Compositions of dry powder formulations of messenger RNA and methods of use thereof

Abstract

The present disclosure provides stable dry powder messenger RNA formulations for therapeutic use and methods of making and using the same.

Description

Cross - Reference to Related Applications

[0001] This application claims the benefit of priority to U.S. Provisional Application No. 63 / 384,553, filed on November 21, 2022, the entire content of which is hereby incorporated by reference in its entirety. Submission of Sequence Listing

[0002] The sequence listing associated with this application is submitted as an XML file in electronic format and is hereby incorporated by reference in its entirety into this specification. The name of the XML file containing the sequence listing is 0171_0103_PCT_SL.xml, and the size of the XML file is 3,985 bytes. Background of the Invention

[0003] Messenger RNA therapy (MRT) is becoming an increasingly important approach for treating a variety of diseases. Lipid - encapsulated mRNA formulations, such as lipid nanoparticle (LNP) compositions, exhibit a high degree of cellular uptake and protein expression. However, currently these formulations are typically in liquid form and generally need to be administered either in the form of an injection or via a nebulizer. Compared to some less invasive routes (e.g., metered - dose inhalers), these modes of administration are less favored by patients. Lyophilized formulations sometimes do not provide reliable particle uniformity in the dry state or are not easy to handle and distribute. The lyophilized powder must be dissolved in a suitable solvent before being dispensed to patients and may undergo degradation within a few hours. Since mRNA and / or LNPs can be unstable, repeated freeze - thaw of mRNA formulations is not recommended. Summary of the Invention

[0004] Among other things, the present disclosure provides dry powder (e.g., spray - dried) formulations of mRNA encapsulated in lipid - based nanoparticles for more efficient mRNA delivery and more effective mRNA therapy. The particle size of the mRNA - LNP formulation can be important for dry - powder - based delivery of mRNA drug products. mRNA - LNP drug products generated by spray drying typically produce particles larger than 10 μm, which is not conducive to delivery to several tissues, such as the lung. Spray - drying techniques can be used to manufacture dry - powder products of mRNA - LNPs with an ideal particle - size range and desired surface characteristics by optimizing processing parameters and LNP composition and by using different combinations of solvents and excipients. Compositions containing a certain ratio of hydrophobic amino acids and / or sugar alcohols in the mRNA - LNP formulation are provided herein, which can provide fine dry - powder particles containing mRNA - loaded lipid nanoparticles. Such particles can be suitable for several delivery methods, such as inhalation, without significantly affecting the yield or stability of mRNA. Additionally, the present disclosure relates to the desired in vitro and in vivo potency of dry - powder products with minimal inflammatory response.

[0005] In some aspects, the present disclosure relates to dry powder formulations comprising messenger RNA encapsulated in lipid nanoparticles (LNPs), wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids, wherein the dry powder formulation comprises leucine and mannitol in a weight ratio between 1:1 and 1:10, and wherein the dry powder formulation has an average particle size between 1 - 8 μm. In some embodiments, the average particle size is 2 μm. In some embodiments, the average particle size is 3 μm. In some embodiments, the average particle size is 4 μm. In some embodiments, the average particle size is 5 μm. In some embodiments, the average particle size is 6 μm. In some embodiments, the average particle size is 7 μm.

[0006] In some embodiments, the dry powder formulation comprises leucine and mannitol in a weight ratio of 1:2. In some embodiments, the dry powder formulation comprises leucine and mannitol in a weight ratio of 1:3. In some embodiments, the dry powder formulation comprises leucine and mannitol in a weight ratio of 1:4. In some embodiments, the dry powder formulation comprises leucine and mannitol in a weight ratio of 1:5. In some embodiments, the dry powder formulation comprises leucine and mannitol in a weight ratio of 1:6. In some embodiments, the dry powder formulation comprises leucine and mannitol in a weight ratio of 1:7. In some embodiments, the dry powder formulation comprises leucine and mannitol in a weight ratio of 1:8. In some embodiments, the dry powder formulation comprises leucine and mannitol in a weight ratio of 1:9.

[0007] In some embodiments, the weight ratio of leucine to mannitol is 1:8.

[0008] In some embodiments, the weight ratio of leucine to mannitol is 1:4.

[0009] In some aspects, the present disclosure relates to messenger RNA encapsulated in lipid nanoparticles (LNPs), wherein the LNPs comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEGylated lipids, wherein the dry powder formulation comprises hydrophobic amino acids at a concentration between 4% and 65%, and wherein the dry powder formulation has an average particle size between 1 - 8 μm. In some embodiments, the dry powder formulation comprises hydrophobic amino acids at a concentration between 10% and 50%. In some embodiments, the dry powder formulation has an average particle size between 2 - 6 μm. In some embodiments, the average particle size of the dry powder formulation is 2 μm. In some embodiments, the average particle size of the dry powder formulation is 3 μm. In some embodiments, the average particle size of the dry powder formulation is 4 μm. In some embodiments, the average particle size of the dry powder formulation is 5 μm. In some embodiments, the average particle size of the dry powder formulation is 6 μm.

[0010] In some embodiments, the hydrophobic amino acid is leucine, isoleucine, trileucine, proleucine, glycine, valine, phenylalanine, methionine, proline, or tryptophan. In some embodiments, the hydrophobic amino acid is leucine.

[0011] In some embodiments, the dry powder formulation comprises lipid nanoparticles encapsulating mRNA, and the N / P ratio of these lipid nanoparticles is between 2 and 6. In some embodiments, the dry powder formulation comprises lipid nanoparticles encapsulating mRNA, and the N / P ratio of these lipid nanoparticles is between 3 and 4. In some embodiments, the dry powder formulation comprises lipid nanoparticles encapsulating mRNA, and the N / P ratio of these lipid nanoparticles is 3.

[0012] In some embodiments, the dry powder formulation comprises one or more cholesterol-based lipids. In some embodiments, the dry powder formulation comprises cationic lipids, and on a molar percentage basis, these cationic lipids account for about 30% - 70% of the total lipids in the LNP. In some embodiments, the dry powder formulation comprises PEGylated lipids, and on a molar percentage basis, these PEGylated lipids account for about 1% - 15% of the total lipids in the LNP. In some embodiments, the dry powder formulation comprises non-cationic lipids, and on a molar percentage basis, these non-cationic lipids account for about 10% - 40% of the total lipids in the LNP. In some embodiments, the dry powder formulation comprises one or more cholesterol-based lipids, and on a molar percentage basis, the one or more cholesterol-based lipids comprise about 5% - 40% of the total lipids in the LNP.

[0013] In some embodiments, the dry powder formulation comprises lipid nanoparticles in which the molar ratio of one or more cationic lipids to one or more non-cationic lipids to one or more cholesterol-based lipids to one or more PEGylated lipids is about 60:25:10:5. In some embodiments, the molar ratio of one or more cationic lipids to one or more non-cationic lipids to one or more cholesterol-based lipids to one or more PEGylated lipids in the lipid nanoparticles is about 40:25:30:5.

[0014] In some embodiments, the dry powder formulation has an average particle size between 1 - 5 μm. In some embodiments, the dry powder formulation has an average particle size between 1 - 3 μm.

[0015] In some embodiments, the dry powder formulation contains mRNA, and by weight, the mRNA accounts for more than 2% of the dry powder formulation. In some embodiments, the dry powder formulation contains mRNA, and by weight, the mRNA accounts for more than 3% of the dry powder formulation. In some embodiments, the dry powder formulation contains mRNA, and by weight, the mRNA accounts for more than 4% of the dry powder formulation.

[0016] In some embodiments, the encapsulation efficiency of the lipid nanoparticles contained in the dry powder formulation is greater than 60%. In some embodiments, the encapsulation efficiency of the lipid nanoparticles contained in the dry powder formulation is greater than 70%. In some embodiments, the encapsulation efficiency of the lipid nanoparticles contained in the dry powder formulation is greater than 80%.

[0017] In some embodiments, the mRNA in the dry powder formulation maintains an integrity of 80% or greater after spray drying. In some embodiments, the mRNA in the dry powder formulation maintains an integrity of 90% or greater after spray drying. In some embodiments, the mRNA in the dry powder formulation maintains an integrity of 95% or greater after spray drying.

[0018] In some embodiments, the dry powder formulation maintains 80% or greater mRNA integrity after storage at room temperature for 6 months or longer. In some embodiments, the dry powder formulation maintains 90% or greater mRNA integrity after storage at room temperature for 6 months or longer. In some embodiments, the dry powder formulation maintains 80% or greater mRNA integrity after storage at 4°C for 6 months or longer. In some embodiments, the dry powder formulation maintains 90% or greater mRNA integrity after storage at 4°C for 6 months or longer. In some embodiments, the dry powder formulation maintains 80% or greater mRNA integrity after storage at 25°C for 4 weeks or longer. In some embodiments, the dry powder formulation maintains 90% or greater mRNA integrity after storage at 25°C for 4 weeks or longer. In some embodiments, the dry powder formulation maintains 95% or greater mRNA integrity after storage at 25°C for 4 weeks or longer.

[0019] In some embodiments, the dry powder formulation has a water content of less than 0.5%. In some embodiments, the dry powder formulation has a water content of less than 0.4%. In some embodiments, the dry powder formulation has a water content of less than 0.3%. In some embodiments, the dry powder formulation has a water content of less than 0.2%. In some embodiments, the dry powder formulation has a water content of less than 0.1%.

[0020] In some embodiments, the dry powder formulation comprises mRNA encoding a therapeutic protein. In some embodiments, the mRNA encodes an antigen. In some embodiments, the mRNA encodes a vaccine. In some embodiments, the dry powder formulation is inhalable. In some embodiments, the dry powder formulation is nebulizable after reconstitution.

[0021] In some aspects, the present disclosure includes methods of in vivo delivery of mRNA, the methods comprising administering to a subject in need a dry powder formulation according to any of the embodiments disclosed herein. In some embodiments, the present disclosure includes methods of administering the dry powder formulation by inhalation. In some embodiments, the present disclosure includes methods of administering any of the dry powder formulations disclosed herein by intranasal spray. In some embodiments, the present disclosure provides methods of administering any of the dry powder formulations disclosed herein by inhaler.

[0022] In some aspects, the present disclosure includes a method for preparing a dry powder formulation, the method comprising: a) providing a mixture comprising lipid nanoparticles encapsulating mRNA, b) adding leucine and mannitol to the mixture at a weight ratio between 1:1 and 1:10, c) spray drying the mixture, and d) obtaining a dry powder formulation having an average particle size between 1 - 8 μm, and wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. In some embodiments, the weight ratio of leucine to mannitol is 1:8. In some embodiments, the weight ratio of leucine to mannitol is 1:7. In some embodiments, the weight ratio of leucine to mannitol is 1:6. In some embodiments, the weight ratio of leucine to mannitol is 1:5. In some embodiments, the weight ratio of leucine to mannitol is 1:4.

[0023] In some aspects, the present disclosure includes a method for preparing a dry powder formulation, the method comprising: a) providing a mixture comprising lipid nanoparticles encapsulating mRNA, b) adding a hydrophobic amino acid at a concentration between 4.0% - 65% to the mixture, c) spray drying the mixture, and d) obtaining a dry powder formulation having an average particle size between 1 - 8 μm, and wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. In some embodiments, the hydrophobic amino acid is leucine, isoleucine, valine, phenylalanine, methionine, proline, or tryptophan. In some embodiments, the hydrophobic amino acid is leucine. In some embodiments, the method further comprises the step of adding 20% ethanol to the mixture.

[0024] In some embodiments, the spray drying step occurs at a temperature less than 90°C. In some embodiments, the spray drying step occurs at a temperature between 20°C - 70°C.

[0025] In some embodiments, the lipid nanoparticles encapsulating mRNA have an N / P ratio between 2 and 6. In some embodiments, the lipid nanoparticles encapsulating mRNA have an N / P ratio between 3 and 4. In some embodiments, the N / P ratio of the lipid nanoparticles encapsulating mRNA is 2. In some embodiments, the N / P ratio of the lipid nanoparticles encapsulating mRNA is 3. In some embodiments, the N / P ratio of the lipid nanoparticles encapsulating mRNA is 4. In some embodiments, the N / P ratio of the lipid nanoparticles encapsulating mRNA is 5. In some embodiments, the N / P ratio of the lipid nanoparticles encapsulating mRNA is 6.

[0026] In some embodiments, the lipid nanoparticles further comprise one or more cholesterol-based lipids. In some embodiments, the lipid nanoparticles further comprise one or more cationic lipids, and on a molar percentage basis, the one or more cationic lipids account for about 30% - 70% of the total lipids in the LNP. In some embodiments, the lipid nanoparticles further comprise one or more PEGylated lipids, and on a molar percentage basis, the one or more PEGylated lipids account for about 1% - 15% of the total lipids in the LNP. In some embodiments, the lipid nanoparticles further comprise one or more non-cationic lipids, and on a molar percentage basis, the one or more non-cationic lipids account for about 10% - 40% of the total lipids in the LNP. In some embodiments, the lipid nanoparticles further comprise one or more cholesterol-based lipids, and on a molar percentage basis, the one or more cholesterol-based lipids account for about 5% - 40% of the total lipids in the LNP.

[0027] In some embodiments, the method comprises providing in the lipid nanoparticles a molar ratio of about 60:25:10:5 of one or more cationic lipids to one or more non-cationic lipids to one or more cholesterol-based lipids to one or more PEGylated lipids. In some embodiments, the method comprises providing in the lipid nanoparticles a molar ratio of about 40:25:30:5 of one or more cationic lipids to one or more non-cationic lipids to one or more cholesterol-based lipids to one or more PEGylated lipids.

[0028] In some embodiments, the average particle size is between 1 - 5 μm. In some embodiments, the average particle size is between 1 - 3 μm. In some embodiments, the average particle size is 3 μm. In some embodiments, the average particle size is 2 μm.

[0029] In some embodiments, by weight, the mRNA accounts for more than 2% of the dry powder formulation. In some embodiments, by weight, the mRNA accounts for more than 3% of the dry powder formulation. In some embodiments, by weight, the mRNA accounts for more than 4% of the dry powder formulation.

[0030] In some embodiments, the encapsulation efficiency of the lipid nanoparticles is greater than 50%. In some embodiments, the encapsulation efficiency of the lipid nanoparticles is greater than 60%. In some embodiments, the encapsulation efficiency of the lipid nanoparticles is greater than 70%. In some embodiments, the encapsulation efficiency of the lipid nanoparticles is greater than 80%. In some embodiments, the encapsulation efficiency of the lipid nanoparticles is greater than 90%.

