A fluorescence hybridization chain reaction biosensor based on the presence of granzyme b and its application

Abstract

The application discloses a fluorescence hybridization chain reaction biosensor based on the existence of granzyme B and application thereof, and realizes real-time detection of T cell effector molecules by establishing a fluorescence hybridization chain reaction biosensor based on the existence of active granzyme B, and has the characteristics of short amplification time, simple operation, high amplification efficiency, simple reaction system and high economic benefit. By introducing peptide nucleic acid into the hybridization chain reaction system, the cutting of the substrate by granzyme B is successfully used as the starting recognition event of the hybridization chain reaction, and after the cutting of the peptide substrate in the peptide nucleic acid by granzyme B, the foothold is exposed, the strand displacement reaction is mediated, the fluorescence signal is restored after amplification, and a new strategy of using the hybridization chain reaction for detecting active cytokines is provided. The strategy makes the hybridization chain reaction using fluorescence as a signal output mode applicable to active protein detection, and has the advantages of a simple reaction system, few operation steps and low detection cost.

Description

Technical Field

[0001] This invention relates to the field of biosensing technology, specifically to a fluorescent hybridization chain reaction biosensor based on the presence of granzyme B and its applications. Background Technology

[0002] Nucleic acid amplification methods are diverse, and can be classified into enzyme-free and enzyme-based amplification according to enzyme requirements; and into thermal cycling and isothermal amplification according to heating methods. Isothermal enzyme-free amplification technology can achieve faster and more efficient amplification without the use of a thermal cycler. Among them, hybridization chain reaction is an isothermal enzyme-free amplification technology, which has the advantages of being enzyme-free, isothermal, highly sensitive, and easy to program. It has now become a powerful molecular diagnostic tool and is widely used in the field of biological detection. At the same time, optical detection and analysis methods provide effective tools for the qualitative and quantitative analysis of analytes. The generation and output of fluorescence signals are widely used, not only for the sensitive detection of analytes in vitro, but also for the detection of analytes in vivo and for bioimaging.

[0003] Various detection methods are based on hybridization chain reactions, but most detect specific nucleic acid sequences or membrane proteins. For example, patent application CN111175506A discloses a sensor and method for detecting carcinoembryonic antigen (CEA) based on hybridization chain reaction and ribozyme. The sensor based on hybridization chain reaction and ribozyme includes a nucleic acid aptamer probe and a hairpin probe. The nucleic acid aptamer probe includes a nucleic acid aptamer sequence, a priming strand sequence, and a complementary sequence. The hairpin probe includes a first hairpin probe and a second hairpin probe, both of which include G-quadruplex ribozyme base sequences. The nucleic acid aptamer probe specifically recognizes CEA. The nucleic acid aptamer probe undergoes conformational change, causing the first and second hairpin probes to form double-stranded DNA. Simultaneously, in the presence of hemin, the first and second hairpin probes self-assemble to form a hemin / G-quadruplex ribozyme. The hemin / G-quadruplex ribozyme catalyzes the oxidation of thiamine mediated by hydrogen peroxide and emits fluorescence, enabling the quantitative detection of CEA. Patent application CN119410753A discloses a fluorescent aptamer sensor based on hybridization chain reaction and its application. This fluorescent aptamer sensor includes a nucleic acid aptamer probe, a complementary strand probe, and a hairpin probe, with the hairpin probe comprising a first hairpin probe and a second hairpin probe. This invention utilizes the high specificity of nucleic acid aptamers and the signal amplification of the hybridization chain reaction to improve the selectivity and sensitivity of AFM1 detection. It has advantages such as isothermal amplification, high specificity, high sensitivity, and low cost, enabling simple, rapid, highly sensitive, and highly specific detection of AFM1.

[0004] However, few researchers have used hybridization chain reactions to detect cytokine release levels. Granzyme B, as an effector molecule released after activation of tumor-specific T cells, plays a crucial role in tumor-specific T cell-mediated killing of tumor cells. Therefore, there is a need to develop a fluorescent hybridization chain reaction system for real-time detection of granzyme B release levels, enabling a simpler, lower-cost, and faster sensitive detection of tumor-specific T cell effector molecules. Summary of the Invention

[0005] The purpose of this invention is to develop a fluorescent hybridization chain reaction system for detecting granzyme B release levels.

