therefore, the optimal annealing temperature for the SSR-PCR amplification system (10 μL) is 59°C.

[0089] Depend on Figure 2 Figure F shows that when the number of cycles is 33, 34, and 36, the amplified bands are blurred or cannot be seen. However, when the number of cycles is 35, the amplified bands are clear and easy to distinguish, and the reproducibility is excellent. Therefore, 35 cycles were selected as the optimal number of cycles for the PCR program in the SSR-PCR amplification system (10 μg).

[0090] In summary, the SSR-PCR amplification system (10 μL) consists of the following components: 25 mmol·L - 1 Mg 2+ 0.8 μL, 10 mmol·L -1 dNTPs 0.2 μL, 10 μmol·L -1 0.4 μL of each upper and lower primers, 0.8 μL of 30 ng / μL template DNA, 0.1 μL of 5 U / μL Taq DNA polymerase, 1.0 μL of 10× Taq Buffer, and 6.3 μL of ddH2O.

[0091] The optimal reaction cycle conditions were: 95°C for 50 s, 59°C for 40 s, and 72°C for 1 min, for 35 cycles.

[0092] 6. Development of SSR polymorphic sites

[0093] 6.1 Differential Expression Analysis of Genes Containing SSR Loci

[0094] Based on transcriptome data, 22,445 genes were successfully screened from 28,039 genes containing SSR loci. Differential expression analysis of these 22,445 unigenes containing SSR loci was performed (screening criteria: |log2(fold change)| ≥ 1 and Q < 0.05), resulting in a total of 1,947 differentially expressed genes. Under control conditions, 407 differentially expressed genes (96 upregulated, 311 downregulated) were identified in leaves and 311 differentially expressed genes (99 upregulated, 212 downregulated) were identified in roots between GIB (a salt-tolerant alfalfa variety) and LS (a salt-sensitive alfalfa variety). Under 200 mmol / L NaCl treatment, the number of differentially expressed functional genes in leaves was 152 (27 upregulated, 125 downregulated), and in roots was 172 (99 upregulated, 73 downregulated). In addition, compared with the control, 430 genes (291 up-regulated and 139 down-regulated) and 219 genes (130 up-regulated and 89 down-regulated) were differentially expressed in leaves and roots of GIB under NaCl treatment. In contrast, 655 differentially expressed genes (464 up-regulated and 191 down-regulated) and 409 differentially expressed genes (157 up-regulated and 252 down-regulated) were found in leaves and roots of LS.

[0095] 6.2 Functional Analysis of Differentially Expressed Genes Containing SSR Loci

[0096] The damage caused by salt stress to plants mainly includes ion toxicity, osmotic stress, and a series of secondary stress effects such as oxidative stress caused by the action of the two. Plants adapt to these stress effects through intracellular regulation. Based on GO and KEGG analysis, the present invention identified a total of 192 differentially expressed functional genes containing SSR sites involved in signal transduction pathways (37), metabolic synthesis (29), reactive oxygen species (ROS) scavenging (20), transcription factors (68) and ion transport (34). Figure 3 Middle A).

[0097] In addition, the present invention also analyzed the distribution of SSR repeat motifs within gene regions (exons, 3'UTR and 5'UTR) of five functional categories ( Figure 3 The location with the largest number of SSR repeat motifs in the three gene regions is transcriptional regulation ( Figure 3 Among the 192 differentially expressed functional genes related to salt stress, some genes contained two or more SSR loci. Based on the standards for SSR primer design, a total of 211 pairs of SSR primers were designed. At the same time, based on local BLAST sequence alignment, 155 functional genes containing SSR loci were successfully matched with the cultivated alfalfa reference genome, and 200 of the 211 SSR markers were successfully located on 30 alfalfa chromosomes ( Figure 4 ).

