Barley SNP molecular marker and application thereof
By developing SNP molecular markers related to the β-glucan content of barley grains, the screening problem in the existing technology is solved, efficient and accurate detection of β-glucan content and breeding screening are achieved, and the efficiency of barley breeding and the utilization of genetic resources are improved.
Patent Information
- Application Number
- CN202510605113.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-12
- Publication Date
- 2025-07-04
AI Technical Summary
The prior art lacks effective molecular markers for assisting screening and breeding to meet the diverse needs of barley varieties with different beta-glucan content, especially in livestock and poultry feed and beer production, as well as in foods.
A SNP molecular marker significantly related to the content of β-glucan in barley kernels was developed, and the genotype of SNP molecular marker was detected by primers. PCR amplification and sequencing technology was used to provide a kit for screening barley germplasm rich or low-level β-glucan, including specific primers and PCR amplification premix.
Accurate detection and screening of β-glucan content in barley grains is achieved, which improves the efficiency and accuracy of breeding, and can early screen out barley varieties with ideal β-glucan content, broadening the genetic basis.
Smart Images

Figure CN120249549A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular markers, and particularly relates to a barley SNP molecular marker and its application. Background Art
[0002] The β-glucan content in barley grains is a key trait affecting its uses and product quality, and this effect varies depending on the specific use of barley. In livestock and poultry feed and beer production, barley varieties with low β-glucan content are often selected as fermentation raw materials because high levels of β-glucan can hinder the digestion and growth of livestock and poultry, reduce the filtration rate of wort and the malt extract rate, and may cause problems such as beer turbidity precipitation and taste deterioration, which are important quality requirements. When barley is used as a food raw material, β-glucan is a beneficial component with effects such as reducing human blood sugar and cholesterol, cleaning the intestines, and enhancing immunity. However, the β-glucan content varies greatly among different barley varieties, with some being 4% - 5% and some varieties reaching more than 8%. Therefore, by screening barley varieties with different β-glucan contents, the diverse needs in different fields such as feed, brewing, and food processing can be effectively met.
[0003] Currently, there is little research on SNP markers for the β-glucan content in barley grains, and there is a lack of effective molecular markers for assisting breeding. Summary of the Invention
[0004] In view of this, the purpose of the present invention is to provide a barley SNP molecular marker that is significantly correlated with the β-glucan content in barley grains and can be used for screening barley germplasms with different β-glucan contents and barley genetic breeding.
[0005] The present invention provides a SNP molecular marker related to the trait of β-glucan content in barley grains, and the SNP molecular marker has a G / A polymorphism at the 110th position on the DNA fragment shown in the nucleotide sequence SEQ ID NO:3.
[0006] The present invention provides a primer for detecting the SNP molecular marker, including an upstream primer with the nucleotide sequence shown in SEQ ID NO:1 and a downstream primer with the nucleotide sequence shown in SEQ ID NO:2.
[0007] The present invention provides a kit for screening barley rich in β-glucan, including the primer and a PCR amplification premix.
[0008] Preferably, the PCR amplification premix includes KOD One TM PCRMasterMix.
[0009] The present invention provides the application of the SNP molecular marker, the primer or the kit in barley breeding.
[0010] Preferably, the barley breeding includes materials for screening and / or evaluating the β-glucan content in barley grains.
[0011] The present invention provides a method for screening barley germplasms with different β-glucan contents, comprising the following steps: detecting the SNP molecular marker in the genomic DNA of a sample to be tested, analyzing the genotype of the SNP molecular marker, and judging the abundance of β-glucan in the sample to be tested according to the genotype:
[0012] When the genotype of the SNP molecular marker is GG, the sample to be tested is a barley germplasm rich in β-glucan;
[0013] When the genotype of the SNP molecular marker is AA, the sample to be tested is a barley germplasm with a low β-glucan content.
[0014] Preferably, the reagent for detecting the SNP molecular marker in the genomic DNA of the sample to be tested includes the primer or the kit.