[0006] To achieve the objectives of this invention, the conventional hybridization chain reaction was redesigned and modified. Several T bases were added as spacers to the 5' end of the trigger sequence, and cholesterol modification was introduced at the 5' end. A peptide-nucleic acid complementary pairing region was added to the 3' end of hairpin sequence 1 for complementary pairing with the peptide-nucleic acid sequence. Simultaneously, a fluorescent group and a quencher group were modified inside hairpin sequence 1. When the hairpin sequence is in a hairpin state, the fluorescence of the fluorescent group is quenched. Once a certain level of active granzyme B is present in the fluorescent hybridization chain reaction environment, the presence of granzyme B can cleave the granzyme B substrate modified on the peptide-nucleic acid sequence. The complementary small peptide-nucleic acid fragment spontaneously falls off, re-exposing the host sequence. The trigger sequence then initiates the hybridization chain reaction to form a long double-stranded product, restoring the fluorescence of the fluorescent group, ultimately achieving real-time detection of the granzyme B release level.

[0007] On the one hand, the present invention provides a fluorescent hybridization chain reaction based on the presence of granzyme B, which includes only the fluorescent hybridization chain reaction system.

[0008] The fluorescent hybridization chain reaction system includes a trigger sequence, a peptide nucleic acid sequence, and two hairpin sequences (hairpin sequence 1 and hairpin sequence 2).

[0009] The trigger sequence adds a T base spacer sequence at the 5' end and introduces cell membrane surface modifications for embedding into the cell membrane surface;

[0010] Preferably, the T-base spacer sequence added to the 5' end of the trigger sequence consists of 10 to 20 T bases. Most preferably, 15 T bases are added to the 5' end.

[0011] The cell surface modification techniques include lipid modification, protein modification, electrostatic interaction modification, hydrophobic interaction modification, chemical coupling modification, or biotin-avidin system modification. In this embodiment of the invention, cholesterol modification is used as an example.

[0012] The peptide nucleic acid sequence contains a fragment of granzyme B substrate;

[0013] The hairpin sequence 1 is modified with a fluorescent group near its 5' end chain j, and with a quenching group modified on the T base near its 5' end. The hairpin end is an OMe modified base pair.

[0014] The hairpin sequence 2 has an OMe modified base pair at the hairpin end;

[0015] The fluorescent group is a molecule that can generate a strong fluorescent signal when excited by excitation light;

[0016] Preferably, the fluorescent group is a substance that can emit fluorescence when excited by a 620nm excitation wavelength;

[0017] Preferably, the fluorescent group is a Cy5 fluorescent group;

[0018] The quenching group can quench the fluorescence of the fluorescent group in the hairpin structure;

[0019] Preferably, the quenching group is a BHQ2 quenching group;

[0020] The OMe modification can enhance the nuclease tolerance of nucleic acid sequences;

[0021] The granzyme B substrate contained in the peptide nucleic acid sequence can be cleaved by granzyme B.

[0022] The trigger sequence can initiate the hybridization chain reaction of the two hairpins through a foothold-mediated chain displacement reaction after the hairpin sequence 1 is cleaved by granzyme B to expose the foothold.

[0023] On the other hand, the present invention provides the reaction conditions for the above-mentioned fluorescent hybridization chain reaction:

[0024] The concentration of the trigger sequence is 50–100 nM; preferably, it is 80 nM.

[0025] The concentration of the hairpin sequence 1-peptide nucleic acid assembly is 100–200 nM; preferably, it is 150 nM.

[0026] The concentration of hairpin sequence 2 is 50–150 nM; preferably, it is 100 nM.

[0027] The complementary pairing of the hairpin sequence 1 with the peptide nucleic acid sequence is achieved through the following steps:

[0028] The hairpin sequence 1 and the peptide nucleic acid sequence are mixed at an equivalent ratio of 1:1.2 to 2.4 and incubated at 30 to 45°C in the dark for 15 to 30 minutes. Specifically, the reaction process includes incubation at 42°C in the dark for 15 minutes, followed by overnight incubation at 4°C for later use.