[0031] In some embodiments, the mRNA in the dry powder formulation maintains 80% or greater integrity after spray drying. In some embodiments, the mRNA in the dry powder formulation maintains 90% or greater integrity after spray drying. In some embodiments, the mRNA in the dry powder formulation maintains 95% or greater integrity after spray drying.

[0032] In some embodiments, the dry powder formulation maintains 80% or greater mRNA integrity after storage at room temperature for 6 months or longer. In some embodiments, the dry powder formulation maintains 90% or greater mRNA integrity after storage at room temperature for 6 months or longer. In some embodiments, the dry powder formulation maintains 80% or greater mRNA integrity after storage at 4 °C for 6 months or longer. In some embodiments, the dry powder formulation maintains 90% or greater mRNA integrity after storage at 4 °C for 6 months or longer. In some embodiments, the dry powder formulation maintains 80% or greater mRNA integrity after storage at 25 °C for 4 weeks or longer. In some embodiments, the dry powder formulation maintains 90% or greater mRNA integrity after storage at 25 °C for 4 weeks or longer. In some embodiments, the dry powder formulation maintains 95% or greater mRNA integrity after storage at 25 °C for 4 weeks or longer.

[0033] In some embodiments, the dry powder formulation has a water content of less than 0.5%. In some embodiments, the dry powder formulation has a water content of less than 0.4%. In some embodiments, the dry powder formulation has a water content of less than 0.3%. In some embodiments, the dry powder formulation has a water content of less than 0.2%. In some embodiments, the dry powder formulation has a water content of less than 0.1%.

[0034] In some embodiments, the dry powder formulation comprises mRNA encoding a therapeutic protein. In some embodiments, the mRNA encodes an antigen. In some embodiments, the mRNA encodes a vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 is a graphical representation of the spray drying process in a typical spray drying chamber.

[0036] Figures 2A - 2D is a bar graph showing: mRNA weight percentage ( Figure 2A ); mRNA powder yield ( Figure 2B ); encapsulation efficiency of mRNA after spray drying ( Figure 2C ) and powder size ( Figure 2D ), using Lipid 1 at different leucine and / or mannitol concentrations.

[0037] Figures 3A - 3Dis a bar graph showing the following: mRNA weight percentage ( Figure 3A ); mRNA powder yield ( Figure 3B ); encapsulation efficiency after mRNA spray drying ( Figure 3C ) and powder size ( Figure 3D ), using Lipid 3 at different leucine and / or mannitol concentrations.

[0038] Figures 4A - 4D Shows the effect of lipid amount on the dry powder product characteristics: yield in the collection vessel ( Figure 4A ), average particle size of the dry powder product ( Figure 4B ), mRNA encapsulation ( Figure 4C ), and mRNA weight percentage in the dry powder product ( Figure 4D ).

[0039] Figures 5A - 5G Shows SEM images of some representative dry powder products manufactured using Lipid 1 - dry powder products manufactured using only mannitol at N / P 4 with a conventional LNP composition ( Figure 5A ), dry powder products manufactured using only leucine at N / P 4 with a conventional LNP composition ( Figure 5B ), dry powder products manufactured using only leucine at N / P 3 with a conventional LNP composition ( Figure 5C ), dry powder products manufactured using only leucine at N / P 4 with a modified LNP composition ( Figure 5D ), dry powder products manufactured using a mannitol / leucine combination at N / P 4 with a conventional LNP composition ( Figure 5E ), dry powder products manufactured using a mannitol / leucine combination at N / P 4 with a conventional LNP composition and exposed to a longer duration ( Figure 5F ), cross - section of a DPP containing mannitol / leucine at N / P 4 with a conventional LNP composition ( Figure 5G ).

[0040] Figures 6A - 6D Shows the in vitro transfection characteristics of the dry powder products. Figure 6A Shows the normalized relative light units of HEK293 cells transfected with mRNA encapsulated in Lipids 1, 2, and 3 in the presence of leucine, mannitol, or both, at different N / P ratios. Figure 6B Shows the normalized relative light units of in vitro FFL expression in HEK - 293 cells derived from various dry powder product samples from independent experiments. Figure 6C Shows the dose - dependent potency of the number of cells expressing mCherry, and Figure 6D shows the amount of mCherry expressed by the cells.

[0041] Figures 7A - 7B is a chromatogram evaluating the integrity of mRNA extracted from dry powder ( Figure 7A ) and an mRNA standard ( Figure 7B ).

[0042] Figures 8A - 8C Shows the transfection of the dry powder product into the respiratory system of mice after 24 hours. Figure 8A Shows the luminescence after IVIS imaging of the trachea and lungs, showing FFL bioluminescence. Figure 8B Shows a graph of the average radiance of FFL bioluminescence measured from the trachea and lungs. Figure 8C Shows the TNF-α level.

[0043] Figure 9 Shows the change in mRNA integrity of the dry powder formulation under accelerated thermal stability at 25 °C compared to the liquid formulation. Definitions

[0044] For easier understanding of this disclosure, certain terms are first defined below. Additional definitions of the following terms and other terms are set forth throughout the specification. Publications and other reference materials cited herein to describe the background of this disclosure and to provide more details regarding its practice are incorporated herein by reference.

[0045] About or approximately: As used herein, the terms “about” or “approximately” when applied to one or more target values refer to a value similar to the stated reference value. In certain embodiments, the terms “about” or “approximately” refer to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater than or less than) the stated reference value, unless otherwise specified or otherwise apparent from the context (except in cases where such numbers would exceed 100% of the possible value).

[0046] Delivery: As used herein, the term “delivery” encompasses local delivery and systemic delivery. For example, delivery of mRNA encompasses the situation where mRNA is delivered to a target tissue and the encoded protein is expressed and retained within that target tissue (also referred to as “local distribution” or “local delivery”), as well as the situation where mRNA is delivered to a target tissue and the encoded protein is expressed and secreted into the patient's circulatory system (e.g., serum) and distributed systemically and taken up by other tissues (also referred to as “systemic distribution” or “systemic delivery”). In some embodiments, the delivery is pulmonary delivery, for example, including nebulization.

[0047] Examples: As used herein, the terms “in some embodiments,” “in certain embodiments,” “in other embodiments,” “in some other embodiments,” etc. refer to embodiments of all aspects of the present disclosure, unless the context clearly indicates otherwise.

[0048] Encapsulation: As used herein, the term “encapsulation” or its grammatical equivalents refers to the process of confining a nucleic acid molecule within a nanoparticle.

[0049] Expression: As used herein, “expression” of a nucleic acid sequence refers to the translation of mRNA into polypeptides, the assembly of multiple polypeptides (e.g., the heavy or light chains of an antibody) into a complete protein (e.g., an antibody), and / or the post-translational modification of the polypeptide or fully assembled protein (e.g., an antibody). In the present disclosure, the terms “expression” and “production” and their grammatical equivalents are used interchangeably.

[0050] Functional: As used herein, a “functional” biomolecule is a biomolecule in a form in which it exhibits the properties and / or activities that characterize it.

[0051] Half-life: As used herein, the term “half-life” is the time required for the concentration or activity equivalent of a nucleic acid or protein to decline to half of the value measured at the start of a period of time.

[0052] Improve, increase, or decrease: As used herein, the terms “improve,” “increase,” or “decrease” or their grammatical equivalents indicate a value relative to a baseline measurement value, which is, for example, a measurement value in the same individual before initiation of the treatment described herein, or a measurement value in a control subject (or control subjects) in the absence of the treatment described herein. A “control subject” is a subject suffering from the same form of disease as the subject being treated, and is approximately the same age as the subject being treated.

[0053] In vitro: As used herein, the term “in vitro” refers to events that occur in an artificial environment (e.g., in a test tube or reaction vessel, in cell culture, etc.) rather than within a multicellular organism.

[0054] In vivo: As used herein, the term “in vivo” refers to events that occur within a multicellular organism such as a human and non-human animals. In the context of a cell-based system, the term can be used to refer to events that occur within a living cell (as opposed to, for example, an in vitro system).

[0055] Isolated: As used herein, the term "isolated" means (1) a substance and / or entity that has been separated from at least some of the components with which it was associated during its initial production (whether in nature and / or in an experimental setting) and / or (2) by human hand production, preparation, and / or manufacture. The isolated substance and / or entity can be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more than about 99% of the other components with which it was initially associated. In some embodiments, the isolated agent is about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more than about 99% pure. As used herein, a substance is "pure" if it is substantially free of other components. As used herein, the calculation of the percentage purity of an isolated substance and / or entity should not include excipients (e.g., buffers, solvents, water, etc.).

[0056] Aerodynamic mass median diameter: As used herein, the term "aerodynamic mass median diameter" or "MMAD" or "aerodynamic diameter" refers to half of the total aerosol mass. In some embodiments, the MMAD of the particles is between about 1 μm and about 5 μm or any sub-range therebetween. In some embodiments, the MMAD of the particles is about 2 μm. In some embodiments, the MMAD of the particles is about 3 μm. In some embodiments, the MMAD of the particles is about 4 μm. In some embodiments, the MMAD of the particles is about 5 μm. Experimentally, the aerodynamic diameter can be determined using the gravity sedimentation method, so the aerodynamic diameter of the particles can be directly derived using the time it takes for a group of particles to settle a certain distance. An indirect method for measuring the aerodynamic mass median diameter (MMA) is the multistage liquid impinger (MSLI). The aerodynamic diameter d aer can be calculated by the following equation: where d g is the geometric diameter, such as MMGD, and ρtap is the tapped bulk density. Particles with a tapped density of less than about 0.4 g / cm3, a median diameter of at least about 1 μm (e.g., at least about 5 μm) and an aerodynamic diameter between about 2 μm and about 4 μm (preferably less than about 5 μm) are more capable of escaping inertial and gravitational deposition in the oropharyngeal region and targeting the airways, particularly the deep lung.

[0057] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" refers to a polynucleotide encoding at least one polypeptide. As used herein, mRNA encompasses both modified RNA and unmodified RNA. The mRNA may contain one or more coding regions and non-coding regions. The mRNA can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. In appropriate cases, for example, in the case of chemically synthesized molecules, the mRNA may contain nucleoside analogs such as analogs having chemically modified bases or sugars, backbone modifications, etc. Unless otherwise indicated, the mRNA sequence is presented in the 5' to 3' direction.

[0058] N / P ratio: As used herein, the term "N / P ratio" refers to the molar ratio of the positively charged molecular units in the cationic lipid in the lipid nanoparticle relative to the negatively charged molecular units in the mRNA encapsulated within the lipid nanoparticle. As such, the N / P ratio is typically calculated as the ratio of the moles of amine groups in the cationic lipid in the lipid nanoparticle relative to the moles of phosphate groups in the mRNA encapsulated within the lipid nanoparticle.

[0059] Nucleic acid: As used herein, the term "nucleic acid" in its broadest sense refers to any compound and / or substance that is incorporated into or can be incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is incorporated into or can be incorporated into a polynucleotide chain via a phosphodiester bond. In some embodiments, "nucleic acid" refers to a single nucleic acid residue (e.g., nucleotide and / or nucleoside). In some embodiments, "nucleic acid" refers to a polynucleotide chain comprising a single nucleic acid residue. In some embodiments, "nucleic acid" encompasses RNA as well as single-stranded and / or double-stranded DNA and / or cDNA. Further, the terms "nucleic acid", "DNA", "RNA" and / or similar terms include nucleic acid analogs, i.e., analogs that do not have a phosphodiester backbone. For example, so-called "peptide nucleic acids" that are known in the art and have a peptide bond rather than a phosphodiester bond in the backbone are considered to be within the scope of this disclosure. The term "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and / or encode the same amino acid sequence. Nucleotide sequences encoding proteins and / or RNAs may include introns. Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. In appropriate cases, e.g., in the case of chemically synthesized molecules, nucleic acids may contain nucleoside analogs such as analogs having chemically modified bases or sugars, backbone modifications, etc. Unless otherwise indicated, nucleic acid sequences are presented in the 5' to 3' direction. In some embodiments, a nucleic acid is or contains natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanosine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); inserted bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioates and 5'-N-phosphoramidite linkages). In some embodiments, this disclosure particularly relates to "unmodified nucleic acids", meaning nucleic acids (e.g., polynucleotides and residues, including nucleotides and / or nucleosides) that have not been chemically modified to facilitate or enable delivery. In some embodiments, nucleotides T and U may be used interchangeably in sequence descriptions.

[0060] Patient: As used herein, the term "patient" or "subject" refers to any living organism to which a composition provided herein can be administered, for example, for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In certain embodiments, the patient is a human. Humans include pre- and post-natal forms.

[0061] Pharmaceutically acceptable: As used herein, the term "pharmaceutically acceptable" refers to a substance that, within the scope of sound medical judgment, is suitable for contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response, or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[0062] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., mice, rats, rabbits, dogs, cats, cows, pigs, sheep, horses, or primates). Humans include pre- and post-natal forms. In some embodiments, the subject is a human. A subject can be a patient, which refers to a person who visits a healthcare provider for the diagnosis or treatment of a disease. The term "subject" is used interchangeably herein with "individual" or "patient". A subject can have or be susceptible to a disease or disorder, but may or may not exhibit symptoms of the disease or disorder.

[0063] Substantially: As used herein, the term "substantially" refers to a qualitative condition that exhibits all or nearly all of the range or degree of a desired characteristic or property. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, achieve and / or proceed to completion or are realized or avoided with absolute results. Thus, the term "substantially" is used herein to capture the potential lack of completion inherent in many biological and chemical phenomena.

[0064] Treat: As used herein, the term "treat" (including "treat", "treatment", or "treating") refers to any method used to partially or completely alleviate, relieve, reduce, inhibit, prevent one or more symptoms or characteristics of a particular disease, disorder, and / or condition, delay its onset, reduce its severity, and / or reduce its incidence. For the purpose of reducing the risk of developing a pathology associated with a disease, a treatment can be administered to a subject who does not exhibit signs of the disease and / or exhibits only early signs of the disease. Detailed Description

[0065] Among other things, the present disclosure provides dry powder (e.g., spray dried) formulations of mRNA encapsulated in lipid-based nanoparticles. The dry powder formulations described herein can include an amount of hydrophobic amino acids (e.g., mannitol and / or leucine) and can be used to improve mRNA delivery and mRNA therapies. For example, the dry powder formulations described herein can have useful powder sizes, mRNA encapsulation efficiencies, and powder yields. The present disclosure can also provide methods of using the formulations described herein, as well as kits comprising the formulations described herein.