[0098] 6.3 Detection of key SSRs involved in the salt stress response of alfalfa

[0099] PCR amplification was performed on 211 pairs of SSR primers designed using the established optimal SSR-PCR reaction system in 4 alfalfa varieties (LS, GN3, GN5, GIB). The results of SSR-PCR amplification showed that 7 pairs of SSR primers (SSR121, SSR122, SSR125, SSR127, SSR165, SSR191, SSR231) amplified obvious characteristic bands among the varieties. In the Excel table, the row names are the band names and the column names are the sample names. A "0-1" matrix (Table 2) was constructed for the purity and salt tolerance identification of each variety. The results of the preliminary research of the present invention team showed that the salt tolerance characteristics of each variety in the seedling stage were LS<GN3<GN5<GIB; the salt tolerance characteristics of each variety in the budding stage were LS<GN5<GN3<GIB. Among them, GIB is salt-tolerant, GN5 is salt-tolerant, GN3 is salt-tolerant in the budding stage, and is salt-sensitive in the seedling stage, and LS is salt-sensitive. According to the distribution of amplified bands of 7 pairs of polymorphic SSR primers, there was obvious separation of the related bands among the tested varieties GN3, GN5, GIB and LS ( Figure 5 ), which are more reliable for identifying variety purity and screening markers related to salt tolerance.

[0100] Table 27 SSR primer PCR amplification "0-1" matrix

[0101]

[0102]

[0103] The SSR121 primers located on chromosome 2 amplified a band at one site (around 240 bp) in GN3; four sites (around 230 bp, 240 bp, 250 bp and 265 bp) in GIB; two sites (around 240 bp and 250 bp) in LS; and three sites (around 230 bp, 240 bp and 265 bp) in GN5. Figure 5 ; Table 3).

[0104] The SSR122 primers located on chromosome 3 amplified bands at four sites (around 270bp, 280bp, 800bp and 1200bp) in GN3; one site (around 270bp) in GIB and LS; and three sites (around 270bp, 280bp and 1200bp) in GN5. Figure 5 ; Table 3).

[0105] The SSR125 primers located on chromosome 5 amplified two bands at GN3 (around 260bp and 480bp); two bands at GIB (around 250bp and 480bp); one band at LS (around 270bp); and one band at GN5 (around 265bp). Figure 5 ; Table 3).

[0106] The SSR127 primers located on chromosome 5 amplified a band at only one site, LS, which was located at around 270 bp ( Figure 5 ; Table 3), no bands were amplified in the other three varieties.

[0107] The SSR165 primers located on chromosome 8 amplified bands at 5 sites (270bp, 480bp, 485bp, 500bp and around 600bp) in GN3, GIB and GN5 respectively; LS amplified bands at 5 sites (270bp, 480bp, 490bp, 500bp and around 590bp) Figure 5 ; Table 3).

[0108] SSR191 located on chromosome 4 amplified bands at 6 sites (around 220bp, 260bp, 270bp, 280bp, 480bp and 700bp) in GN3; 5 sites (around 220bp, 260bp, 270bp, 480bp and 700bp) in GIB and GN5; 5 sites (around 220bp, 260bp, 270bp, 480bp and 700bp) in LS. Figure 5 ; Table 3).

[0109] The length of the SSR231 primer located on chromosome 8 was very different in each variety. GN3 amplified a specific band at about 230 bp, GIB amplified a specific band at about 200 bp, LS amplified a specific band at about 190 bp, and GN5 amplified relatively vague specific bands at three sites (about 200 bp, 230 bp, and 240 bp). Figure 5 ; Table 3).

[0110] Based on the above analysis, SSR121 can independently distinguish the four varieties, SSR122 can independently distinguish GN3 from GN5, SSR125 can distinguish GN3 from LS, GN3 from GN5, GIB from LS, GIB from GN5; SSR127 and SSR165 can each distinguish LS from the other three varieties; SSR191 can distinguish GN3 from LS, GN3 from GN5, GN3 from GIB; SSR231 can independently distinguish four varieties.