[0029] Fluorescent hybridization chain reaction process; incubation at 25-37°C in the dark for 2-5 hours; specifically, the reaction process includes incubation at 37°C in the dark for 4 hours.

[0030] On the other hand, the present invention provides the reaction sequence of the above-mentioned fluorescent hybridization chain reaction:

[0031] Triggering subsequence:

[0032] 5'-cholesterol-TTTTTTTTTTTTTTTACAACAGCCTCAAGATCATC-3'

[0033] (SEQ ID NO.1);

[0034] Peptide nucleic acid sequence: 5'-GCCGCCGCCTT-KIEPDK-ACAACA-3' (SEQ ID NO.2);

[0035] Card issuance sequence 1:

[0036] 5'-OMeG / OMeC / OMeC / TCAAG / Cy5 / ATCATCGTGCTGGATGA / BHQ2 / TCTTGAGGCTGTTGTGCAAGGCGGC / OMeG / OMeG / OMeC / -3' (SEQ ID NO. 3);

[0037] Card issuance sequence 2:

[0038] 5'-OMeC / OMeA / OMeG / CACGATGATCTTGAGGCACAACAGCCTCAAGAT / OMeC / 0MeA / T / OMeC / -3' (SEQ ID NO. 4);

[0039] In this sequence, Cy5 is a fluorescent group modified inside the nucleic acid sequence, and BHQ2 is a quenching group modified on the T base. Specifically, as shown in SEQ ID NO.3, the fluorescent group is modified on the 8th-12th base sequence near the 5' end, and the quenching group is modified on the 25th-30th T base position near the 5' end.

[0040] On the other hand, the present invention also provides a fluorescent hybridization chain reaction biosensor based on the presence of granzyme B.

[0041] Including fluorescent hybridization chain reaction systems;

[0042] The fluorescent hybridization chain reaction system includes a trigger sequence and two hairpin sequences;

[0043] Preferably, hairpin sequence 1 needs to be complementary to peptide nucleic acid sequence at a ratio of 1:1.2 to 2.4 before detection; more preferably, complementary pairing at a ratio of 1:2.4.

[0044] Preferably, the hairpin sequence 1 is labeled with a fluorescent group near its 5' end chain j; preferably, the fluorescent group is labeled between the 8th and 9th bases;

[0045] Preferably, hairpin sequence 1 is marked with a quenching group near its 5' end T base, and more preferably, the quenching group is marked with a quenching group at the 26th T base;

[0046] Preferably, the hairpin sequence 1 has an OMe-modified base pair at its end; preferably, the hairpin sequence 2 has an OMe-modified base pair at its end.

[0047] Preferably, the granzyme B peptide substrate in the peptide nucleic acid sequence can be cleaved by granzyme B; preferably, the granzyme B tetrapeptide substrate is IEPD.

[0048] Preferably, the trigger sequence can initiate a hybridization chain reaction between the two hairpin sequences via a foothold-mediated chain displacement reaction after the hairpin sequence-peptide nucleic acid assembly is cleaved by granzyme B;

[0049] Further preferably, the trigger sequence is shown in SEQ ID NO.1; preferably, the peptide nucleic acid sequence is shown in SEQ ID NO.2; preferably, the hairpin sequence 1 is shown in SEQ ID NO.3; preferably, the hairpin sequence 2 is shown in SEQ ID NO.4.

[0050] The analytical principle of this biosensor is as follows: A peptide nucleic acid sequence complementary to the anchor portion of hairpin sequence 1 is designed, and the peptide nucleic acid sequence is modified with a granzyme B substrate sequence. The peptide nucleic acid sequence is pre-paired with hairpin sequence 1 to mask the anchor portion of hairpin sequence 1. Simultaneously, fluorescent and quenching groups are modified on the j and T bases near the 5' end of hairpin sequence 1, respectively. When the sequence forms a hairpin structure, fluorescence is quenched. The 5' end of the trigger sequence is modified with a cholesterol molecule to facilitate its embedding on the cell membrane surface. When active granzyme B appears in the system and reaches a certain level, active granzyme B cleaves the peptide substrate fragment on the peptide nucleic acid-hairpin sequence 1. After cleavage, some peptide nucleic acid fragments detach freely at 37°C, exposing the anchor sequence. Subsequently, the trigger sequence initiates a fluorescent hybridization chain reaction through an anchor-mediated chain substitution reaction to form a long double-stranded product. At this point, the fluorescence signal is no longer quenched, and the fluorescence signal is significantly enhanced.