[0066] Various exemplary aspects and embodiments of the present disclosure are described in detail in the following sections. The use of multiple sections is not intended to limit the present disclosure. Each section can be applicable to any aspect of the present disclosure. In this application, unless otherwise specified, the use of "or" means "and / or".

[0067] In some aspects, the present disclosure features dry powder formulations comprising messenger RNA encapsulated in lipid nanoparticles (LNPs), wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. In some embodiments, the formulation comprises a hydrophobic amino acid (e.g., leucine) at a concentration of 4% w / w - 65% w / w. In some embodiments, the formulation comprises a hydrophobic amino acid (e.g., leucine) and a sugar (e.g., sugar alcohol such as mannitol) in a weight ratio between 1:1 and 1:10. In some embodiments, the dry powder formulation has an average particle size between 1 - 8 μm.

[0068] In another aspect, the present disclosure features a method of preparing a dry powder formulation as described herein. In some embodiments, the method includes providing a mixture comprising lipid nanoparticles encapsulating mRNA, adding a hydrophobic amino acid (e.g., leucine) at a concentration between 4% w / w and 65% w / w to the mixture, and spray drying the mixture. In some embodiments, a dry powder formulation having an average particle size between 1 - 8 μm is obtained. In some embodiments, the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. Dry powder formulations comprising amino acids and / or sugars.

[0069] The present disclosure provides stable dry powder formulations containing mRNA-loaded lipid nanoparticles (mRNA-LNPs) for therapeutic use. In some embodiments, the dry powder contains excipients to increase yield, optimize powder size, and / or optimize the N / P ratio. In some embodiments, the dry powder formulations described herein contain certain compounds, such as amino acids, for example, tryptophan, lysine, methionine, trileucine, proleucine, phenylalanine, threonine, valine, leucine, isoleucine, arginine, tyrosine, glycine, serine, glutamic acid, aspartic acid, taurine, cysteine, histidine, proline, alanine, and creatinine. In some embodiments, the dry powder formulations described herein contain certain compounds, such as amino acids (e.g., hydrophobic amino acids, such as leucine, trileucine, proleucine) and / or sugars (e.g., sugar alcohols, such as mannitol), which can be used to increase the yield of the mRNA lipid nanoparticle product formulation, reduce its powder size, and / or improve its N:P ratio. In certain embodiments, the dry powder formulation contains a combination of amino acids (e.g., leucine, trileucine, proleucine) and sugars (e.g., mannitol).

[0070] In some embodiments, the lipid nanoparticles described herein contain one or more of a cationic lipid, a PEGylated lipid, a non-cationic lipid, and a cholesterol-based lipid. Exemplary non-limiting lipids are described herein.

[0071] In some embodiments, the dry powder formulation contains lipid nanoparticles (LNPs) that contain leucine and mannitol in a specific weight ratio of 0.1 to 3.0.

[0072] In some embodiments, the dry powder formulations described herein contain one or more hydrophobic amino acids.

[0073] In some embodiments, the dry powder formulations described herein contain at least one sugar.

[0074] In some embodiments, the sugar is selected from the group consisting of monosaccharides, disaccharides, polysaccharides, sugar alcohols, glucose, fructose, galactose, mannose, sorbose, lactose, sucrose, cellobiose, trehalose, raffinose, starch, dextran, maltodextrin, cyclodextrin, inulin, xylitol, sorbitol, lactitol, and mannitol, and combinations thereof. In some embodiments, the sugar is mannitol. In some embodiments, the sugar is trehalose. In some embodiments, the sugar is sorbitol.

[0075] In some embodiments, the sugar accounts for less than 30%, 25%, 20%, 15%, 10%, or 5% of the total weight, including any value and sub-range therebetween.

[0076] In some embodiments, the hydrophobic amino acids are selected from the group consisting of: leucine, trileucine, proleucine, isoleucine, valine, phenylalanine, methionine, proline, and tryptophan, and combinations thereof. In some embodiments, the hydrophobic amino acid is leucine. In some embodiments, the hydrophobic amino acid is isoleucine, trileucine, or proleucine. In some embodiments, the hydrophobic amino acid is valine. In some embodiments, the hydrophobic amino acid is phenylalanine. In some embodiments, the hydrophobic amino acid is methionine. In some embodiments, the hydrophobic amino acid is proline.

[0077] In some embodiments, the dry powder formulation described herein comprises (1) one or more hydrophobic amino acids and (2) at least one sugar.

[0078] In some embodiments, the dry powder formulation comprises an amino acid (being leucine) and a sugar (being mannitol).

[0079] In some embodiments, the dry powder formulation comprises an amino acid (such as leucine) and a sugar (such as mannitol) in a weight ratio ranging from 1:1 to 1:10. In some embodiments, the dry powder formulation comprises an amino acid (such as leucine) and a sugar (such as mannitol) in a weight ratio ranging from 1:1 to 1:20. In some embodiments, the dry powder formulation comprises an amino acid (such as leucine) and a sugar (such as mannitol) in a weight ratio ranging from 1:3 to 1:9. In some embodiments, the dry powder formulation comprises an amino acid (such as leucine) and a sugar (such as mannitol) in a weight ratio ranging from 10:1 to 1:1. In some embodiments, the dry powder formulation comprises an amino acid (such as leucine) and a sugar (such as mannitol) in a weight ratio ranging from 20:1 to 1:1.

[0080] In some embodiments, the dry powder formulation comprises an amino acid (such as leucine) and a sugar (such as mannitol) in a weight ratio ranging from 1:3 to 1:9. In some embodiments, the dry powder formulation comprises an amino acid (such as leucine) and a sugar (such as mannitol) in a weight ratio ranging from 1:4 to 1:8.

[0081] For example, in some embodiments, the weight ratio of the amino acid and the sugar (e.g., leucine and mannitol) is 1:4. In some embodiments, the weight ratio of the amino acid and the sugar (e.g., leucine and mannitol) is 1:8.

[0082] In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:1. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:0.5. In some embodiments, the dry powder formulation comprises leucine and mannitol in a weight ratio of about 1:2. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:3. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:4. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:5. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:6. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:7. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:8. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:9. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:10. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio greater than 1:10. In some embodiments, the amino acid is leucine and the sugar is mannitol. N / P ratio of lipid nanoparticles

[0083] In some embodiments, preparing LNPs requires encapsulating mRNA and adding lipids to an aqueous buffer containing mRNA at a certain nitrogen (lipid) to phosphate (nucleic acid) ratio (N / P ratio).

[0084] In some embodiments, mRNA and lipids are combined with a pump system, which maintains a constant lipid / mRNA (N / P) ratio throughout the process and also enables easy scale-up.

[0085] In some embodiments, the lipid:mRNA (N / P) ratio of the one or more LNPs encapsulating mRNA (also referred to as mRNA-loaded LNPs) ranges from 1 to 20, 1 to 15, 1 to 10, 2 to 8, 2 to 6, or 2 to 4. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 1 to 20. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 1 to 18. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 1 to 16. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 1 to 14. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 1 to 12. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 1 to 10. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 1 to 8. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 1 to 6. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 2 to 20. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 2 to 16. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 2 to 12. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 2 to 8. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 2 to 6. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 2 to 4. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 4 to 20. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 4 to 16. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 4 to 14. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 4 to 12.In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded lipid nanoparticles ranges from 4 to 10. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded LNPs is 2 or 4. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded LNPs is 2. In some embodiments, the lipid:mRNA (N / P) ratio of the one or more mRNA-loaded LNPs is 4.

[0086] In some embodiments, the lipid nanoparticles encapsulating mRNA have an N / P ratio between 2 and 6. In some embodiments, the N / P ratio is between 3 and 4. In some embodiments, the N / P ratio is 3.

[0087] In some embodiments, the dry powder formulation comprises lipid nanoparticles that are added to the mRNA at an N:P ratio of about 1. In some embodiments, the dry powder formulation comprises lipid nanoparticles that are added to the mRNA at an N:P ratio of about 2. In some embodiments, the dry powder formulation comprises lipid nanoparticles that are added to the mRNA at an N:P ratio of about 3. In some embodiments, the dry powder formulation comprises lipid nanoparticles that are added to the mRNA at an N:P ratio of about 4. In some embodiments, the dry powder formulation comprises lipid nanoparticles that are added to the mRNA at an N:P ratio of about 5. In some embodiments, the dry powder formulation comprises lipid nanoparticles that are added to the mRNA at an N:P ratio of about 6. In some embodiments, the dry powder formulation comprises lipid nanoparticles that are added to the mRNA at an N:P ratio of about 7. In some embodiments, the dry powder formulation comprises lipid nanoparticles that are added to the mRNA at an N:P ratio of about 8. Aerodynamic mass median diameter of the dry powder particles

[0088] In some embodiments, the aerodynamic mass median diameter is defined as the particle diameter such that half of the aerosol mass is composed of particles smaller than this diameter and half is composed of particles larger than this diameter. Inhalable dry particles or dry powder can be delivered to the desired region within the respiratory tract as needed. Particles known to have an aerodynamic diameter of about 1 micron to about 3 microns can be delivered to the deep lung. Larger aerodynamic diameters (e.g., from about 3 microns to about 5 microns) can be delivered to the central and upper airways. If the MMAD of a single particle is too large (e.g., above 5 um), the percentage of powder deposited in the mouth will increase.

[0089] In some embodiments, dry powder product particles in the range of 1 μm to 3 μm exhibit the highest deposition in the central and peripheral airways, leading to sedimentation and subsequent absorption, while particles below 1 μm and above 5 μm are exhaled and swallowed, respectively. In some embodiments, characteristics of the particles such as bulk density and tapped density, water content, water absorption rate, flowability, and surface area also play a role in the flow of the dry powder product in the airways. Encapsulation efficiency

[0090] In some embodiments, the encapsulation efficiency of the one or more mRNA-loaded lipid nanoparticles is 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 98% or greater, including any value and subrange therebetween. In some embodiments, the encapsulation efficiency of the one or more mRNA-loaded lipid nanoparticles is 70% or greater. In some embodiments, the encapsulation efficiency of the one or more mRNA-loaded lipid nanoparticles is 75% or greater. In some embodiments, the encapsulation efficiency of the one or more mRNA-loaded lipid nanoparticles is 80% or greater. In some embodiments, the encapsulation efficiency of the one or more mRNA-loaded lipid nanoparticles is 85% or greater. In some embodiments, the encapsulation efficiency of the one or more mRNA-loaded lipid nanoparticles is 90% or greater. In some embodiments, the encapsulation efficiency of the one or more mRNA-loaded lipid nanoparticles is 92% or greater. In some embodiments, the encapsulation efficiency of the one or more mRNA-loaded lipid nanoparticles is 94% or greater. In some embodiments, the encapsulation efficiency of the one or more mRNA-loaded lipid nanoparticles is 95% or greater. In some embodiments, the encapsulation efficiency of the one or more mRNA-loaded lipid nanoparticles is 96% or greater. In some embodiments, the encapsulation efficiency of the one or more mRNA-loaded lipid nanoparticles is 98% or greater. LNP size and size adjustment before spray drying

[0091] Suitable mRNA-loaded lipid nanoparticles can be made in a variety of sizes. In some embodiments, the size of the mRNA-loaded lipid nanoparticles before spray drying is determined by the length of the maximum diameter of the lipid nanoparticles.

[0092] In some embodiments, the size of the mRNA-loaded lipid nanoparticles prior to spray drying is no greater than about 250 nm (e.g., no greater than about 250 nm, about 225 nm, about 200 nm, about 175 nm, about 150 nm, about 125 nm, about 100 nm, about 90 nm, about 80 nm, about 75 nm, about 70 nm, about 60 nm, about 50 nm, about 40 nm, about 30 nm, about 25 nm, about 20 nm, or about 10 nm, including any values and subranges therebetween). In some embodiments, the size of suitable liposomes ranges from about 10 nm to about 250 nm (e.g., ranges from about 10 nm to about 225 nm, about 10 nm to about 200 nm, about 10 nm to about 175 nm, about 10 nm to about 150 nm, about 10 nm to about 125 nm, about 10 nm to about 100 nm, about 10 nm to about 75 nm, or about 10 nm to about 50 nm). In some embodiments, the size of the mRNA-loaded lipid nanoparticles prior to spray drying ranges from about 100 nm to about 250 nm (e.g., ranges from about 100 nm to about 225 nm, about 100 nm to about 200 nm, about 100 nm to about 175 nm, about 100 nm to about 150 nm). In some embodiments, the size of the mRNA-loaded lipid nanoparticles prior to spray drying ranges from about 10 nm to about 100 nm (e.g., ranges from about 10 nm to about 90 nm, about 10 nm to about 80 nm, about 10 nm to about 70 nm, about 10 nm to about 60 nm, or about 10 nm to about 50 nm). In a particular embodiment, the size of the mRNA-loaded lipid nanoparticles prior to spray drying is less than about 100 nm.

[0093] A variety of alternative methods known in the art can be used to adjust the size of a liposome population. One such size-adjusting method is described in U.S. Patent No. 4,737,323, which is incorporated herein by reference. Sonication of a liposome suspension by bath or probe sonication results in a progressive decrease in size to small ULVs with diameters less than about 0.05 microns. Homogenization is another method that relies on shear energy to break large liposomes into smaller liposomes. In a typical homogenization procedure, MLVs are recycled through a standard emulsion homogenizer until the selected liposome size is observed, typically between about 0.1 micron and 0.5 microns. The size of liposomes can be determined by quasi-electric light scattering (QELS), as described in Bloomfield, Ann. Rev. Biophys. Bioeng. [Bioengineering], 10:421-150 (1981), which is incorporated herein by reference. The average liposome diameter can be reduced by sonicating the formed liposomes. Intermittent sonication cycles can be alternated with QELS assessment to guide efficient liposome synthesis. Spray drying process

[0094] Spray drying is a common, economical, and established technique for manufacturing dry powder products in various modalities, such as small molecules, peptides, and proteins. The technique is continuous, scalable, suitable for heat-sensitive materials, can produce consistent dry powder products, and can be automated. Various sugars (such as lactose and mannitol) are commonly used as carrier excipients to facilitate the spray drying process. For example, in the compositions and methods described herein, the beneficial properties of mannitol as an excipient for spray drying of mRNA formulations include (i) altering the effect on viscoelastic properties associated with sputum, (ii) increasing the water content driven by the osmotic gradient, (iii) having lower hygroscopicity compared to some other sugars (like lactose), (iv) the absence of aldehyde groups in non-reducing sugars, etc. However, amino acids such as leucine, isoleucine, and trileucine have been used to increase the dispersibility of dry powder products and reduce MMAD. Although spray drying is continuous, scalable, suitable for heat-sensitive materials, and can produce consistent DPP, there are very few reports on the excipient screening of spray-dried mRNA LNPs and the optimization of formulation properties and aerosol performance.