[0015] Preferably, the reaction system for detecting the SNP molecular marker in the genomic DNA of the sample to be tested is 25 μl, specifically including: KOD One TM PCR MasterMix 12.5 μl, 10 μmol / L upstream primer 0.75 μl, 10 μmol / L downstream primer 0.75 μl, template DNA 2 μl, and sterile water 9 μl.
[0016] Preferably, the reaction program for detecting the SNP molecular marker in the genomic DNA of the sample to be tested is: pre-denaturation at 94 °C for 3 min; denaturation at 98 °C for 10 s, annealing at 55 °C for 5 s, extension at 68 °C for 5 s, for 35 cycles; extension at 68 °C for 5 min.
[0017] The present invention provides an SNP molecular marker related to the trait of β-glucan content in barley grains. The SNP molecular marker has a G / A polymorphism at the 110th position on the DNA fragment with the nucleotide sequence shown in SEQ ID NO:3. Through genome-wide association analysis of the β-glucan content and the SNP molecular markers obtained by resequencing in 265 barley materials, an SNP locus significantly related to the β-glucan content is obtained, specifically S4H_596184063. Further verification shows that based on the genotyping results of the SNP molecular marker, the β-glucan content of barley materials can be accurately judged, and the consistency reaches 100%. It can be seen that the SNP molecular marker provided by the present invention is accurate, efficient, convenient and stable for amplification, and can be used for molecular marker-assisted selection to improve the identification efficiency of barley varieties with different β-glucan contents. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 It is a box plot of the β-glucan content among different haplotypes of 265 barley materials. DETAILED DESCRIPTION OF THE INVENTION
[0019] The present invention provides an SNP molecular marker related to the trait of β-glucan content in barley grains. The SNP molecular marker has a G / A polymorphism at the 110th position on the DNA fragment with the nucleotide sequence shown in SEQ ID NO:3( CGCATAGCCGACCCGTAAAA AGACATGTTCTGCAAATATTCTTTTTTAGC GTCCGTTTACGGAGTGTAACTCTGCCGTCGCCCGCACCGGCCCGCAAAGC CATTTTTCT[G / A]CAAAGTTGTCGTTATACATGGTTTGCTAGAGATGCTTTAAGAGACAACCAACACAGGATGCAGA GCGGCAAAGTTCAA TAGCCA , where the underlined part represents the amplification primer).
[0020] In the present invention, the name of the SNP molecular marker is S4H_596184063, which is obtained by resequencing and is located at the 596184063rd base on chromosome 4 of the Morex V3 version of the barley genome.
[0021] In the present invention, through genome-wide association analysis of the β-glucan content and SNP loci in barley grains, it is known that the SNP (S4H_596184063) shows a significant correlation with the β-glucan content in barley grains. The -LOG10(P) value of the SNP molecular marker is 12.85, which is greater than the population threshold of 7. The SNP locus is a polymorphic locus of base G / A.
[0022] The present invention provides a primer for detecting the SNP molecular marker, including an upstream primer with a nucleotide sequence shown in SEQ ID NO:1 (5’-CGCATAGCCGACCCGTAAAA-3’) and a downstream primer with a nucleotide sequence shown in SEQ ID NO:2 (5’-TGGCTATTGAACTTTGCCGC-3’).
[0023] In the present invention, the primer obtains a DNA fragment with a nucleotide sequence shown in SEQ ID NO:3 through a PCR amplification reaction. Sequencing the DNA fragment, there is a G / A polymorphism at the 110th position in the sequencing peak map. When the 110th position in the sequencing result is the G locus, it is determined that the genotype of this SNP locus is GG; when the 110th position in the sequencing peak map is A, it is determined that the genotype of this SNP locus is the AA genotype; when both G and A appear at the 82nd position in the sequencing peak map, it is determined that the genotype of this SNP locus is the GA genotype.
[0024] The present invention does not impose special restrictions on the source of the primer, and the well-known artificial synthesis method in the art can be used. In the embodiments of the present invention, the primer was entrusted to Zhejiang Shangya Biotechnology Co., Ltd. for synthesis.
[0025] The present invention provides a kit for screening barley rich in β-glucan, including the primer and a PCR amplification premix.