[0051] The specific reaction method is as follows:

[0052] The 10 μM hairpin sequence 1 and the 100 μM peptide nucleic acid sequence were mixed in hybridization buffer at a ratio of 1:2.4, incubated at 42 °C in the dark for 15 min, and then incubated at 4 °C overnight for later use.

[0053] The hybridization buffer solution is formulated as follows: 25 mM HEPES, 120 mM NaCl, 5 mM MgCl2, pH 7.4.

[0054] The trigger sequence at a concentration of 80 nM was co-incubated with hairpin sequence 1 at a concentration of 150 nM and hairpin sequence 2 at a concentration of 100 nM in the T cell activation culture medium and incubated at 37°C in the dark for 4 h.

[0055] The present invention also provides the application of the biosensor in detecting the level of granzyme B released after T cell activation, wherein the T cells are activated by a CD3×NYESO-1 bispecific antibody.

[0056] The present invention also provides the application of the biosensor in detecting the level of granzyme B released when bispecific antibodies kill tumor cells, wherein the ratio of effector cells to target cells is 2:1, the killing time is 36 hours, and the fluorescence signal reflects the level of granzyme B release.

[0057] This invention also provides a method for detecting granzyme B not for the purpose of disease diagnosis or treatment, using the aforementioned fluorescent hybridization chain reaction system, comprising the following steps:

[0058] Pre-assemble hairpin sequence 1 with peptide nucleic acid sequence;

[0059] Add the sample to be tested and incubate to trigger a hybridization chain reaction;

[0060] The concentration of granzyme B was quantified by changes in fluorescence intensity.

[0061] The test sample is either the culture medium after T cell activation or the cell culture medium in a bispecific antibody-mediated tumor killing model.

[0062] The fluorescence signal is detected at an excitation wavelength of 620 nm and emitted at an emission wavelength of 670 nm.

[0063] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0064] This invention establishes a fluorescent hybridization chain reaction (HCR) biosensor based on the presence of active granzyme B, enabling real-time detection of T-cell effector molecules. It features short amplification time, simple operation, high amplification efficiency, a simple reaction system, and high cost-effectiveness. By introducing peptide nucleic acids into the HCR system, granzyme B cleavage of the substrate is successfully used as the initiation recognition event for the HCR. After granzyme B cleaves the peptide substrate in the peptide nucleic acid, a site is exposed, mediating a chain displacement reaction, allowing the fluorescence signal to be recovered after amplification. This provides a novel strategy for using HCR to detect active cytokines. This strategy enables HCR with fluorescence as the signal output method to be used for the detection of active proteins, with a simple reaction system, few operation steps, and low detection cost. Attached Figure Description

[0065] Figure 1 This is based on the principle of fluorescent hybridization chain reaction in the presence of granzyme B.

[0066] Figure 2 To demonstrate the feasibility of fluorescence hybridization chain reaction based on the presence of granzyme B; where A is the 10% native page electrophoresis result of nucleic acid after sequence amplification and the 10% native page electrophoresis result of nucleic acid after blocking with peptide nucleic acid sequence; B is a characterization of the change in fluorescence intensity after sequence amplification and introduction of peptide nucleic acid; where P-H1 represents peptide nucleic acid-hairpin sequence 1.

[0067] Figure 3 Cholesterol-modified trigger sequences in CD3 + Embedded flow cytometry results on T cells.

[0068] Figure 4 CD3 + Feasibility verification of fluorescent hybridization chain reaction on T cell membrane.

[0069] Figure 5 For the fluorescent hybridization chain reaction after activation, CD3 + Figure 1 shows the flow cytometry results of granzyme B on T cells and its comparison with the results of flow cytometry antibody detection.

[0070] Figure 6 The graph shows the flow cytometry results of granzyme B released during bispecific antibody-mediated T cell killing of tumor cells using fluorescent hybridization chain reaction, and a comparison with the results of flow cytometry antibody method.