[0095] Various spray drying processes can be used to practice the present disclosure.

[0096] The process generally involves removing moisture from the composition by passing the composition in liquid form through a device; Figure 1 A simplified schematic depiction is provided. Briefly, a liquid formulation containing the composition of interest is passed through a narrow inlet spray "atomizer" nozzle into a first chamber, which is the drying chamber. Typically, the liquid formulation passes through in a steady stream. The liquid formulation is sprayed into the drying chamber as tiny droplets. A heated air or gas stream is also directed into the drying chamber to form an air stream. The formulation is dispersed by this heat stream to dry the incoming droplets into solid particulate form. This product is then directed into a second chamber via a flowing-through joint or pipe. The second chamber is a cyclone powder collector. Here, an air circulation generates a cyclone, and the powder particles are collected via the eddy current into a collection container attached to the outlet end. The cyclone chamber is attached to an exhaust fan that helps cool the components. The inlet and outlet temperatures can be adjusted by the operator. The corresponding inlet temperature, outlet temperature, chamber temperature, liquid feed flow rate (suction percentage), pressure, the nature of the heated air stream, and most importantly, the composition of the liquid feed are appropriately adjusted to optimize the drying of any particulate matter.

[0097] In some embodiments, the inlet temperature can be adjusted within the range of 40°C to 200°C. In some embodiments, the outlet temperature ranges between 20°C and 70°C. The relative pressure of the pump and the aspirator can also be adjusted by the operator. In some embodiments, the inlet temperature is adjusted to 55°C. In some embodiments, the inlet temperature is adjusted to 60°C. In some embodiments, the internal temperature is adjusted to 61°C. In some embodiments, the internal temperature is adjusted to 62°C. In some embodiments, the internal temperature is adjusted to 63°C. In some embodiments, the internal temperature is adjusted to 64°C. In some embodiments, the internal temperature is adjusted to 65°C. In some embodiments, the internal temperature is adjusted to 70°C. In some embodiments, for spray drying mRNA-lipid nanoparticles, the inlet temperature is adjusted between 70°C and 200°C. In some embodiments, the inlet temperature is adjusted between 80°C and 200°C. In some embodiments, the inlet temperature is adjusted between 90°C and 200°C. In some embodiments, the inlet temperature is adjusted between 95°C and 180°C. In some embodiments, the inlet temperature is adjusted between 95°C and 160°C. In some embodiments, the inlet temperature is adjusted between 90°C and 150°C. In some embodiments, the inlet temperature is adjusted between 90°C and 120°C. In some embodiments, the inlet temperature is adjusted between 90°C and 100°C. In some embodiments, the inlet temperature is 70°C, 75°C, 80°C, 85°C, 90°C, 95°C, or 100°C, including any value and sub-range therebetween.

[0098] In some embodiments, the outlet temperature ranges between 20°C and 70°C. In some embodiments, the outlet temperature is between 30°C and 60°C. In some embodiments, the outlet temperature is between 20°C and 50°C. In some embodiments, the outlet temperature is between 30°C and 50°C. In some embodiments, the outlet temperature is between 40°C and 50°C. In some embodiments, the outlet temperature is between 45°C and 50°C.

[0099] Spray drying can be carried out using any suitable spray drying apparatus. As is known to those of ordinary skill in the art, a variety of spray drying instruments are commercially available and can be used to practice this disclosure. Exemplary commercially available devices suitable for this disclosure include, but are not limited to, the following: Mini Spray Dryer B-290; Nano Spray Dryer B-90 (manufactured by Buchi); Anhydro MicraSpray Dryer GMP; Anhydro MicraSpray Dryer Sterile Series (manufactured by SPX FLOW); MDL-50 and MDL-015 (manufactured by Fujisaki Electric); General Purpose Mini Spray Dryer GAS410 (manufactured by Yamato Scientific America); LSD-1500 Mini Spray Dryer, MSD-8 Multi-Function Laboratory Spray Dryer; PSD-12 Precision Pharmaceutical Spray Dryer; (manufactured by Changzhou Xiandao Drying Equipment Co., Ltd); TALLFORM DRYER TM ; Multi-Stage Dryer; COMPACT DRYER TM ; FILTERMAT TM Spray Dryer; VERSATILE-SD TM ; Fluidized Bed Spray Dryer; MOBILE MINOR TM ; SDMICRO TM ; PRODUCTION MINOR TM (manufactured by GEA Process Engineering) and many other devices. Several of these manufacturers also offer convenient scale-up from laboratory scale to industrial production scale. Dry powder

[0100] The dry powder prepared according to this disclosure contains a plurality of spray-dried particles. Residual water content, aerosol properties, and physicochemical stability are important parameters of spray-dried pharmaceutical products. It is determined from the weight loss of the sample after heating and drying using the following equation: where SW b is the weight of the sample before heating, and SW a is the weight of the sample after heating. Perkin Elmer TGA 7 (Perkin Elmer) is an example of a commercially used instrument that has relevant software for measuring residual moisture in nanoparticles.

[0101] Typically, for the uniform administration of the active pharmaceutical ingredient of a formulation, an acceptable range of particle size distribution is maintained. For example, therapeutic treatments for liver and lung diseases are developed by delivering synthetic mRNA encoding a missing and / or non-functional protein to the corresponding organ cells via intravenous and inhalable routes, respectively. In particular, for pulmonary delivery, the particles of the dry powder formulation affect the distribution and deposition of the aerosol within the respiratory system. In many cases, for the effective absorption and distribution of the therapeutic component, particle deposition in the large conducting airways is preferred. For the active pharmaceutical ingredient acting as a bronchodilator, an aerosol of very fine particles (e.g., particles with a diameter less than 1 micron) can be peripherally deposited to be effectively absorbed by specific cells of the lung such as smooth muscle.

[0102] In some embodiments, the average particle size of the dry powder formulation is between 0.5 - 10 μm. In some embodiments, the average particle size of the dry powder formulation is between 1 - 8 μm. In some embodiments, the average particle size of the dry powder formulation is between 1 - 7 μm. In some embodiments, the average particle size of the dry powder formulation is between 1 - 6 μm. In some embodiments, the average particle size of the dry powder formulation is between 1 - 5 μm. In some embodiments, the average particle size of the dry powder formulation is between 1 - 4 μm. In some embodiments, the average particle size of the dry powder formulation is between 1 - 3 μm. In some embodiments, the average particle size of the dry powder formulation is between 1 - 2 μm. In some embodiments, the average particle size of the dry powder formulation is 2 μm. In some embodiments, the average particle size of the dry powder formulation is 3 μm. In some embodiments, the average particle size of the dry powder formulation is 5 μm. In some embodiments, the average particle size of the dry powder formulation is 8 μm. In some embodiments, the average particle size of the dry powder formulation is 9 μm. In some embodiments, the average particle size of the dry powder formulation is 10 μm.

[0103] The primary particle size distribution of the spray-dried particles is measured by dynamic light scattering and expressed as the Z-average. The Z-average is the mean calculated from the intensity-weighted distribution of the particle diameters, also known as the cumulative size, and is given by: where S i is the scattering intensity of particle 'i', and D i is the diameter of the particle. In addition to these parameters, the fine and coarse fractions of the particles are also defined.

[0104] On the other hand, the polydispersity index (PDI) is a measure of the molecular weight distribution of a given particulate sample. In some embodiments, the polydispersity index of the glycerol- and propylene glycol-based LNPs is less than 0.2. In some embodiments, the polydispersity index of the glycerol- and propylene glycol-based LNPs is about 0.1. In some embodiments, the polydispersity index of the glycerol- and propylene glycol-based LNPs is less than about 0.1. mRNA

[0105] In some embodiments, by weight, the mRNA comprises greater than about 2% of the dry powder formulation. In some embodiments, by weight, the mRNA comprises greater than about 3% of the dry powder formulation. In some embodiments, by weight, the mRNA comprises greater than about 3% of the dry powder formulation. In some embodiments, by weight, the mRNA comprises greater than about 4% of the dry powder formulation.

[0106] It has been observed that the dry powder formulations of the mRNA of the present disclosure have high stability even after the LNPs are briefly exposed to heat and stress during spray drying. In some embodiments, the mRNA in the dry powder formulation maintains greater than about 80% integrity after spray drying. In some embodiments, the mRNA in the dry powder formulation maintains greater than about 85% integrity after spray drying. In some embodiments, the mRNA in the dry powder formulation maintains greater than about 90% integrity after spray drying. In some embodiments, the mRNA in the dry powder formulation maintains greater than about 95% integrity after spray drying.

[0107] It is desirable for the integrity of the mRNA to be maintained and / or maintained for an extended period of time after multiple freeze-thaw cycles to maintain the therapeutic benefit. In some embodiments, the mRNA maintains 80% or greater integrity after storage at room temperature for 6 months or longer. In some embodiments, the mRNA maintains 80% or greater integrity after storage at room temperature for 3 months or longer. In some embodiments, the mRNA maintains 80% or greater integrity after storage at room temperature for 1 year or longer. In some embodiments, the mRNA maintains 90% or greater integrity after storage at room temperature for 6 months or longer. In some embodiments, the mRNA maintains 90% or greater integrity after storage at room temperature for 3 months or longer. In some embodiments, the mRNA maintains 90% or greater integrity after storage at room temperature for 1 year or longer.

[0108] In some embodiments, the mRNA maintains 80% or greater integrity after storage at 25°C for 4 weeks or longer. In some embodiments, the mRNA maintains 80% or greater integrity after storage at 25°C for 3 months or longer. In some embodiments, the mRNA maintains 80% or greater integrity after storage at 25°C for 6 months or longer. In some embodiments, the mRNA maintains 80% or greater integrity after storage at 25°C for one year or longer. In some embodiments, the mRNA maintains 85% or greater integrity after storage at 25°C for 4 weeks or longer. In some embodiments, the mRNA maintains 85% or greater integrity after storage at 25°C for 3 months or longer. In some embodiments, the mRNA maintains 85% or greater integrity after storage at 25°C for 6 months or longer. In some embodiments, the mRNA maintains 85% or greater integrity after storage at 25°C for one year or longer. In some embodiments, the mRNA maintains 90% or greater integrity after storage at 25°C for 4 weeks or longer. In some embodiments, the mRNA maintains 90% or greater integrity after storage at 25°C for 3 months or longer. In some embodiments, the mRNA maintains 90% or greater integrity after storage at 25°C for 6 months or longer. In some embodiments, the mRNA maintains 90% or greater integrity after storage at 25°C for one year or longer. In some embodiments, the mRNA maintains 95% or greater integrity after storage at 25°C for 4 weeks or longer. In some embodiments, the mRNA maintains 95% or greater integrity after storage at 25°C for 3 months or longer. In some embodiments, the mRNA maintains 95% or greater integrity after storage at 25°C for 6 months or longer. In some embodiments, the mRNA maintains 95% or greater integrity after storage at 25°C for one year or longer.

[0109] In some embodiments, the mRNA maintains 80% or greater integrity after 3 freeze - thaw cycles following storage at - 80°C. In some embodiments, the mRNA maintains 90% or greater integrity after 3 freeze - thaw cycles following storage at - 80°C.

[0110] As used herein, the phrase "the mRNA maintains x% or greater integrity after storage" means that the decrease in mRNA integrity after storage is no more than (100 - x)%. mRNA synthesis

[0111] The mRNA according to the present disclosure can be synthesized according to any of a variety of known methods. The various methods are described in the published US application number US2018 / 0258423 and can be used to implement the present disclosure, all of which are incorporated herein by reference. For example, the mRNA according to the present disclosure can be synthesized via in vitro transcription (IVT). Briefly, IVT is typically carried out with: a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may include DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNase I, pyrophosphatase, and / or RNase inhibitor. The exact conditions will vary according to the specific application.

[0112] In some embodiments, suitable mRNA sequences are mRNA sequences encoding a protein or peptide. In some embodiments, the suitable mRNA sequences are codon-optimized for efficient expression in human cells. In some embodiments, the suitable mRNA sequences are naturally occurring or wild-type sequences. In some embodiments, the suitable mRNA sequences encode a protein or peptide that contains one or more mutations in the amino acid sequence. Exemplary mRNA coding sequences and corresponding amino acid sequences are shown below: Exemplary construct design of mRNA X–mRNA coding region–Y 5' and 3' UTR sequences X (5' UTR sequence) = GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG (SEQ ID NO:1) Y (3' UTR sequence) = CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU (SEQ ID NO:2) or GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUG CCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU (SEQ ID NO:3)

[0113] The present disclosure can be used to deliver mRNAs of various lengths. In some embodiments, the present disclosure can be used to deliver in vitro synthesized mRNAs that are of or greater than the following lengths: about 0.5 kb, 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, 20 kb, 30 kb, 40 kb, or 50 kb, including any value and sub-range therebetween. In some embodiments, the present disclosure can be used to deliver in vitro synthesized mRNAs that are in the following ranges of lengths: about 1-20 kb, about 1-15 kb, about 1-10 kb, about 5-20 kb, about 5-15 kb, about 5-12 kb, about 5-10 kb, about 8-20 kb, or about 8-50 kb.

[0114] In some embodiments, to prepare the mRNA according to the present disclosure, the DNA template is transcribed in vitro. Suitable DNA templates typically have a promoter for in vitro transcription (e.g., T3, T7, or SP6 promoter), followed by the desired nucleotide sequence for the desired mRNA and a termination signal. Nucleotide

[0115] According to the present disclosure, various naturally occurring or modified nucleosides can be used to generate the mRNA. In some embodiments, the mRNA is or comprises naturally occurring nucleosides (or unmodified nucleotides; e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, pseudouridine (e.g., N-1-methyl-pseudouridine), 2-thiouridine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); inserted bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioates and 5′-N-phosphoramidite linkages).

[0116] In some embodiments, suitable mRNAs can contain backbone modifications, sugar modifications, and / or base modifications. For example, modified nucleotides can include, but are not limited to, modified purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), as well as analogs or derivatives of modified nucleotide purines and pyrimidines, such as 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydrouracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queosine, β-D-mannosyl-queosine, wybutoxosine, and phosphoramide, thiophosphate, peptide nucleic acid, methylphosphonate, 7-deazaguanosine, 5-methylcytosine, and inosine. Those skilled in the art know the preparation of such analogs, for example, from U.S. Patent No. 4,373,071, U.S. Patent No. 4,401,796, U.S. Patent No. 4,415,732, U.S. Patent No. 4,458,066, U.S. Patent No. 4,500,707, U.S. Patent No. 4,668,777, U.S. Patent No. 4,973,679, U.S. Patent No. 5,047,524, U.S. Patent No. 5,132,418, U.S. Patent No. 5,153,319, U.S. Patent No. 5,262,530, and 5,700,642, the disclosures of which are incorporated herein by reference in their entireties.