[0026] The present invention does not impose special restrictions on the type of the PCR amplification premix, and the well-known PCR amplification premix in the art can be used. In the embodiments of the present invention, the PCR amplification premix preferably includes KOD One TM PCR MasterMix.
[0027] The present invention provides the application of the SNP molecular marker, the primer or the kit in barley breeding.
[0028] In the present invention, the barley breeding includes preferably screening and / or evaluating materials for the β-glucan content in barley grains. The method of the barley breeding preferably includes using the SNP molecular marker as the detection object, and screening and / or evaluating materials for the β-glucan content in barley grains by analyzing the genotype of the SNP molecular marker. The present invention does not impose special restrictions on the method of analyzing the genotype of the SNP molecular marker, and the well-known schemes in the art can be used, such as obtaining through genome resequencing or obtaining through PCR amplification combined with sequencing method.
[0029] The present invention provides a method for screening barley germplasms with different contents of β-glucan, comprising the following steps: detecting the SNP molecular marker in the genomic DNA of a sample to be tested, analyzing the genotype of the SNP molecular marker, and judging the richness of β-glucan in the sample to be tested according to the genotype:
[0030] When the genotype of the SNP molecular marker is GG, the sample to be tested is a barley germplasm rich in β-glucan;
[0031] When the genotype of the SNP molecular marker is AA, the sample to be tested is a barley germplasm with a low content of β-glucan.
[0032] In the present invention, the sample to be tested preferably includes barley grains or barley grain powder. The present invention has no special limitation on the method for extracting the genomic DNA of the sample to be tested, and any well-known extraction method in the art can be used, such as the kit method or the CTAB method.
[0033] In the present invention, the method for detecting the SNP molecular marker in the genomic DNA of the sample to be tested includes genome resequencing or a PCR amplification combined with sequencing method. The reagents for detecting the SNP molecular marker in the genomic DNA of the sample to be tested preferably include the primers or the kit.
[0034] In the present invention, PCR amplification is carried out using the primers in the above technical solution to obtain a DNA fragment containing the SNP molecular marker, and then sequencing is carried out to obtain the DNA fragment sequence containing the SNP molecular marker. The reaction system of the PCR is preferably 25 μl, specifically including: KOD One TM PCR Master Mix 12.5 μl, 10 μmol / L upstream primer 0.75 μl, 10 μmol / L downstream primer 0.75 μl, template DNA 2 μl, and sterile water 9 μl. The reaction program of the PCR is preferably: pre-denaturation at 94 °C for 3 min; denaturation at 98 °C for 10 s, annealing at 55 °C for 5 s, extension at 68 °C for 5 s, 35 cycles; extension at 68 °C for 5 min. The present invention analyzed 265 barley materials as objects and found that SNP (S4H_596184063) was significantly correlated with the β-glucan content in barley grains, and the β-glucan content of GG-type barley materials was significantly higher than that of AA-type barley materials; further, using 16 barley mini-core germplasm resources as materials, based on the SNP molecular marker, 8 materials with a high content of β-glucan and 8 materials with a low content of β-glucan can be accurately screened and detected.
[0035] In the present invention, by developing SNP molecular markers related to the β-glucan content in barley grains, on the one hand, it helps to deeply understand the genetic basis of the β-glucan content in barley and provides important clues for revealing its complex genetic regulation mechanism; on the other hand, the SNP molecular markers can be used as molecular breeding tools for early screening and precise selection of barley varieties with ideal β-glucan content, thereby improving breeding efficiency and accelerating the breeding process of excellent varieties. In addition, the SNP molecular markers can also be applied to the evaluation and utilization of germplasm resources, helping to explore and retain genetic resources with excellent traits and further broadening the genetic basis of barley breeding. Therefore, the SNP molecular markers related to the β-glucan content in barley grains not only have important scientific significance but also have significant application value, having a profound impact on promoting the modernization and precision of barley breeding technology.
[0036] The following examples are used to illustrate in detail a barley SNP molecular marker and its application provided by the present invention, but they should not be construed as limiting the protection scope of the present invention.