[0071] Figure 7 This is a diagram showing the results of the specificity verification of the fluorescent hybridization chain reaction. Detailed Implementation

[0072] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0073] In this invention, the complementary pairing buffer formulation is: 25mM 4-hydroxyethylpiperazine ethanesulfonic acid (HEPES), 120mM sodium chloride (NaCl), 5mM magnesium chloride (MgCl2), pH 7.4; the amplification buffer is: RPMI-1640 medium (phenol red-free), 1% fetal bovine serum, and 1% penicillin-streptomycin mixed solution.

[0074] Example 1: Establishment of a fluorescent hybridization chain reaction biosensor for detecting granzyme B release levels

[0075] 1. Experimental materials

[0076] 25mM HEPES, 120mM NaCl, 5mM MgCl2, hydrochloric acid (HCl), RPMI-1640 medium (phenol red-free), fetal bovine serum, penicillin-streptomycin mixture, CD3×NYESO-1 bispecific antibody, etc.

[0077] The nucleic acid sequences used in the experiment are shown in Table 1.

[0078] Table 1

[0079]

[0080] Note: Cy5 is a labeled fluorescent group, and BHQ2 is a labeled quencher group.

[0081] 2. Design principles of fluorescent hybridization chain reactions

[0082] A peptide nucleic acid sequence complementary to the anchorage portion of hairpin sequence 1 was designed, and the peptide nucleic acid sequence was modified with a granzyme B substrate sequence. The peptide nucleic acid sequence was pre-paired with hairpin sequence 1 (hairpin1) to mask the anchorage of hairpin sequence 1. Simultaneously, fluorescent and quenching groups were modified on the j and T bases near the 5' end of hairpin sequence 1, respectively. When hairpin sequence 1 forms a hairpin structure, fluorescence is quenched. A cholesterol molecule was modified at the 5' end of the trigger sequence to facilitate its embedding on the cell membrane surface. When active granzyme B appeared in the system and reached a certain level, active granzyme B cleaved the peptide substrate fragment on the peptide nucleic acid-hairpin sequence 1 (P-H1). After cleavage, a small portion of the peptide nucleic acid fragment detached freely at 37°C, exposing the anchorage sequence. Subsequently, the trigger sequence, already embedded on the cell membrane surface, initiated a fluorescent hybridization chain reaction through an anchorage-mediated chain displacement reaction to form a long double-stranded product. At this point, the fluorescence signal was no longer quenched, and the fluorescence signal was significantly enhanced. Figure 1 ).

[0083] 3. Feasibility verification of fluorescent hybridization chain reaction (Nucleic Acid Native Page)

[0084] First, the trigger sequence, hairpin sequence 1, and hairpin sequence 2 (hairpin2) were dissolved in 1×HBS buffer to prepare a 10 μM solution, and the peptide nucleic acid was dissolved in 1×HBS buffer to prepare a 100 μM solution. Appropriate amounts of the trigger sequence, hairpin sequence 1, hairpin sequence 2, and peptide nucleic acid sequence were heated at 95°C for 5 min, rapidly cooled to 4°C, and incubated at this temperature for 1 h. 10 μM of hairpin sequence 1 and 100 μM of peptide nucleic acid sequence were mixed at a 1:2.4 equivalent ratio, heated at 42°C for 15 min, and then incubated overnight at 4°C.

[0085] For hybridization chain reactions that did not use peptide nucleic acid blocking site sequences, the groupings were as follows: hairpin sequence 1 (1 μM), hairpin sequence 2 (1 μM), hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM), trigger sequence (100 nM) + hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM), trigger sequence (200 nM) + hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM), trigger sequence (500 nM) + hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM), trigger sequence (1 μM) + hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM);

[0086] For hybridization chain reactions using peptide nucleic acid blocking site sequences, the groupings are as follows: hairpin sequence 1 (1 μM), hairpin sequence 2 (1 μM), peptide nucleic acid - hairpin sequence 1 (1 μM), peptide nucleic acid - hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM), trigger sequence (100 nM) + peptide nucleic acid - hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM), trigger sequence (500 nM) + peptide nucleic acid - hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM), trigger sequence (1 μM) + peptide nucleic acid - hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM), trigger sequence (1 μM) + hairpin sequence 1 (1 μM) + hairpin sequence 2 (1 μM);