[0117] In some embodiments, the mRNA comprises one or more non-standard nucleotide residues. Non-standard nucleotide residues can include, for example, 5-methyl-cytidine (“5mC”), pseudouridine (“yU”), and / or 2-thio-uridine (“2sU”). For discussion of such residues and their incorporation into mRNA, see, for example, U.S. Patent No. 8,278,036 or WO 2011 / 012316. The mRNA can be an RNA defined as an RNA in which 25% of the U residues are 2-thio-uridine and 25% of the C residues are 5-methylcytidine. The teachings regarding the use of RNA are disclosed in U.S. Patent Publication US2012 / 0195936 and International Publication WO 2011 / 012316, which are hereby incorporated by reference in their entireties. The presence of non-standard nucleotide residues can render the mRNA more stable and / or less immunogenic than a control mRNA having the same sequence but containing only standard residues. In additional embodiments, the mRNA can comprise one or more non-standard nucleotide residues selected from isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurine cytosine, and combinations of such modifications and other nucleobase modifications. Some embodiments can further include additional modifications to the furanose ring or the nucleobase. Additional modifications can include, for example, sugar modifications or substitutions (e.g., one or more 2'-O-alkyl modifications, locked nucleic acid (LNA)). In some embodiments, the RNA can be complexed or hybridized with additional polynucleotides and / or peptide polynucleotides (PNA). In some embodiments where the sugar modification is a 2'-O-alkyl modification, such modifications can include, but are not limited to, 2'-deoxy-2'-fluoro modification, 2'-O-methyl modification, 2'-O-methoxyethyl modification, and 2'-deoxy modification. In some embodiments, any of these modifications can be present in 0-100% of the nucleotides, either singly or in combination—e.g., more than 0%, 1%, 10%, 25%, 50%, 75%, 85%, 90%, 95%, or 100% of the constituent nucleotides.

[0118] In some embodiments, the mRNA can contain RNA backbone modifications. Typically, a backbone modification is a modification in which the phosphodiester of the nucleotide backbone contained in the RNA is chemically modified. Exemplary backbone modifications typically include, but are not limited to, modifications from the group consisting of methylphosphonate, methylphosphoramidate, phosphoramidate, thiophosphate (e.g., cytidine 5'-O-(1-thiophosphate)), boranophosphate, a positively charged guanidinium group, etc., which means replacing the phosphodiester bond with other anionic, cationic, or neutral groups.

[0119] In some embodiments, the mRNA can contain sugar modifications. Typical sugar modifications are chemical modifications of the sugar of the nucleotides it contains, including but not limited to sugar modifications selected from the group consisting of: 2'-deoxy-2'-fluoro-oligoribonucleotides (2'-fluoro-2'-deoxycytidine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate), 2'-deoxy-2'-deamino-oligoribonucleotides (2'-amino-2'-deoxycytidine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate), 2'-O-alkyl oligoribonucleotides, 2'-deoxy-2'-C-alkyl oligoribonucleotides (2'-O-methylcytidine 5'-triphosphate, 2'-methyluridine 5'-triphosphate), 2'-C-alkyl oligoribonucleotides, and their isomers (2'-aracytidine 5'-triphosphate, 2'-arouridine 5'-triphosphate), or azidotriphosphates (2'-azido-2'-deoxycytidine 5'-triphosphate, 2'-azido-2'-deoxyuridine 5'-triphosphate). Post-synthetic processing

[0120] Typically, a 5' cap and / or a 3' tail can be added after synthesis. The presence of the cap is important for providing resistance to nucleases found in most eukaryotic cells. The presence of the "tail" is used to protect the mRNA from exonucleolytic degradation.

[0121] Typically, the 5' cap is added as follows: First, an RNA terminal phosphatase removes a terminal phosphate group from the 5' nucleotide, leaving two terminal phosphates; then guanosine triphosphate (GTP) is added to the terminal phosphate via guanylyl transferase, producing a 5'5'5 triphosphate bond; then, the 7-nitrogen of guanine is methylated by a methyltransferase. Examples of cap structures include but are not limited to m7G(5')ppp(5'(A,G(5')ppp(5')A and G(5')ppp(5')G. Additional cap structures are described in published U.S. application No. US2016 / 0032356 and published U.S. application No. US 2018 / 0125989, which are incorporated herein by reference.

[0122] Typically, the tail structure includes a poly(A) and / or poly(C) tail. The polyA or polyC tail at the 3'-end of the mRNA typically includes at least 50 adenosine or cytosine nucleotides, at least 150 adenosine or cytosine nucleotides, at least 200 adenosine or cytosine nucleotides, at least 250 adenosine or cytosine nucleotides, at least 300 adenosine or cytosine nucleotides, at least 350 adenosine or cytosine nucleotides, at least 400 adenosine or cytosine nucleotides, at least 450 adenosine or cytosine nucleotides, at least 500 adenosine or cytosine nucleotides, at least 550 adenosine or cytosine nucleotides, at least 600 adenosine or cytosine nucleotides, at least 650 adenosine or cytosine nucleotides, at least 700 adenosine or cytosine nucleotides, at least 750 adenosine or cytosine nucleotides, at least 800 adenosine or cytosine nucleotides, at least 850 adenosine or cytosine nucleotides, at least 900 adenosine or cytosine nucleotides, at least 950 adenosine or cytosine nucleotides, or at least 1 kb adenosine or cytosine nucleotides, including any value and sub-range therebetween. In some embodiments, the polyA or polyC tail can be about 10 to 800 adenosine or cytosine nucleotides (e.g., about 10 to 200 adenosine or cytosine nucleotides, about 10 to 300 adenosine or cytosine nucleotides, about 10 to 400 adenosine or cytosine nucleotides, about 10 to 500 adenosine or cytosine nucleotides, about 10 to 550 adenosine or cytosine nucleotides, about 10 to 600 adenosine or cytosine nucleotides, about 50 to 600 adenosine or cytosine nucleotides, about 100 to 600 adenosine or cytosine nucleotides, about 150 to 600 adenosine or cytosine nucleotides, about 200 to 600 adenosine or cytosine nucleotides, about 250 to 600 adenosine or cytosine nucleotides, about 300 to 600 adenosine or cytosine nucleotides, about 350 to 600 adenosine or cytosine nucleotides, about 400 to 600 adenosine or cytosine nucleotides, about 450 to 600 adenosine or cytosine nucleotides, about 500 to 600 adenosine or cytosine nucleotides, about 10 to 150 adenosine or cytosine nucleotides, about 10 to 100 adenosine or cytosine nucleotides, about 20 to 70 adenosine or cytosine nucleotides, or about 20 to 60 adenosine or cytosine nucleotides). In some embodiments, the tail structure includes a combination of poly(A) and poly(C) tails having various lengths as described herein. In some embodiments, the tail structure includes at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% adenosine nucleotides, including any value and sub-range therebetween. In some embodiments, the tail structure includes at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% cytosine nucleotides, including any value and sub-range therebetween.

[0123] As described herein, adding a 5' cap and / or a 3' tail helps to detect abortive transcripts generated during in vitro synthesis because, without capping and / or tailing, the prematurely terminated mRNA transcripts may be too small to detect. Thus, in some embodiments, a 5' cap and / or a 3' tail are added to the synthesized mRNA before testing the purity of the mRNA (e.g., the level of abortive transcripts present in the mRNA). In some embodiments, a 5' cap and / or a 3' tail are added to the synthesized mRNA before purifying the mRNA as described herein. In other embodiments, a 5' cap and / or a 3' tail are added to the synthesized mRNA after purifying the mRNA as described herein.

[0124] The mRNA synthesized according to the present disclosure can be used without further purification. In particular, the mRNA synthesized according to the present disclosure can be used without a step of removing oligomers. In some embodiments, the mRNA synthesized according to the present disclosure can be further purified. The mRNA synthesized according to the present disclosure can be purified using various methods. For example, centrifugation, filtration, and / or chromatography can be used for the purification of mRNA. In some embodiments, the synthesized mRNA is purified by ethanol precipitation or filtration or chromatography, or gel purification, or any other suitable means. In some embodiments, the mRNA is purified by HPLC. In some embodiments, those skilled in the art are familiar with extracting mRNA in a standard phenol:chloroform:isoamyl alcohol solution. In some embodiments, tangential flow filtration is used to purify mRNA. Suitable purification methods include those described in the following: published U.S. application No. US2016 / 0040154, published U.S. application No. US2015 / 0376220, published U.S. application No. US 2018 / 0251755, published U.S. application No. US2018 / 0251754, U.S. Provisional Application No. 62 / 757,612 filed on November 8, 2018, and U.S. Provisional Application No. 62 / 891,781 filed on August 26, 2019, all of which are incorporated herein by reference and can be used to implement the present disclosure.

[0125] In some embodiments, the mRNA is purified before capping and tailing. In some embodiments, the mRNA is purified after capping and tailing. In some embodiments, the mRNA is purified both before and after capping and tailing.

[0126] In some embodiments, the mRNA is purified by centrifugation before and / or after capping and tailing, or both before and after. In some embodiments, the mRNA is purified by filtration before and / or after capping and tailing, or both before and after. In some embodiments, the mRNA is purified by tangential flow filtration (TFF) before and / or after capping and tailing, or both before and after. In some embodiments, the mRNA is purified by chromatography before and / or after capping and tailing, or both before and after. Additional lipids

[0127] In some embodiments, the lipid nanoparticle comprises one or more cationic lipids, one or more non-cationic lipids, and one or more PEGylated lipids. In some embodiments, the lipid nanoparticle further comprises one or more cholesterol-based lipids. In some embodiments, the one or more cationic lipids account for about 30%-70% of the total lipids in the LNP by mole %. In some embodiments, the one or more PEGylated lipids account for about 1%-15% of the total lipids in the LNP by mole %. In some embodiments, the one or more non-cationic lipids account for about 10%-40% of the total lipids in the LNP by mole %. In some embodiments, the one or more cholesterol-based lipids account for about 5%-40% of the total lipids in the LNP by mole %.

[0128] In some embodiments, the molar ratio of the one or more cationic lipids to the one or more non-cationic lipids to the one or more cholesterol-based lipids to the one or more PEGylated lipids in the lipid nanoparticle is approximately 60:25:10:5. In some embodiments, the molar ratio of the one or more cationic lipids to the one or more non-cationic lipids to the one or more cholesterol-based lipids to the one or more PEGylated lipids in the lipid nanoparticle is approximately 40:25:30:5.

[0129] Exemplary lipids are described herein. Cationic lipid

[0130] As used herein, the phrase "cationic lipid" refers to any of a variety of lipid species that have a net positive charge at a selected pH, such as physiological pH.

[0131] Suitable cationic lipids for use in the compositions and methods of the present disclosure include those described in International Patent Publication WO 2010 / 144740, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following compound structure: 4-(dimethylamino)butanoic acid (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl ester and its pharmaceutically acceptable salts.

[0132] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include ionizable cationic lipids as described in International Patent Publication WO 2013 / 149140, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having one of the following formulas: or its pharmaceutically acceptable salts, wherein R1 and R2 are each independently selected from the group consisting of hydrogen, optionally substituted, variably saturated or unsaturated C1-C 20 alkyl and optionally substituted, variably saturated or unsaturated C6-C 20 acyl; wherein L1 and L2 are each independently selected from the group consisting of hydrogen, optionally substituted C1-C 30 alkyl, optionally substituted variably unsaturated C1-C 30 alkenyl, and optionally substituted C1-C 30 alkynyl; wherein m and o are each independently selected from the group consisting of zero and any positive integer (e.g., wherein m is three); and wherein n is zero or any positive integer (e.g., wherein n is one). In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following compound structure (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine (“HGT5000”): (HGT-5000) and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following compound structure (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-1-amine (“HGT5001”): (HGT-5001) and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following compound structure and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine (“HGT5002”): (HGT-5002) and its pharmaceutically acceptable salts.

[0133] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cationic lipids described as amino alcohol lipids in International Patent Publication WO 2010 / 053572, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following compound structure: (C12-200) and its pharmaceutically acceptable salts.

[0134] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cationic lipids as described in International Patent Disclosure WO 2016 / 118725, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following compound structure: and its pharmaceutically acceptable salts.

[0135] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cationic lipids as described in International Patent Disclosure WO 2016 / 118724, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following compound structure: and its pharmaceutically acceptable salts.

[0136] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include a cationic lipid having the following formula: 14,25-bis(tridecyl)-15,18,21,24-tetraaza-octatriacontane, and its pharmaceutically acceptable salts.

[0137] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cationic lipids as described in International Patent Publications WO 2013 / 063468 and WO 2016 / 205691, which are incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following formula: or its pharmaceutically acceptable salt, wherein each instance of R L is independently optionally substituted C6-C 40Alkenyl. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: (OF-02) and their pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts.

[0138] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include the cationic lipids described in International Patent Publication WO 2015 / 184256, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following formula: or its pharmaceutically acceptable salt, wherein each X is independently O or S; each Y is independently O or S; each m is independently 0 to 20; each n is independently 1 to 6; each R A is independently hydrogen, optionally substituted C1-50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted C3-10 carbocyclic group, optionally substituted 3-14 membered heterocyclic group, optionally substituted C6-14 aryl, optionally substituted 5-14 membered heteroaryl or halogen; and each R B is independently hydrogen, optionally substituted C1-50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted C3-10 carbocyclic group, optionally substituted 3-14 membered heterocyclic group, optionally substituted C6-14 aryl, optionally substituted 5-14 membered heteroaryl or halogen. In certain embodiments, the compositions and methods of the present disclosure include the cationic lipid "Target 23" having the following compound structure: (Target 23) and their pharmaceutically acceptable salts.

[0139] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cationic lipids as described in International Patent Publication WO 2016 / 004202, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: or a pharmaceutically acceptable salt thereof.