[0111] Table 3 Key SSR molecular markers for salt tolerance in alfalfa

[0112]

[0113]

[0114] The primer pair sequences for different SSR markers are as follows:

[0115] The forward primer sequence of SSR-121 is 5'-TGGGACATATGCATGCATCT-3', SEQ ID NO. 3; the reverse primer sequence is 5'-GCAGAAACTAAAATGACAGCACC-3', SEQ ID NO. 4;

[0116] The forward primer sequence of SSR-122 is 5'-CAGTGTGGCACCCTTGTAGA-3', SEQ ID NO. 5; the reverse primer sequence is 5'-TGTCGGAGGCGATGCATTAT-3', SEQ ID NO. 6;

[0117] The forward primer sequence of SSR-125 is 5'-CGGCTATGGGCTTCTGTACA-3', SEQ ID NO. 7; the reverse primer sequence is 5'-TACAGGGGCGGATCTGAGAT-3', SEQ ID NO. 8;

[0118] The forward primer sequence of SSR-127 is 5'-TGGCACAAAAGGCGACTACT-3', SEQ ID NO.9; the reverse primer sequence is 5'-CGCTCATGATAACTTCGTCGC-3', SEQ ID NO.10;

[0119] The forward primer sequence of SSR-165 is 5'-CGCGAAATAGCCACGGTATC-3', SEQ ID NO. 11; the reverse primer sequence is 5'-TCCGTGGTATGTTGGGTGTC-3', SEQ ID NO. 12;

[0120] The forward primer sequence of SSR-191 is 5'-CTGTGAACCCCTCAGCTGAG-3', SEQ ID NO. 13; the reverse primer sequence is 5'-CGAAAAGAGAGCCGTGTTGC-3', SEQ ID NO. 14;

[0121] The forward primer sequence of SSR-231 is 5'-TGCACAATGCTCTCAATCCA-3', SEQ ID NO. 15; the reverse primer sequence is 5'-AGACTGGGGGAAGGTTTCTG-3', SEQ ID NO. 16.

[0122] Based on the data of 7 pairs of SSR primers, the Nei's genetic distance and genetic similarity of different alfalfa varieties were calculated using Popgene 32 software (Table 4). The genetic distance and genetic similarity were 0.2958-0.7949 and 0.4516-0.7419, respectively. GIB and GN5 had the smallest genetic distance (0.2985) and the highest genetic similarity (0.7419). GN5 and LS had the largest genetic distance (0.7949) and the lowest genetic similarity (0.4516).

[0123] Table 4 Nei's genetic distance among four alfalfa varieties

[0124]

[0125]

[0126] Note: The upper part is Nei's genetic similarity, and the lower part is Nei's genetic distance

[0127] In order to further analyze the genetic relationship among the four varieties, the Nei's genetic distance UPGMA cluster diagram of the four varieties was constructed using NTsys software ( Figure 6 ).Depend on Figure 6 As shown, at a genetic distance of 0.31, the four alfalfa varieties fell into three groups: LS (salt-sensitive), GIB (salt-tolerant), and GN5 (salt-tolerant) in the first group, and GN3 (salt-sensitive at the seedling stage and salt-tolerant at the budding stage) in the third group. This is consistent with the salt tolerance characteristics of each variety. Therefore, these SSR primers can be used to identify the purity and salt tolerance of GN3, GIB, LS, and GN5 varieties.

[0128] The above content is a further detailed description of the present invention in conjunction with specific implementation methods. It cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, they can make several simple deductions or substitutions without departing from the concept of the present invention, which should be regarded as falling within the scope of protection determined by the claims submitted for the present invention.