[0087] The above reaction groups were incubated at 37°C for 4 hours. After the reaction, 1 μM of the reaction solution was taken for nucleic acid native page verification. Figure 2 A) By Figure 2 As shown in A, in the absence of a trigger sequence, hairpin sequence 1 + hairpin sequence 2 did not undergo hybridization chain reaction amplification. However, in the presence of a trigger sequence, as the concentration of the trigger sequence increased, the bands of hairpin sequence 1 + hairpin sequence 2 gradually faded, and hybridization chain reaction products of longer double-stranded fragments with larger molecular weights began to appear. After blocking the base portion of hairpin sequence 1 using a peptide nucleic acid sequence, the hybridization chain reaction was significantly weakened. Figure 2 A).

[0088] Note: The sequences used in the nucleic acid native page do not contain fluorescent groups or quencher groups, nor do they contain cholesterol modifications.

[0089] 4. Feasibility verification of fluorescent hybridization chain reaction (fluorescence characterization)

[0090] First, the trigger sequence, hairpin sequence 1, and hairpin sequence 2 were dissolved in 1×HBS buffer to prepare a 10 μM solution, and the peptide nucleic acid was dissolved in 1×HBS buffer to prepare a 100 μM solution. Appropriate amounts of the trigger sequence, hairpin sequence 1, hairpin sequence 2, and peptide nucleic acid sequence were heated at 95°C for 5 min, rapidly cooled to 4°C, and incubated at this temperature for 1 h. 10 μM of hairpin sequence 1 and 100 μM of peptide nucleic acid sequence were mixed at a 1:2.4 equivalent ratio, heated at 42°C for 15 min, and then incubated overnight at 4°C.

[0091] The reaction groups were: hairpin sequence 1 (100 nM) + hairpin sequence 2 (100 nM), peptide nucleic acid - hairpin sequence 1 (100 nM) + hairpin sequence 2 (100 nM), and trigger sequence (40 nM) + peptide nucleic acid - hairpin sequence 1 (100 nM) + hairpin sequence 2 (100 nM). The mixtures were incubated at 37°C for 4 hours in the dark. Fluorescence intensity was detected using a microplate reader set to 620 nm excitation and 670 nm emission. Figure 2 B). By Figure 2 As shown in section B, in the absence of the trigger sequence, hairpin sequence 1 + hairpin sequence 2 did not undergo hybridization chain reaction amplification, resulting in low fluorescence intensity. However, in the presence of the trigger sequence, the fluorescence intensity significantly increased, indicating that the hybridization chain reaction occurred. After blocking the base region of hairpin sequence 1 using a peptide nucleic acid sequence, a significant decrease in fluorescence intensity was observed, indicating that the hybridization chain reaction was significantly inhibited. The characterization results are consistent with those of the nucleic acid native page.

[0092] 5. Feasibility verification of the embedding of the trigger sequence on the PBMC cell membrane

[0093] The trigger sequence was designed with 5' cholesterol modification and 3' FAM modification. The modified trigger sequence was dissolved in 1×HBS to prepare a 10μM solution. An appropriate amount of the trigger sequence was heated at 95℃ for 5 min, then rapidly cooled to 4℃ and incubated for 1 h. PBMC cells were aliquoted into 1.5 ml EP tubes (1×10⁻⁶ cells / mL). 6 Add 200 μL of trigger sequences (0 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 100 nM) to each tube and incubate at room temperature for 30 min. Wash three times with 1×PBS. Add 0.5 μL of rabbit anti-human CD3-PE antibody (0.5 mg / ml) and incubate at 4℃ for 30 min. Wash three times with 1×PBS. Detect by flow cytometry. Results ( Figure 3 This indicates that as the concentration of the trigger sequence increases, the average fluorescence intensity on the cell surface also increases.