[0140] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cationic lipids as described in U.S. Provisional Patent Application Serial No. 62 / 758,179, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following formula: or a pharmaceutically acceptable salt thereof, wherein R 1 and R 2 are each independently H or C1-C6 aliphatic; each m is independently an integer having a value of 1 to 4; each A is independently a covalent bond or arylene; each L 1 is independently an ester, thioester, disulfide, or anhydride group; each L 2 is independently C2-C 10 aliphatic; each X 1 is independently H or OH; and each R 3 is independently C6-C 20 aliphatic. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following formula: (Compound 1) or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following formula: (Compound 2) or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following formula: (Compound 3) or a pharmaceutically acceptable salt thereof.

[0141] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cationic lipids as described in J. McClellan, M. C. King, Cell 2010, 141, 210 - 217 and Whitehead et al., Nature Communications (2014) 5:4277, which are incorporated herein by reference. In certain embodiments, the cationic lipids in the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts.

[0142] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cationic lipids as described in International Patent Disclosure WO 2015 / 199952, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts.

[0143] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include the cationic lipids described in International Patent Publication WO 2017 / 004143, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structure: and their pharmaceutically acceptable salts.

[0144] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cationic lipids as described in International Patent Publication WO 2017 / 075531, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the following formula: or a pharmaceutically acceptable salt thereof, wherein L 1 or L 2 one of which is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -S-S-, -C(=O)S-, -SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a -, or -NR a C(=O)O-; and L 1 or L 2 the other of which is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -S-S-, -C(=O)S-, SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a - or -NR a C(=O)O- or a direct bond; G 1 and G 2 are each independently an unsubstituted C1-C 12 alkylene or C1-C 12 alkenylene; G 3 is C1-C 24 alkylene, C1-C 24 alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene; R a is H or C1-C 12 alkyl; R1 and R 2 are each independently a C6-C 24 alkyl or a C6-C 24 alkenyl; R 3 is H, OR 5 , CN, -C(=O)OR 4 , -OC(=O)R 4 or -NR 5 C(=O)R 4 ; R 4 is a C1-C 12 alkyl; R 5 is H or a C1-C6 alkyl; and x is 0, 1, or 2.

[0145] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cationic lipids as described in International Patent Disclosure WO 2017 / 117528, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following compound structure: and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following compound structure: and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following compound structure: and its pharmaceutically acceptable salts.

[0146] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cationic lipids as described in International Patent Disclosure WO 2017 / 049245, which is incorporated herein by reference. In some embodiments, the cationic lipid in the compositions and methods of the present disclosure includes a compound having one of the following formulas and its pharmaceutically acceptable salts. For any one of the four formulas, R4 is independently selected from -(CH2) n Q and -(CH2) n CHQR; Q is selected from the group consisting of: -OR, -OH, -O(CH2) nN(R)2, -OC(O)R, -CX3, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)2R, -N(H)S(O)2R, -N(R)C(O)N(R)2, -N(H)C(O)N(R)2, -N(H)C(O)N(H)(R), -N(R)C(S)N(R)2, -N(H)C(S)N(R)2, -N(H)C(S)N(H)(R), and heterocycles; and n is 1, 2, or 3. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and pharmaceutically acceptable salts thereof.

[0147] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cationic lipids as described in International Patent Publications WO 2017 / 173054 and WO 2015 / 095340, each of which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structures: and pharmaceutically acceptable salts thereof.

[0148] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cleavable cationic lipids as described in International Patent Publication WO 2012 / 170889, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following formula: wherein R1 is selected from the group consisting of imidazole, guanidinium, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl; wherein R2 is selected from the group consisting of one of the following two formulas: and wherein R3 and R4 are each independently selected from the group consisting of optionally substituted, variably saturated or unsaturated C6-C 20 alkyl and optionally substituted, variably saturated or unsaturated C6-C 20 acyl; and wherein n is zero or any positive integer (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty or greater). In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid "HGT4001" having the following compound structure: (HGT4001) and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid "HGT4002" having the following compound structure: (HGT4002) and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid "HGT4003" having the following compound structure: (HGT4003) and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid "HGT4004" having the following compound structure: (HGT4004) and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid "HGT4005" having the following compound structure: (HGT4005) and its pharmaceutically acceptable salts.

[0149] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include HEPES-based disulfide cationic lipids having a piperazine core as described in International Patent Publication WO 2022 / 221688, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following formula: (GL-HEPES-E3-E10-DS-3-E18-1: (4-(bis(2-hydroxydecyl)amino)butyric acid 2-(4-(2-((3-(bis((Z)-2-hydroxyoctadec-9-en-1-yl)amino)propyl)disulfanyl)ethyl)piperazin-1-yl)ethyl ester)) and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following formula: (GL-HEPES-E3-E12-DS-4-E10: (4-(bis(2-hydroxydodecyl)amino)butyric acid 2-(4-(2-((3-(bis(2-hydroxydecyl)amino)butyl)disulfanyl)ethyl)piperazin-1-yl)ethyl ester)) and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following formula: (GL-HEPES-E3-E12-DS-3-E14: (4-(bis(2-hydroxydodecyl)amino)butyric acid 2-(4-(2-((3-(bis(2-hydroxytetradecyl)amino)propyl)disulfanyl)ethyl)piperazin-1-yl)ethyl ester)) and its pharmaceutically acceptable salts.

[0150] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include the cationic lipids described in Dong et al., PNAS, 2014, 111(11):3955 - 3960 and U.S. Patent No. 9,512,073, which are incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following formula: (cKK-E10) and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the following formula: (cKK-E12) and its pharmaceutically acceptable salts.

[0152] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cleavable cationic lipids as described in U.S. Provisional Application No. 62 / 672,194, filed May 16, 2018, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid that is any one of the general formulas or any one of the structures (1a)-(21a) and (1b)-(21b) and (22)-(237) described in U.S. Provisional Application No. 62 / 672,194. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid having a structure according to formula (I’), wherein, R X is independently -H, -L 1 -R 1 , or -L 5A -L 5B -B’; L 1 , L 2 and L 3 each independently is a covalent bond, -C(O)-, -C(O)O-, -C(O)S-, or -C(O)NR L -; L 4A and L 5A are each independently -C(O)-, -C(O)O-, or -C(O)NR L -; L 4B and L 5B are each independently C1-C 20 alkylene, C2-C 20 alkenylene, or C2-C 20 alkynylene; B and B’ are each NR 4 R 5 or a 5- to 10-membered nitrogen-containing heteroaryl; R 1 、R 2 and R 3 are each independently C6-C 30 alkyl, C6-C 30 alkenyl, or C6-C 30 alkynyl; R 4 and R5 Each independently is hydrogen, C1-C 10 alkyl, C2-C 10 alkenyl, or C2-C 10 alkynyl; and each R L independently is hydrogen, C1-C 20 alkyl, C2-C 20 alkenyl, or C2-C 20 alkynyl.

[0153] In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid that is the compound (139) of 62 / 672,194, having the following compound structure: ("18:1 carbon tail - ribose lipid").

[0154] In some embodiments, the compositions and methods of the present disclosure include the cationic lipid N-[l-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride ("DOTMA") (Feigner et al. (Proc. Nat'l Acad. Sci. [Proceedings of the National Academy of Sciences of the United States of America] 84, 7413 (1987); U.S. Patent No. 4,897,355, which is incorporated herein by reference). Other cationic lipids suitable for the compositions and methods of the present disclosure include, for example, 5-carboxyspermine glycinatedioctadecylamide ("DOGS"); 2,3-dioleyloxy-N-[2(spermine-formylamino)ethyl]-N,N-dimethyl-l-propanaminium ("DOSPA") (Behr et al. Proc. Nat.'l Acad. Sci. [Proceedings of the National Academy of Sciences of the United States of America] 86, 6982 (1989), U.S. Patent No. 5,171,678; U.S. Patent No. 5,334,761); 1,2-dioleoyl-3-dimethylammonio-propane ("DODAP"); 1,2-dioleoyl-3-trimethylammonio-propane ("DOTAP").

[0155] Additional exemplary cationic lipids suitable for the compositions and methods of the present disclosure also include: 1,2-distearyloxy-N,N-dimethyl-3-aminopropane (“DSDMA”); 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane (“DODMA”); 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane (“DLinDMA”); 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane (“DLenDMA”); N-dioleyl-N,N-dimethylammonium chloride (“DODAC”); N,N-distearyl-N,N-dimethylammonium bromide (“DDAB”); N-(1,2-dimyristyloxypropyl-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (“DMRIE”); 3-dimethylamino-2-(cholest-5-en-3-β-yloxybutan-4-yloxy)-1-(cis,cis-9,12-octadecadienyloxy)propane (“CLinDMA”); 2-[5'-(cholest-5-en-3-β-yloxy)-3'-oxapentyloxy)-3-dimethyl-1-1-(cis,cis-9',12'-octadecadienyloxy)propane (“CpLinDMA”); N,N-dimethyl-3,4-dioleyloxybenzylamine (“DMOBA”); 1,2-N,N'-dioleylcarbamoyl-3-dimethylaminopropane (“DOcarbDAP”); 2,3-dilinoleoyloxy-N,N-dimethylpropylamine (“DLinDAP”); 1,2-N,N'-dilinoletcarbamoyl-3-dimethylaminopropane (“DLincarbDAP”); 1,2-dilinoleoylcarbamoyl-3-dimethylaminopropane (“DLinCDAP”); 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (“DLin-K-DMA”); 2-((8-[(3β)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (“Octyl-CLinDMA”); (2R)-2-((8-[(3β)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (“Octyl-CLinDMA(2R)”); (2S)-2-((8-[(3β)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (“Octyl-CLinDMA(2S)”);2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (“DLin-K-XTC2-DMA”); and 2-(2,2-bis((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine (“DLin-KC2-DMA”) (see WO 2010 / 042877, which is incorporated herein by reference; Semple et al., Nature Biotech. 28:172-176 (2010)). (Heyes, J. et al., J Controlled Release 107:276-287 (2005); Morrissey, D.V. et al., Nat. Biotechnol. 23(8):1003-1007 (2005); International Patent Publication WO 2005 / 121348). In some embodiments, one or more cationic lipids comprise at least one of an imidazole, a dialkylamino, or a guanidinium moiety.;

[0156] In some embodiments, one or more cationic lipids suitable for use in the compositions and methods of the present disclosure include 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (“XTC”); (3aR,5s,6aS)-N,N-dimethyl-2,2-bis((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (“ALNY-100”) and / or 4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-bisundecyl-4,7,10,13-tetraazacyclohexadecane-1,16-diamide (“NC98-5”).

[0001] In some embodiments, the compositions and methods of the present disclosure include the cationic lipid ALC-0315 ([(4-hydroxybutyl)azanediyl]bis(hexane-6,1-diyl)bis(2-hexyldecanoate)), which is a synthetic lipid having the following chemical structure: and its pharmaceutically acceptable salts.

[0157] In some embodiments, the compositions of the present disclosure comprise one or more cationic lipids that, when measured by weight, comprise at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipid content in the composition (e.g., lipid nanoparticle), including any value and sub-range therebetween. In some embodiments, the compositions of the present disclosure comprise one or more cationic lipids that, when measured by mol%, comprise at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipid content in the composition (e.g., lipid nanoparticle), including any value and sub-range therebetween. In some embodiments, the compositions of the present disclosure comprise one or more cationic lipids that, when measured by weight, comprise from about 30% to 70% (e.g., about 30% to 65%, about 30% to 60%, about 30% to 55%, about 30% to 50%, about 30% to 45%, about 30% to 40%, about 35% to 50%, about 35% to 45%, or about 35% to 40%, including any value and sub-range therebetween) of the total lipid content in the composition (e.g., lipid nanoparticle). In some embodiments, the compositions of the present disclosure comprise one or more cationic lipids that, when measured by mol%, comprise from about 30% to 70% (e.g., about 30% to 65%, about 30% to 60%, about 30% to 55%, about 30% to 50%, about 30% to 45%, about 30% to 40%, about 35% to 50%, about 35% to 45%, or about 35% to 40%, including any value and sub-range therebetween) of the total lipid content in the composition (e.g., lipid nanoparticle). Non-cationic / helper lipid

[0158] In some embodiments, the liposomes provided contain one or more non-cationic (“helper”) lipids. As used herein, the phrase “non-cationic lipid” refers to any neutral lipid, zwitterionic lipid, or anionic lipid. As used herein, the phrase “anionic lipid” refers to any of a variety of lipidic substances that carry a net negative charge at the selected pH (e.g., physiological pH). Non-cationic lipids include, but are not limited to, distearoyl phosphatidylcholine (DSPC), dioleoyl phosphatidylcholine (DOPC), dipalmitoyl phosphatidylcholine (DPPC), dioleoyl phosphatidylglycerol (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), dioleoyl phosphatidylethanolamine (DOPE), palmitoyl oleoyl phosphatidylcholine (POPC), palmitoyl oleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoyl phosphatidylethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), phosphatidylserine, sphingolipids, cerebrosides, gangliosides, 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), or mixtures thereof.

[0159] In some embodiments, the non-cationic lipid is DPPC. In some embodiments, the non-cationic lipid is DOPE. In some embodiments, the non-cationic lipid is DEPE.