[0037] Example 1
[0038] A screening method for barley SNP molecular markers
[0039] (1) Test materials
[0040] Using 265 global barley germplasm resources as materials, including 150 cultivars and 115 landraces. They were planted in the experimental field of Jingshan, Hangzhou, Zhejiang Province from 2022 to 2023 and the grains were harvested at maturity, dried, threshed and stored for later use.
[0041] (2) Trait determination
[0042] The harvested seeds of the above barley materials were ground into powder with a flour mill, placed in a dryer for drying and storage, and used for subsequent content determination. About 20 grams of powder was weighed, and the β-glucan content of barley grains was quantitatively analyzed using the Mixed-Linkage β-Glucan Assay Kit, and each barley sample was subjected to three biological replicates.
[0043] (3) GWAS analysis and determination of SNP molecular markers
[0044] After resequencing and SNP filtering of this population, 44,117,834 high-quality SNPs were obtained. Combining with the above-determined β-glucan content, GWAS analysis was performed using the EMMAX model. The results showed that there was a continuous peak on chromosome 4, and the most significant SNP (S4H_596184063) of this peak was significantly related to the β-glucan content in barley grains. The -LOG of this SNP10 (P) value is 12.85, greater than the population threshold of 7, and the SNP locus is the difference between bases G / A.
[0045] (4) Haplotype analysis
[0046] Haplotype analysis was performed by combining SNP markers with the β-glucan content data of 265 tested materials.
[0047] The results are as Figure 1 shown. Among them, the SNP genotyping was divided into two groups, purple for the GG type and pink for the AA type. The β-glucan content of barley materials of the GG type was significantly higher than that of barley materials of the AA type.
[0048] Example 2
[0049] Verification of barley SNP molecular markers
[0050] (1) Test materials
[0051] Using 16 global barley micro-core germplasm resources (Zhang, Z., Hu, Z., Xie, S., Riaz, A., Zhang, G. and Ye, L. (2025), Natural Variation in NIN-LIKE PROTEIN 4 Associated With Spike-Response to Nitrogen in Barley. Plant, Cell & Environment. https: / / doi.org / 10.1111 / pce.15497) as materials, the determination of β-glucan content and the sequencing analysis of the target region of S4H_596184063 were carried out respectively. Specifically, as shown in Table 1, it includes 8 materials with high β-glucan content and 8 materials with low β-glucan.
[0052] (2) Obtaining of SNP markers
[0053] According to the above SNP locus information, combined with the barley whole-genome sequence information, SNP marker primers were developed. The upstream primer F is: 5’-CGCATAGCCGACCCGTAAAA-3’; the downstream primer R is: 5’-TG GCTATTGAACTTTGCCGC-3’. The amplification size is 194 bp, and the SNP is located at the 110th bp of the amplified fragment. Using the above primers, the variation of the base at 596184063 on chromosome 4 of barley was detected.
[0054] (3) DNA extraction
[0055] Using fresh leaves at the seedling stage as materials, DNA was extracted by the CTAB method. The detailed steps are as follows:
[0056] a) Place 2 small steel beads in a 1.5 ml centrifuge tube and add 400 μl of CTAB extraction buffer;
[0057] b) Take about 5 g of young barley leaves and put them into the centrifuge tube. Place it in a fully automatic sample grinder and grind at 55 HZ for 1 min, then place it in a 65 °C water bath for 1 h. Shake well every 15 min. After the water bath, let it cool to room temperature;
[0058] c) Add an equal volume of chloroform:isoamyl alcohol (24:1) solution and shake well; centrifuge at 12000 rpm for 15 min, and transfer the supernatant to a new 1.5 ml centrifuge tube;
[0059] d) Add 2 / 3 of the volume of pre-cooled isopropanol of the supernatant, slowly shake up and down for 30 s to fully mix the isopropanol and the aqueous layer, and let it stand at -20 °C for 20 min to precipitate DNA;
[0060] e) After centrifuging at 12000 rpm for 15 min, discard the supernatant; add 500 μl of 75% ethanol to wash the DNA;
[0061] f) After centrifuging at 12000 rpm for 5 min, discard the supernatant; add 500 μl of absolute ethanol to wash the DNA;
[0062] g) After centrifuging at 12000 rpm for 5 min, discard the supernatant. Dry it in a fume hood, then add 30 - 50 μl of ddH2O to dissolve the DNA, and store it at -20 °C for later use.