[0094] 6. Feasibility verification of hybridization chain reaction on T cell membrane

[0095] First, collect T cells (1.5 × 10⁻⁶) after sorting with magnetic beads. 6 / tube), add 5' cholesterol-modified trigger sequences (20 nM, 40 nM, 80 nM), hairpin sequence 1 (150 nM), and hairpin sequence 2 (100 nM) to a final volume of 300 μL, incubate at 37°C for 4 h in the dark, wash 3 times with 1×PBS, add rabbit anti-human CD3-FITC antibody (0.5 μL / tube, 0.5 mg / ml) and incubate at 4°C for 30 min, wash 3 times with 1×PBS, and analyze by flow cytometry. Results ( Figure 4 This indicates that the fluorescent hybridization chain reaction can occur on the surface of T cell membranes, and the average fluorescence intensity of cells gradually increases with the increase of the incubation concentration of the trigger sequence.

[0096] Example 2: Fluorescent hybridization chain reaction for detecting granzyme B release levels in activated T cells.

[0097] T cells sorted by magnetic beads were seeded into 6-well plates (3×10⁻⁶). 6 Add 2 μL of cell stimulation mixture (500×) to each well (catalog number 00-4970-93, eBioscience) ( / ml). TM Incubate overnight at 37°C. After activation, take 350 μL of cell culture medium from each tube and add peptide nucleic acid-hairpin sequence 1 (150 nM), hairpin sequence 2 (100 nM), and trigger sequences (20 nM, 40 nM, 80 nM). Incubate at 37°C in the dark for 4 h, wash three times with 1×PBS, add rabbit anti-human CD3-FITC antibody (0.5 μL / tube, 0.5 mg / ml), incubate at 4°C for 30 min, wash three times with 1×PBS, and analyze by flow cytometry. Results ( Figure 5 The results showed that, compared with the flow cytometry method for granzyme B, the fluorescence hybridization chain reaction method had better discrimination, and the average fluorescence intensity of cells increased with the increase of the incubation concentration of the trigger sequence.

[0098] Example 3: Fluorescent hybridization chain reaction for detecting granzyme B release levels during bispecific antibody-mediated tumor killing.

[0099] T-cell connector bispecific antibodies can mediate the specific killing of tumor cells by T cells, bypassing the TCR-MHC recognition mechanism, and show great promise in tumor immunotherapy. A375 cells, T cells sorted by magnetic beads, and CD3×NYESO-1 bispecific antibody (see patent application number 2023116435708) were used. The effector-to-target ratio was controlled at 2:1. The cells were grouped according to the bispecific antibody concentration (0 pM, 0.1 pM, 1 pM, 10 pM, 1000 pM), with three replicates. After killing the cells at 37°C for 36 hours, the cell culture plates were displaced, and 350 μL of cell culture medium was added to a protein transport inhibitor mixture (500×) (catalog number 00-4980-03, eBioscience). TM The trigger sequence (80 nM), peptide nucleic acid-hairpin sequence 1 (150 nM), and hairpin sequence 2 (100 nM) were incubated at 37°C in the dark for 4 h, washed three times with 1×PBS, and then incubated at 4°C for 30 min with rabbit anti-human CD3-FITC antibody (0.5 μL / tube, 0.5 mg / ml). The cells were washed three times with 1×PBS and analyzed by flow cytometry. Results ( Figure 6 The results showed that, compared with the flow cytometry method for granzyme B, the fluorescence hybridization chain reaction method had better discrimination, and the average fluorescence intensity of T cells gradually increased with the increase of the concentration of bispecific antibody incubation.

[0100] Example 4: Validation of substrate specificity of granzyme B using fluorescent hybridization chain reaction

[0101] A375 cells and T cells sorted by magnetic beads were collected, with an effector cell:target cell ratio of 2:1. CD3×NYESO-1 bispecific antibody was prepared and plated in groups with bispecific antibody concentrations (0 pM, 0.1 pM, 1 pM, 10 pM, 1000 pM), with three replicates. After killing cells at 37°C for 36 hours, the cell culture plates were displaced, and 350 μL of cell culture medium was added to a protein transport inhibitor mixture (500×) (catalog number 00-4980-03, eBioscience). TM Granulase B inhibitor (catalog number HY-P10149, MCE) (100 nM, 1 nM), after incubation at 37°C in the dark for 4 h, a trigger sequence (80 nM), peptide nucleic acid-hairpin sequence 1 (150 nM), and hairpin sequence 2 (100 nM) were added, and incubated at 37°C in the dark for 4 h. After washing three times with 1×PBS, rabbit anti-human CD3-FITC antibody (0.5 μL / tube, 0.5 mg / ml) was added and incubated at 4°C for 30 min. After washing three times with 1×PBS, the results were analyzed by flow cytometry. The results showed that ( Figure 7 The addition of granzyme B inhibitors can significantly reduce the average fluorescence intensity of cells. The higher the concentration of granzyme B inhibitors during incubation, the more significant the reduction in the average fluorescence intensity of cells.