Claims

1. A primer pair for detecting and distinguishing SSR markers of different alfalfa varieties, characterized in that: The SSR markers are SSR-121, SSR-122, SSR-125, SSR-127, SSR-165, SSR-191, and SSR-231; The sequences of the primer pairs are as follows: The forward primer sequence for detecting SSR-121 is shown in SEQ ID NO.3, and the reverse primer sequence is shown in SEQ ID NO.4; The forward primer sequence for detecting SSR-122 is shown in SEQ ID NO.5, and the reverse primer sequence is shown in SEQ ID NO.6; The forward primer sequence for detecting SSR-125 is shown in SEQ ID NO.7, and the reverse primer sequence is shown in SEQ ID NO.8; The forward primer sequence for detecting SSR-127 is shown in SEQ ID NO.9, and the reverse primer sequence is shown in SEQ ID NO.10; The forward primer sequence for detecting SSR-165 is shown in SEQ ID NO.11, and the reverse primer sequence is shown in SEQ ID NO.12; The forward primer sequence for detecting SSR-191 is shown in SEQ ID NO. 13, and the reverse primer sequence is shown in SEQ ID NO. 14; The forward primer sequence for detecting SSR-231 is shown in SEQ ID NO.15, and the reverse primer sequence is shown in SEQ ID NO.

16.

2. A kit for distinguishing different varieties of alfalfa, characterized in that: The kit comprises the primer pair according to claim 1.

3. Use of the primer pair according to claim 1 or the kit according to claim 2 for distinguishing different varieties of alfalfa, characterized in that: The primer pair or the kit is used to distinguish salt-tolerant and salt-sensitive alfalfa varieties; The different alfalfa varieties identified were Gannong No. 3, Gannong No. 5, Polar Bear, and Legacy; When the primer pair for detecting SSR-121 was used to amplify Gannong 3, Gannong 5, Polar Bear and Lion, the amplified product showed a specific band at 240 bp, which was identified as Gannong 3; specific bands appeared at 230 bp, 240 bp and 265 bp, which was identified as Gannong 5; Specific bands appeared at 230 bp, 240 bp, 250 bp, and 265 bp, indicating that the gene was polar bear; Specific bands appeared at 240 bp and 250 bp, which was determined to be Lishi; When the primer pair for detecting SSR-122 was used to amplify Gannong 3 and Gannong 5 simultaneously, specific bands appeared at 270 bp, 280 bp, 800 bp, and 1200 bp in the amplified products, and it was identified as Gannong 3. Specific bands appeared at 270 bp, 280 bp, and 1200 bp, and it was identified as Gannong 5; When the primer pair for detecting SSR-125 was used to amplify Gannong 5 and Polar Bear simultaneously, the amplified product showed specific bands at 250 bp and 480 bp, which was determined to be Polar Bear; the specific band appeared at 265 bp, which was determined to be Gannong 5; When the primer pair for detecting SSR-125 was used to amplify Gannong 3 and Gannong 5 simultaneously, the amplified product showed specific bands at 260 bp and 480 bp, which was identified as Gannong 3; the specific band appeared at 265 bp, which was identified as Gannong 5; When the primer pair for detecting SSR-125 was used to amplify both polar bear and lion, the amplified product showed specific bands at 250 bp and 480 bp, which was determined to