[0160] In some embodiments, such non-cationic lipids can be used alone, but are preferably used in combination with other lipids (e.g., cationic lipids). In some embodiments, the non-cationic lipids can comprise the following molar ratios: about 5% to about 90%, or about 10% to about 70% of the total lipids present in the liposome. In some embodiments, the non-cationic lipid is a neutral lipid, i.e., a lipid that does not carry a net charge under the conditions of formulating and / or administering the composition. In some embodiments, the percentage of non-cationic lipid in the liposome can be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%. Cholesterol-based lipids

[0161] In some embodiments, the provided liposomes comprise one or more cholesterol-based lipids. For example, suitable cholesterol-based cationic lipids include, for example, DC-Choi (N,N-dimethyl-N-ethylformamidinocholesterol), 1,4-bis(3-N-oleylaminopropyl)piperazine (Gao et al., Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al., BioTechniques 23, 139 (1997); U.S. Patent No. 5,744,335), or ICE. In some embodiments, the cholesterol-based lipids can comprise the following molar ratios: about 2% to about 30%, or about 5% to about 20% of the total lipids present in the liposome. In some embodiments, the percentage of cholesterol-based lipids in the lipid nanoparticles can be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%. PEGylated lipids

[0162] For example, the present disclosure also contemplates the use of polyethylene glycol (PEG)-modified phospholipids and derived lipids, such as derived ceramides (PEG-CER), including N-octanoyl-sphingosine-1-[succinyl-(methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide), alone or preferably in combination with other lipid formulations comprising a delivery vehicle (e.g., lipid nanoparticles). The PEGylated lipids contemplated include, but are not limited to, polyethylene glycol chains up to 8 kDa covalently attached to lipids having one or more alkyl chains with a length of C6-C 20 Adding such components can prevent complex aggregation and can also provide a means for increasing the circulation lifetime and enhancing the delivery of lipid-nucleic acid compositions to target tissues (Klibanov et al. (1990) FEBS Letters, 268(1):235-237), or they can be selected to rapidly exchange the formulation in vivo (see U.S. Patent No. 5,885,613). Particularly useful exchangeable lipids are PEG-ceramides having shorter acyl chains (e.g., C14 or C18). The PEG-modified phospholipids and derived lipids of the present disclosure can comprise the following molar ratios: about 0% to about 20%, about 0.5% to about 20%, about 1% to about 15%, about 4% to about 10%, or about 2% of the total lipids present in the liposome delivery vehicle. In some embodiments, the one or more PEGylated lipids comprise about 4% of the total lipids on a molar basis. In some embodiments, the one or more PEGylated lipids comprise about 5% of the total lipids on a molar basis. In some embodiments, the one or more PEGylated lipids comprise about 6% of the total lipids on a molar basis. Polymer

[0163] In some embodiments, suitable delivery vehicles are formulated using a polymer as a carrier, which polymer is either alone or in combination with other carriers including the various lipids described herein. Thus, in some embodiments, as used herein, liposomal delivery vehicles also encompass nanoparticles comprising a polymer. Suitable polymers can include, for example, polyacrylates, alkyl cyanoacrylates, polylactides, polylactide-polyglycolide copolymers, polycaprolactones, dextrans, albumins, gelatins, alginates, collagens, chitosans, cyclodextrins, protamines, PEGylated protamines, PLL, PEGylated PLL, and polyethylenimine (PEI). When PEI is present, it can be branched PEI having a molecular weight range of 10 to 40 kDa, such as 25 kDa branched PEI (Sigma number 408727).

[0164] Exemplary combinations of cationic lipids, non-cationic lipids, cholesterol-based lipids, and PEG-modified lipids are described in the Examples section. For example, suitable lipid solutions can contain CKK-E10, DOPE, cholesterol, and DMG-PEG2K; CKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT5000, DOPE, cholesterol, and DMG-PEG2K; HGT5001, DOPE, cholesterol, and DMG-PEG2K; OF-02, DOPE, cholesterol, and DMG-PEG2K; GL-HEPES-E3-E12-DS-4-E10, DOPE, cholesterol, and DMG-PEG2K; CKK-E10, DPPC, cholesterol, and DMG-PEG2K; CKK-E12, DPPC, cholesterol, and DMG-PEG2K; C12-200, DPPC, cholesterol, and DMG-PEG2K; HGT5000, DPPC, cholesterol, and DMG-PEG2K; HGT5001, DPPC, cholesterol, and DMG-PEG2K; OF-02, DPPC, cholesterol, and DMG-PEG2K; or GL-HEPES-E3-E12-DS-4-E10, cholesterol, and DMG-PEG2K. The choice of cationic lipid, non-cationic lipid, and / or PEG-modified lipid that make up the lipid mixture and the relative molar ratios of such lipids to one another are based on the characteristics of the one or more lipids selected and the nature and characteristics of the mRNA to be encapsulated. Additional considerations include, for example, the saturation of the alkyl chains and the size, charge, pH, pKa, fusogenicity, and toxicity of the one or more lipids selected. Thus, the molar ratios can be adjusted accordingly.

[0165] In some embodiments, LNPs are manufactured with cationic lipids, non-cationic lipids, cholesterol-based lipids, and PEGylated lipids in specific molar ratios. In some embodiments, the lipid nanoparticles comprise cationic lipids, non-cationic lipids, cholesterol-based lipids, and PEGylated lipids in a molar ratio of 60:25:10:5. In some embodiments, the lipid nanoparticles comprise cationic lipids, non-cationic lipids, cholesterol-based lipids, and PEGylated lipids in a molar ratio of 40:25:30:5. Therapeutic use

[0166] In some embodiments, the dry powder formulations described herein comprise any full-length mRNA. In some embodiments, the dry powder formulations described herein comprise mRNA suitable for encoding a drug or a peptide or protein therapeutic agent for use in this disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA suitable for encoding any peptide or polypeptide for use in this disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA suitable for encoding any antibody for use in this disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA suitable for encoding any therapeutic protein for use in this disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA suitable for encoding any naturally occurring peptide for use in this disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA suitable for encoding any modified or non-naturally occurring peptide for use in this disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA suitable for encoding any peptide drug for use in this disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA suitable for encoding any peptide or polypeptide for delivery to or for treatment of the lung or lung cells of a subject. In some embodiments, the dry powder formulations described herein comprise full-length mRNA suitable for encoding any peptide or polypeptide for delivery to or for treatment of the liver or liver cells of a subject. In some embodiments, the dry powder formulations described herein comprise full-length mRNA suitable for encoding a protein associated with a urea cycle disorder for use in this disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA suitable for encoding a protein associated with a lysosomal storage disorder for use in this disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA suitable for encoding a protein associated with a glycogen storage disorder for use in this disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA suitable for encoding a protein associated with amino acid metabolism for use in this disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA suitable for encoding a protein associated with lipid metabolism or a fibrotic disorder for use in this disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA suitable for encoding a protein associated with methylmalonic acidemia for use in this disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA suitable for encoding any peptide or polypeptide for delivery to or for treatment of the cardiovascular system or cardiovascular cells of a subject. In some embodiments, the dry powder formulations described herein comprise full-length mRNA suitable for encoding any peptide or polypeptide for delivery to or for treatment of the muscle or muscle cells of a subject.In some embodiments, the dry powder formulations described herein comprise full-length mRNAs encoding peptides or polypeptides suitable for use in the present disclosure for delivery to or treatment of the nervous system or nervous system cells of a subject. In some embodiments, the dry powder formulations described herein comprise full-length mRNAs encoding any peptide or polypeptide suitable for use in the present disclosure for delivery to or treatment of the eye or eye cells of a subject. In some embodiments, the dry powder formulations described herein comprise full-length mRNAs encoding peptides or polypeptides suitable for use in the present disclosure for delivering a vaccine to or treating a subject or the cells of a subject with a vaccine. In some embodiments, the dry powder formulations described herein comprise full-length mRNAs encoding antigens from infectious agents (e.g., viruses) suitable for use in the present disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNAs encoding immunomodulators suitable for use in the present disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNAs encoding endonucleases suitable for use in the present disclosure.

[0167] The pharmaceutical formulations of the present disclosure can be administered in a local rather than a systemic manner, e.g., by directly injecting the pharmaceutical formulation into the targeted tissue (e.g., in a sustained release formulation).

[0168] Depending on the tissue to be targeted, local delivery can be achieved in various ways. Exemplary tissues to which the delivered mRNA can be delivered and / or expressed include, but are not limited to, lung, liver, kidney, heart, spleen, serum, brain, skeletal muscle, lymph nodes, skin, and / or cerebrospinal fluid. In some embodiments, the tissue to be targeted is in the liver. For example, an aerosol containing the composition of the present disclosure can be inhaled (for nasal, tracheal, or bronchial delivery). In some embodiments, the composition of the present disclosure can be delivered using a metered dose inhaler. In some embodiments, the composition of the present disclosure can be reconstituted and nebulized for delivery. In some embodiments, the composition of the present disclosure can be injected into a site of injury, disease manifestation, or pain. In some embodiments, the composition of the present disclosure can be provided in the form of a lozenge for oral, tracheal, or esophageal application. In some embodiments, the composition of the present disclosure can be supplied in liquid, tablet, or capsule form for administration to the stomach or intestine. In some embodiments, the composition of the present disclosure can be supplied in suppository form for rectal or vaginal application. In some embodiments, the composition of the present disclosure can be delivered to the eye by using a cream, drops, or even injection.

[0169] In some embodiments, the dry powder formulations of the present disclosure are reconstituted into a liquid solution and nebulized for delivery. Nebulization can be achieved by any nebulizer known in the art. The nebulizer converts the liquid into a mist such that it can be more easily inhaled into the lungs. The nebulizer is effective for infants, children, and adults. The nebulizer is capable of nebulizing large doses of inhaled medications. Typically, the nebulizer used for the present disclosure includes a detachable mouthpiece.

[0170] In some embodiments, the dry powder formulations as described herein can be used to deliver a therapeutically effective amount of mRNA for treating various diseases or disorders. In some embodiments, the mRNA encodes a therapeutic protein. For example, the dry powder formulations prepared by spray drying according to the present disclosure can be administered via oral, nasal, tracheal, or pulmonary or routes to treat lung-related disorders such as cystic fibrosis. In some embodiments, the dry powder formulations are administered by inhalation. In some embodiments, the formulations are administered by a metered-dose inhaler. In some embodiments, the dry powder formulations are administered by nasal spray. In some embodiments, the dry powder formulations are rehydrated and administered as intravenous infusions, injections, oral drops, nasal drops, and any other applications readily envisioned by one of ordinary skill in the art. The present disclosure can be used to treat various other lung-related diseases, disorders, and conditions. In some embodiments, the stable dry powder formulations of the present disclosure can be used to treat one or more of the following: asthma; COPD; emphysema; primary ciliary dyskinesia (CILD1) with or without situs inversus or Kartagener syndrome; pulmonary fibrosis; Birt-Hogg-Dube syndrome; hereditary hemorrhagic telangiectasia; alpha-1 antitrypsin deficiency; cytochrome b-positive granulomatous disease (CGD, X-linked); cytochrome b-positive granulomatous disease (autosomal recessive); surfactant deficiency diseases, pulmonary surfactant metabolism dysfunction 1, pulmonary surfactant metabolism dysfunction 2, pulmonary surfactant metabolism dysfunction 3; respiratory distress syndrome of premature infants; tuberculous tuberculosis, pulmonary viral diseases (including influenza), and respiratory syncytial virus (RSV).

[0171] In some embodiments, the stable dry powder formulations of the present disclosure can be used to treat one or more of acute respiratory distress syndrome (ARDS), cystic fibrosis (CF), lung cancer, pulmonary alveolar proteinosis (PAP), pulmonary arterial hypertension (PAH), and primary ciliary dyskinesia (PCD).

[0172] In some embodiments, the present disclosure provides dry powder compositions comprising full-length mRNAs encoding therapeutic proteins. In some embodiments, the therapeutic protein is CFTR. In some embodiments, the therapeutic protein is DNAI1. In some embodiments, the present disclosure provides dry powder compositions comprising full-length mRNAs encoding secreted proteins. In some embodiments, the present disclosure provides dry powder compositions comprising full-length mRNAs encoding nuclear proteins. In some embodiments, the present disclosure provides dry powder compositions comprising full-length mRNAs encoding metabolic proteins. In some embodiments, the present disclosure provides dry powder compositions comprising full-length mRNAs encoding cytosolic proteins. In some embodiments, the present disclosure provides dry powder compositions comprising full-length mRNAs encoding membrane proteins. In some embodiments, the present disclosure provides dry powder compositions comprising full-length mRNAs encoding mitochondrial proteins. In some embodiments, the present disclosure provides dry powder compositions comprising full-length mRNAs encoding lysosomal proteins. In some embodiments, the mRNA encodes a cytosolic protein. In some embodiments, the mRNA encodes a protein associated with the actin cytoskeleton. In some embodiments, the mRNA encodes a protein associated with the plasma membrane.

[0173] In some embodiments, the mRNA encodes one or more naturally occurring peptides. In some embodiments, the mRNA encodes one or more modified or non-natural peptides.

[0174] In some embodiments, the peptide drug includes glucose-dependent insulinotropic polypeptide. Another example of a peptide drug is elamipretide. Further examples of peptide drugs are cyclotides (peptides characterized by their head-to-tail cyclized peptide backbone and their disulfide-bonded interlocked arrangement), including, for example, cyclotides having at least two disulfide bonds (and preferably cyclotides having three disulfide bonds).

[0175] In some embodiments, the peptide drug is selected from GLP-1, amylin, amylin analogs, pramlintide, somatostatin analogs (e.g., octreotide, lanreotide or pasireotide), goserelin (e.g., goserelin acetate), buserelin, peptide YY (PYY), PYY analogs, glatiramer (e.g., glatiramer acetate), leuprolide (e.g., leuprolide acetate), desmopressin (e.g., desmopressin acetate, especially desmopressin acetate trihydrate), teicoplanin, telavancin, bleomycin, ramoplanin, decaplanin, bortezomib, cosyntropin, sermorelin, luteinizing hormone releasing hormone (LHRH), calcitonin (e.g., salmon calcitonin), pentagastrin, nesiritide, enfuvirtide, eptifibatide, cyclosporine, glucagon, viomycin, thyrotropin releasing hormone (TRH), leucine enkephalin, methionine enkephalin, substance P, parathyroid hormone (PTH) fragments (e.g., teriparatide (PTH(1-34)), i.e., PTH(1-31) or PTH(2-34)), carfilzomib, icatibant, cilengitide, prostaglandin F2α receptor modulators (e.g., PDC31), and pharmaceutically acceptable salts thereof. Particularly preferred is that the peptide drug is selected from semaglutide, liraglutide, teriparatide (PTH(1-34)), octreotide, leuprolide, and pharmaceutically acceptable salts thereof.

[0176] Accordingly, in certain embodiments, the present disclosure provides methods for producing dry powder compositions comprising full-length mRNA encoding a peptide or polypeptide for delivery to or treatment of a subject's lung or lung cells. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the cystic fibrosis transmembrane conductance regulator (CFTR) protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the ATP-binding cassette sub-family A member 3 protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the dynein axonemal intermediate chain 1 protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the dynein axonemal heavy chain 5 (DNAH5) protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the α-1-antitrypsin protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the forkhead box P3 (FOXP3) protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding one or more surfactant proteins, such as one or more of surfactant protein A, surfactant protein B, surfactant protein C, and surfactant protein D.

[0177] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or treatment of a subject's liver or liver cells. Such peptides and polypeptides can include those associated with urea cycle disorders, lysosomal storage disorders, glycogen storage disorders, amino acid metabolism disorders, lipid metabolism or fibrosis disorders, methylmalonic acidemia, or any other metabolic disorder for which delivery of enriched full-length mRNA to or treatment of the liver or liver cells would provide a dry powder benefit.

[0178] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a protein associated with urea cycle disorders. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding ornithine carbamoyltransferase (OTC) protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding argininosuccinate synthetase 1 protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding carbamoyl phosphate synthetase 1 protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding argininosuccinate lyase protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding arginase protein.