[0063] (4) PCR reaction
[0064] The PCR amplification reaction system is 25 μl, including the following steps: KOD One TM PCR MasterMix 12.5 μl, 10 μmol / L upstream primer 0.75 μl, 10 μmol / L downstream primer 0.75 μl, template DNA 2 μl, and sterile water 9 μl. Perform the PCR reaction on a PCR instrument, and the reaction program is as follows: pre-denaturation at 94 °C for 3 min; denaturation at 98 °C for 10 s, annealing at 54 °C for 5 s, extension at 68 °C for 5 s, 35 cycles; extension at 68 °C for 5 min, and store at 12 °C.
[0065] (5) After the reaction, sequence the reaction product for genotyping identification, and the results show that the SNP site variations are shown in Table 1.
[0066] Table 1 16 barley germplasm materials with different β-glucan contents
[0067] Barley germplasm SNP sequencing results β-glucan content (%) Index type BCS-033 G 7.53 High BCS-001 G 7.26 High BCS-211 G 7.23 High BCS-030 G 6.89 High BCS-002 G 6.57 High BCS-010 G 6.28 High BCS-041 G 6.25 High BCS-057 G 6.16 High BCS-008 A 2.65 Low BCS-086 A 2.77 Low BCS-013 A 2.89 Low BCS-298 A 3.01 Low BCS-027 A 3.10 Low BCS-019 A 3.10 Low BCS-205 A 3.12 Low BCS-300 A 3.14 Low
[0068] The above results indicate that the SNP molecular markers developed in the present invention can be applied to the molecular marker-assisted selection of the β-glucan content in barley grains to improve the accuracy of selection.
[0069] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. A SNP molecular marker related to the trait of β-glucan content in barley grains, characterized in that, The SNP molecular marker has a G / A polymorphism at the 110th position on the DNA fragment with a nucleotide sequence as shown in SEQ ID NO:
3.
2. A primer for detecting the SNP molecular marker described in claim 1, characterized in that, It includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO:1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:
2.
3. A kit for screening barley rich in β-glucan, characterized in that, It includes the primer described in claim 2 and a PCR amplification premix.
4. The kit according to claim 3, characterized in that, The PCR amplification premix includes KOD One TM PCR Master Mix.
5. The application of the SNP molecular marker described in claim 1, the primer described in claim 2, or the kit described in claim 3 or 4 in barley breeding.
6. The application according to claim 5, characterized in that, The barley breeding includes materials for screening and / or evaluating the β-glucan content in barley grains.
7. A screening method for barley germplasms with different contents of β-glucan, characterized in that, It includes the following steps: Detect the SNP molecular marker described in claim 1 in the genomic DNA of the sample to be tested, analyze the genotype of the SNP molecular marker, and judge the abundance of β-glucan in the sample to be tested according to the genotype: When the genotype of the SNP molecular marker is GG, the sample to be tested is a barley germplasm rich in β-glucan; When the genotype of the SNP molecular marker is AA, the sample to be tested is a barley germplasm with a low β-glucan content.
8. The screening method according to claim 7, wherein The reagent for detecting the SNP molecular marker in the genomic DNA of the sample to be tested includes the primer described in claim 2 or the kit described in claim 3.
9. The screening method according to claim 8, wherein The reaction system for detecting the SNP molecular marker in the genomic DNA of the sample to be tested is 25 μl, specifically including: KOD One TM PCR Master Mix 12.5 μl, 10 μmol / L upstream primer 0.75 μl, 10 μmol / L downstream primer 0.75 μl, template DNA 2 μl, and sterile water 9 μl.
10. The screening method according to any one of claims 7 to 9, characterized in that The reaction procedure for detecting the SNP molecular marker in the genomic DNA of the sample to be tested is: pre-denaturation at 94°C for 3 min; denaturation at 98°C for 10 s, annealing at 55°C for 5 s, extension at 68°C for 5 s, 35 cycles; extension at 68°C for 5 min.