be polar bear; the specific band appeared at 270 bp, which was determined to be lion; When the primer pair for detecting SSR-125 was used to amplify both Polar Bear and Gannong 5, the amplified product showed specific bands at 250 bp and 480 bp, which was determined to be Polar Bear; the specific band appeared at 265 bp, which was determined to be Gannong 5; When the primer pair for detecting SSR-127 was used to amplify the four varieties of Lishi, Gannong 5, Polar Bear, and Gannong 3, a specific band appeared at 270 bp in the amplified product, which was determined to be Lishi; When the primer pair for detecting SSR-165 was used to amplify the four varieties of Lishi, Gannong 5, Polar Bear, and Gannong 3, specific bands appeared at 270 bp, 480 bp, 490 bp, 500 bp, and 590 bp in the amplified products, and it was determined to be Lishi; When the primer pair for detecting SSR-191 was used to amplify Gannong 3 and Lishi simultaneously, specific bands appeared at 220 bp, 260 bp, 270 bp, 280 bp, 480 bp and 700 bp of the amplified product, and it was determined to be Gannong 3; Specific bands appeared at 220 bp, 260 bp, 280 bp, 480 bp, and 700 bp, and were determined to be Lishi; When the primer pair for detecting SSR-191 was used to amplify Gannong 3 and Gannong 5 simultaneously, specific bands appeared at 220 bp, 260 bp, 270 bp, 280 bp, 480 bp and 700 bp of the amplified products, and it was determined to be Gannong 3; Specific bands appeared at 220 bp, 260 bp, 270 bp, 480 bp, and 700 bp, and the strain was identified as Gannong 5; When the primer pair for detecting SSR-191 was used to amplify Gannong 3 and Polar Bear simultaneously, specific bands appeared at 220 bp, 260 bp, 270 bp, 280 bp, 480 bp, and 700 bp in the amplified products, and it was determined to be Gannong 3; Specific bands appeared at 220 bp, 260 bp, 270 bp, 480 bp, and 700 bp, indicating that the gene was polar bear; When the primer pair for detecting SSR-231 was used to amplify Gannong 5 and Gannong 3 simultaneously, a specific band appeared at 230 bp in the amplified product, which was identified as Gannong 3; specific bands appeared at 200 bp, 230 bp, and 240 bp, which was identified as Gannong 5; When the primer pair for detecting SSR-231 was used to amplify Gannong 5 and polar bear simultaneously, a specific band appeared at 200 bp in the amplified product, and it was determined to be polar bear; Specific bands appeared at 200 bp, 230 bp, and 240 bp, and it was identified as Gannong 5; When the primer pair for detecting SSR-231 was used to amplify Gannong 5 and Lishi simultaneously, a specific band appeared at 190 bp in the amplified product, which was identified as Lishi; Specific bands appeared at 200 bp, 230 bp, and 240 bp, and it was identified as Gannong 5; When the detection SSR-231 was used to simultaneously amplify Gannong 3, Gannong 5, Polar Bear, and Lishi, a specific band appeared at 190 bp in the amplified product, which was identified as Lishi; A specific band appeared at 200 bp, which was determined to be polar bear; A specific band appeared at 230 bp, which was identified as Gannong 3; Specific bands appeared at 200 bp, 230 bp, and 240 bp, and the strain was identified as Gannong 5.