Claims

1. A fluorescent hybridization chain reaction system for detecting granzyme B release levels, characterized in that, Includes the following components: The trigger sequence, with a 5' end containing several T-base spacer sequences and introducing cholesterol modification, is used to embed into the cell membrane surface. The trigger sequence is shown as 5'-cholesterol-TTTTTTTTTTTTTTTACAACAGCCTCAAGATCATC-3'. The hairpin sequence 1, 3' end contains a base site sequence complementary to the peptide nucleic acid sequence, internally modified with a fluorescent group and a quenching group, and terminally modified with an OMe base pair; the hairpin sequence 1 inhibits the fluorescence signal through the quenching group when not triggered, as shown in 5'-OMeG / OMeC / OMeC / TCAAG / Cy5 / ATCATCGTGCTGGATGA / BHQ2 / TCTTGAGGCTGTTGTGCAAGGCGGC / OMeG / OMeG / OMeC / -3'; Hairpin sequence 2, with OMe modified base pairs at the end, as shown in 5'-OMeC / OMeA / OMeG / CACGATGATCTTGAGGCACAACAGCCTCAAGAT / OMeC / OMeA / T / OMeC / -3'; The peptide nucleic acid sequence contains a substrate fragment specifically cleaved by granzyme B, and the peptide nucleic acid sequence is complementary to the foothold of hairpin sequence 1 to mask the trigger site, as shown in 5'-GCCGCCGCCTT-KIEPDK-ACAACA-3'. When granzyme B cleaves the substrate fragment in the peptide nucleic acid sequence, the anchor point of hairpin sequence 1 is exposed, triggering the subsequence to initiate a hybridization chain reaction between hairpin sequence 1 and hairpin sequence 2 through a chain substitution reaction, releasing a fluorescent signal.

2. The fluorescent hybridization chain reaction system according to claim 1, characterized in that, The concentration of the trigger subsequence is 50~100nM, the concentration of the hairpin sequence 1 is 100~200nM, and the concentration of the hairpin sequence 2 is 50~150nM.

3. The fluorescent hybridization chain reaction system according to claim 1, characterized in that, The complementary pairing of the hairpin sequence 1 with the peptide nucleic acid sequence is achieved through the following steps: The hairpin sequence 1 and the peptide nucleic acid sequence were mixed at an equivalent ratio of 1:1.2~2.4 and incubated in the dark at a temperature of 30~45℃ for 15~30 min.

4. The fluorescent hybridization chain reaction system according to claim 1, characterized in that, The detection reaction temperature for the fluorescent hybridization chain reaction is 25~37℃, and the reaction is incubated in the dark for 2~5 hours.

5. A biosensor based on the fluorescent hybridization chain reaction system according to any one of claims 1-4, characterized in that, The biosensor is used to detect the release level of active granzyme B in real time. The signal detection is achieved through the following steps: Granulase B cleaves the peptide nucleic acid substrate, releasing the foothold of hairpin sequence 1; The trigger sequence initiates a hybridization chain reaction, forming a long double-stranded product; The fluorescence signal was restored and was positively correlated with the granzyme B concentration.

6. The use of the biosensor according to claim 5 in the preparation of reagents or kits for detecting the level of granzyme B released after T cell activation.

7. The use of the biosensor according to claim 5 in the preparation of reagents or kits for detecting the level of granzyme B released when bispecific antibodies kill tumor cells.

8. A method for detecting granzyme B not for the purpose of disease diagnosis or treatment, characterized in that, Using the fluorescent hybridization chain reaction system according to any one of claims 1-4, the following steps are included: Pre-assemble hairpin sequence 1 with peptide nucleic acid sequence; Add the sample to be tested and incubate to trigger a hybridization chain reaction; The concentration of granzyme B was quantified by changes in fluorescence intensity.

Images