4. A method for distinguishing different varieties of alfalfa, characterized in that: The following steps are involved: Extracting whole genomic DNA from the sample to be tested; Performing PCR amplification on whole genomic DNA using the primer pair described in claim 1; The amplified products were subjected to gel electrophoresis, and different varieties of alfalfa were identified based on the electrophoresis results; The different alfalfa varieties identified were Gannong No. 3, Gannong No. 5, Polar Bear, and Legacy; When the primer pair for detecting SSR-121 was used to amplify Gannong 3, Gannong 5, Polar Bear and Lion, the amplified product showed a specific band at 240 bp, which was identified as Gannong 3; specific bands appeared at 230 bp, 240 bp and 265 bp, which was identified as Gannong 5; Specific bands appeared at 230 bp, 240 bp, 250 bp, and 265 bp, indicating that the gene was polar bear; Specific bands appeared at 240 bp and 250 bp, which was determined to be Lishi; When the primer pair for detecting SSR-122 was used to amplify Gannong 3 and Gannong 5 simultaneously, specific bands appeared at 270 bp, 280 bp, 800 bp, and 1200 bp in the amplified products, and it was identified as Gannong 3. Specific bands appeared at 270 bp, 280 bp, and 1200 bp, and it was identified as Gannong 5; When the primer pair for detecting SSR-125 was used to amplify Gannong 5 and Polar Bear simultaneously, the amplified product showed specific bands at 250 bp and 480 bp, which was determined to be Polar Bear; the specific band appeared at 265 bp, which was determined to be Gannong 5; When the primer pair for detecting SSR-125 was used to amplify Gannong 3 and Gannong 5 simultaneously, the amplified product showed specific bands at 260 bp and 480 bp, which was identified as Gannong 3; the specific band appeared at 265 bp, which was identified as Gannong 5; When the primer pair for detecting SSR-125 was used to amplify both polar bear and lion, the amplified product showed specific bands at 250 bp and 480 bp, which was determined to be polar bear; the specific band appeared at 270 bp, which was determined to be lion; When the primer pair for detecting SSR-125 was used to amplify both Polar Bear and Gannong 5, the amplified product showed specific bands at 250 bp and 480 bp, which was determined to be Polar Bear; the specific band appeared at 265 bp, which was determined to be Gannong 5; When the primer pair for detecting SSR-127 was used to amplify the four varieties of Lishi, Gannong 5, Polar Bear, and Gannong 3, a specific band appeared at 270 bp in the amplified product, which was determined to be Lishi; When the primer pair for detecting SSR-165 was used to amplify the four varieties of Lishi, Gannong 5, Polar Bear, and Gannong 3, specific bands appeared at 270 bp, 480 bp, 490 bp, 500 bp, and 590 bp in the amplified products, and it was determined to be Lishi; When the primer pair for detecting SSR-191 was used to amplify Gannong 3 and Lishi simultaneously, specific bands appeared at 220 bp, 260 bp, 270 bp, 280 bp, 480 bp and 700 bp of the amplified product, and it was determined to be Gannong 3; Specific bands appeared at 220 bp, 260 bp, 280 bp, 480 bp, and 700 bp, and were determined to be Lishi; When the primer pair for detecting SSR-191 was used to amplify Gannong 3 and Gannong 5 simultaneously, specific bands appeared at 220 bp, 260 bp, 270 bp, 280 bp, 480 bp and 700 bp of the amplified products, and it was determined to be Gannong 3; Specific bands appeared at 220 bp, 260 bp, 270 bp, 480 bp, and 700 bp, and the strain was identified as Gannong 5; When the primer pair for detecting SSR-191 was used to amplify Gannong 3 and Polar Bear simultaneously, specific bands appeared at 220 bp, 260 bp, 270 bp, 280 bp, 480 bp, and 700 bp in the amplified products, and it was determined to be Gannong 3; Specific bands appeared at 220 bp, 260 bp, 270 bp, 480 bp, and 700 bp, indicating that the gene was polar bear; When the primer pair for detecting SSR-231 was used to amplify Gannong 5 and Gannong 3 simultaneously, a specific band appeared at 230 bp in the amplified product, which was identified as Gannong 3; specific bands appeared at 200 bp, 230 bp, and 240 bp, which was identified as Gannong 5; When the primer pair for detecting SSR-231 was used to amplify Gannong 5 and polar bear simultaneously, a specific band appeared at 200 bp in the amplified product, and it was determined to be polar bear; Specific bands appeared at 200 bp, 230 bp, and 240 bp, and it was identified as Gannong 5; When the primer pair for detecting SSR-231 was used to amplify Gannong 5 and Lishi simultaneously, a specific band appeared at 190 bp in the amplified product, which was identified as Lishi; Specific bands appeared at 200 bp, 230 bp, and 240 bp, and it was identified as Gannong 5; When the detection SSR-231 was used to simultaneously amplify Gannong 3, Gannong 5, Polar Bear, and Lishi, a specific band appeared at 190 bp in the amplified product, which was identified as Lishi; A specific band appeared at 200 bp, which was determined to be polar bear; A specific band appeared at 230 bp, which was identified as Gannong 3; Specific bands appeared at 200 bp, 230 bp, and 240 bp, and the strain was identified as Gannong 5.

5. The method according to claim 4, characterized in that Each 10 μL PCR reaction system consists of the following components: 25 mmol·L -1 Magnesium salt 0.8 μL~1.1 μL, 100 μmol·L -1 0.4 μL to 1.0 μL of each forward and reverse primer in claim 1, 10 mmol·L -1 0.2 μL–0.4 μL of dNTPs, 0.6 μL–0.8 μL of 30 ng / μL DNA template, 0.1 μL of 5 U / μL Taq DNA polymerase, and 1.0 μL of 10× Taq Buffer, complete with water.

6. The method according to claim 4, characterized in that The reaction cycle conditions in the PCR amplification program were: denaturation at 95°C for 50 s, annealing at 59°C for 40 s, and extension at 72°C for 1 min, for 35 cycles.

Images