[0179] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a protein associated with lysosomal storage disorders. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an alpha-galactosidase protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a glucocerebrosidase protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an iduronate-2-sulfatase protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an iduronidase protein. In certain embodiments, the present disclosure provides methods for producing therapeutic compositions having full-length mRNA encoding an N-acetyl-alpha-D-glucosaminidase protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a heparan N-sulfatase protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a galactosamine-6-sulfatase protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a beta-galactosidase protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a lysosomal lipase protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an arylsulfatase B (N-acetylgalactosamine-4-sulfatase) protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a transcription factor EB (TFEB).

[0180] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a protein associated with glycogen storage disorders. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the acid alpha-glucosidase protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the glucose-6-phosphatase (G6PC) protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the liver glycogen phosphorylase protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the muscle phosphoglycerate mutase protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the glycogen debranching enzyme.

[0181] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a protein associated with amino acid metabolism. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the enzyme phenylalanine hydroxylase. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the enzyme glutaryl-CoA dehydrogenase. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the enzyme propionyl-CoA carboxylase. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the enzyme oxalase alanine-glyoxylate aminotransferase.

[0182] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a protein associated with lipid metabolism or fibrotic disorders. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an mTOR inhibitor. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the ATPase phospholipid transporter 8B1 (ATP8B1) protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding one or more NF-κB inhibitors, such as one or more of I-κBα, interferon-related developmental regulator 1 (IFRD1), and Sirtuin 1 (SIRT1). In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the PPAR-γ protein or an active variant.

[0183] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a protein associated with methylmalonic acidemia. For example, in certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the methylmalonyl-CoA mutase protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the methylmalonyl-CoA epimerase protein.

[0184] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA. In some embodiments, the present disclosure provides methods for delivering the same to the liver or for treating liver-related disorders. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the ATP7B protein (also known as the Wilson disease protein). In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the enzyme porphobilinogen deaminase. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding one or more coagulation factors, such as factor VIII, factor IX, factor VII, and factor X. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the human hemochromatosis (HFE) protein.

[0185] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or for treatment of a subject's cardiovascular system or cardiovascular cells. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding vascular endothelial growth factor A protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding relaxin protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding bone morphogenetic protein-9 protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding bone morphogenetic protein-2 receptor protein.

[0186] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or for treatment of a subject's muscle or muscle cells. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding dystrophin. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding frataxin. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or for treatment of a subject's myocardium or myocardial cells. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a protein that modulates one or both of potassium channels and sodium channels in muscle tissue or muscle cells. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a protein that modulates the Kv7.1 channel in muscle tissue or muscle cells. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a protein that modulates the Nav1.5 channel in muscle tissue or muscle cells.

[0187] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or for treatment of a subject's nervous system or nervous system cells. For example, in certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding survival motor neuron 1. For example, in certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding survival motor neuron 2. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding frataxin protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding ATP-binding cassette subfamily D member 1 (ABCD1) protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding CLN3 protein.

[0188] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or for treatment of a subject's blood or bone marrow or blood cells or bone marrow cells. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the protein β-globin. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding Bruton's tyrosine kinase protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding one or more coagulation enzymes, such as factor VIII, factor IX, factor VII, and factor X.

[0189] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or for treatment of a subject's kidney or kidney cells. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding type IV collagen alpha 5 chain (COL4A5) protein.

[0190] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes a peptide or polypeptide for delivery to or for treatment of a subject's eye or eye cells. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes ATP-binding cassette sub-family A member 4 (ABCA4) protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes retinoschisin protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes retinal pigment epithelium-specific 65 kDa (RPE65) protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes 290 kDa centrosomal protein (CEP290).

[0191] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes a peptide or polypeptide for delivering a vaccine to a subject or the subject's cells or treating the subject with the vaccine. For example, in certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes an antigen from an infectious agent, such as a virus. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes an antigen from an influenza virus. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes an antigen from a respiratory syncytial virus. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes an antigen from a rabies virus. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes an antigen from a cytomegalovirus. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes an antigen from a rotavirus. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes an antigen from a hepatitis virus, such as hepatitis A virus, hepatitis B virus, or hepatitis C virus. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes an antigen from a human papillomavirus. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes an antigen from a herpes simplex virus, such as herpes simplex virus 1 or herpes simplex virus 2. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes an antigen from a human immunodeficiency virus, such as human immunodeficiency virus type 1 or human immunodeficiency virus type 2. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes an antigen from a human metapneumovirus. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes an antigen from a human parainfluenza virus, such as human parainfluenza virus type 1, human parainfluenza virus type 2, or human parainfluenza virus type 3. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes an antigen from a malaria virus. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA that encodes an antigen from a Zika virus.In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antigen from chikungunya virus.

[0192] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antigen associated with a subject's cancer or identified from the subject's cancer cells. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antigen determined from the subject's own cancer cells, i.e., providing a personalized cancer vaccine. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antigen expressed from a mutant KRAS gene.

[0193] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antibody. In certain embodiments, the antibody can be a bispecific antibody. In certain embodiments, the antibody can be part of a fusion protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antibody against OX40. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antibody against VEGF. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antibody against tumor necrosis factor α. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antibody against CD3. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antibody against CD19.

[0194] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding immunomodulators. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding interleukin-12. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding interleukin-23. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding interleukin-36γ. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding constitutively active variants of one or more stimulator of interferon genes (STING) proteins.

[0195] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding endonucleases. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding RNA-guided DNA endonuclease proteins (such as Cas9 proteins). In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding meganuclease proteins. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding transcription activator-like effector nuclease proteins. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding zinc finger nuclease proteins.

[0196] The present disclosure can be used to treat a variety of other diseases, disorders, and conditions that require sustained release of mRNA formulations. Such examples include diseases where delivery of mRNA in the digestive tract is useful for these diseases. Such diseases include, but are not limited to, apolipoprotein E deficiency diseases; inflammatory bowel disease or Crohn's disease; adhesion G protein-coupled receptor VI deficiency diseases; type 2 von Willebrand disease; calcium oxalate CAON-related kidney stones; maturity onset diabetes of the young, type 8. Messenger RNA (mRNA) vaccines

[0197] mRNA vaccines are novel and offer many advantages over existing cell-based vaccines using live, attenuated or inactivated pathogens or toxoid vaccines. In addition to safety, mRNA vaccines are cost-effective and provide a flexible design platform. The mRNA encoding the antigen can be used to induce a specific immune response and can thus be applied to develop a wide range of therapeutic and prophylactic mRNA vaccines for a variety of diseases, including infections and cancers. Vaccines against infections

[0198] Vaccine candidates against a large number of infectious pathogens are well established. Typically, a vaccine is an agent that at least partially mimics a pathogen and thereby elicits an immune response in a mammalian host. Generally, vaccines are biological agents such as heat-inactivated, irradiated or otherwise attenuated pathogenic organisms, attenuated live microorganisms, protein or peptide antigens, conjugated antigens, toxins or microbial surface proteins or fragments thereof. However, mRNA encoding a protein or peptide antigen is a safe and effective way to induce an immune response against a disease. As discussed above, mRNA can be effectively delivered for in vivo expression by encapsulation in liposomes that contain suitable lipids discussed in the subsequent sections. Thus, this mRNA encoding an antigenic peptide or protein can be used to generate a vaccine in vivo. The immune response generated by the mammalian host against the vaccine components is then intended to protect the host from subsequent attack by the pathogen, as the host's immune system has been primed for the pathogen's attack. In other words, the host system has an immune memory (a component of the adaptive immune response) against the pathogen. This process is called prophylactic vaccination. Additionally, a vaccine can boost the immune system of a host in an ongoing infection, for example by redirecting the immune response to one or more new and less recognized microbial antigens (subdominant antigens) and then inducing a strong immune response, resulting in pathogen elimination. This type of vaccine response can be classified as therapeutic vaccination.

[0199] The immune response against pathogens can be broken down into several stages. First, when the human body (or mammalian system) encounters a new pathogen, especially through exposure on surfaces (such as the skin or the inner mucosal surfaces of the respiratory, gastrointestinal, and urogenital tracts), it elicits a non-specific innate immune response by activating pattern recognition molecules. Pattern recognition molecules include a variety of germline-encoded receptors that are specialized for distinguishing between microbial and host cell surfaces, or between infected and normal cells. Phagocytes (monocytes, macrophages, and dendritic cells) express pattern recognition molecules on their surfaces and are mainly responsible for recognizing, killing, and eliminating pathogens in the innate immune response. In doing so, phagocytes also process antigens and present them to circulating lymphocytes to generate a more specific antigen-targeted immune response, also known as the adaptive immune response. At this stage, activated lymphocytes mature into antigen-specific T cells in the lymph nodes, and these antigen-specific T cells express receptors to recognize antigens, enabling effector cytotoxic T cells to recognize and kill cells that express antigens presented in association with a second set of cell surface molecules, namely major histocompatibility complex molecules or MHC; and helper T cells activate the system to generate T cell memory and humoral immune responses. The humoral immune response involves the generation of antibody-secreting B cells through clonal expansion and differentiation over the course of several days, during which the innate immune response continues to function. Clonal expansion of cytotoxic T cells also occurs rapidly in lymphoid organs such as lymph nodes and is enhanced by exposure to antigens. Activated T cells produce many cytokines, such as interferon gamma (IFN-γ) and tumor necrosis factor alpha (TNF-α), which are considered markers of T cell activation. Finally, antigen-specific T cells and then antibodies are released into the blood and recruited to the site of infection. Successful vaccines generate a rapid and robust cytotoxic T cell response, a strong antibody response, and long-lasting immune memory. Cancer vaccine

[0200] Cancer is considered an immunological disease, and cancer immunotherapy has become the center of current research and development efforts. In cancer immunotherapy, vaccines are developed to strengthen the immune system against cancer antigens and eliminate tumors by activating cytotoxic T cells against these antigens. One class of cancer antigens is viral antigens associated with oncogenic viruses. To name just a few examples, these include Epstein-Barr virus (EBV) antigens (such as EBV1 and EBV2) associated with lymphoma and nasopharyngeal carcinoma, human papillomavirus (HPV) antigens (such as HPV16) associated with cervical cancer (CC), hepatitis B virus (HBV) antigens and hepatitis C virus (HCV) antigens associated with hepatocellular carcinoma (HCC), human T-lymphotropic virus type 1 (HTLV-1) associated with adult T cell leukemia / lymphoma, and human herpesvirus 8 (HHV-8) associated with Kaposi's sarcoma.

[0201] On the other hand, antigens expressed by cancer cells are not usually expressed in non-cancerous cells or tissues. Such antigens include, but are not limited to, epithelial tumor antigen (ETA) found in breast cancer; RAS family members p-53 and other activated RAS antigens; ovarian cancer antigens BRCA1 and BRCA2; melanoma-associated antigen (MAGE) found in malignant melanoma cells; BCR-ABL fusion gene product found in myeloid leukemia, acute lymphoblastic leukemia, and acute myeloid leukemia; BRAF antigen found in cutaneous melanoma and colorectal cancer, epidermal growth factor receptor (EGFR) in non-small cell lung cancer, KRAS found in colorectal cancer and non-small cell lung cancer, neuron-specific enolase found in neuroblastoma and non-small cell lung cancer, NY-ESO 1 found in neuroblastoma, melanoma-associated antigen recognized by T cells (MART-1) found in melanoma, programmed death ligand 1 (PD-L1) found in non-small cell lung cancer, prostate-specific antigen (PSA) found in prostate cancer, urokinase plasminogen activator (UPA), plasminogen activator inhibitor (PAI-1), and many other antigens, almost all of which are mutant endogenous proteins. These endogenous cancer antigens are not presented by antigen-presenting cells (APCs) in a manner similar to viral antigens, i.e., viral antigens are classified as foreign antigens while in a state associated with MHC-1 molecules, but cytotoxic T cells are able to differentiate and identify mutant self-antigens and have the inherent property of seeking and destroying cells carrying mutant antigens. Therefore, the current goal of cancer immunotherapy is to achieve optimal activation of cytotoxic T cells against mutant antigens. The specific mutations associated with a patient's cancer can be mapped and used to generate a vaccine that induces the patient's own cytotoxic T cells to generate the necessary immune response to destroy tumor cells. mRNA vaccines can be a safe and cost-effective alternative to peptide vaccines for achieving such personalized medicine. Whole-genome scanning and analysis of mutations present in cancer patients can be used to specifically design mRNA encoding antigens or epitopes containing the mutations, which, when administered in vivo, will produce translation products on the cell surface. This will direct an immune response against mutant antigens. In this process, cytotoxic T cells attack tumor cells that inherently express mutant antigens. The methods and protocols involved in the performance of pan-genomic sequencing analysis, mutation analysis, epitope mapping and analysis, and the design of peptides suitable for vaccination are known to those skilled in the art.

[0202] This method can also be used to identify dominant and sub-dominant antigens in patients. It has been observed that in both chronic infections and cancers, certain antigens play a dominant role in generating an initial immune response. However, shortly thereafter, tolerance to such dominant antigens begins to establish, thereby weakening the immune response. Genomic analysis and identification are performed on antigens that do not show an initial dominant antigen response (commonly referred to as sub-dominant antigens) but can now be used to generate new and reconstituted immune responses.

[0203] One advantage of mRNA vaccines over peptide vaccines is that mRNA vaccines bypass the HLA typing of the recipient host.

[0204] When designing mRNA vaccines using synthetic methods, antigenic signatures with vaccine potential in the pathogen proteome can be scanned. (The proteome database can be accessed using the Uniprot Consortium (http: / / www.uniprot.org / )). This may be effective in new pathogens such as Zika virus. This type of reverse vaccinology has been used to identify many novel peptide vaccine candidates. New peptide vaccines have also been identified from Helicobacter pylori and Mycobacterium tuberculosis by combining genomics and proteomics (see, for example, Etz et al., PNAS. 2002, 99(10) 6573-6578). Potential antigen candidates can be verified for their ability to generate a successful immune response by appropriately expressing a library of potential antigens (through various forms of cell surface display) and performing opsonization and antibody binding tests. Exemplary databases available for vaccine antigen development include: the ImMunoGeneTics Information System (URL: imgt.org); the Epitome database (URL: rostlab.org / services / epitome), the Immune Epitope Database and Analysis Resource (iedb.org); the Immunet database (immunet.cn / ced / index.php); the HIV database: hiv.lanl.gov / content / immunology for immunogenetics and immunoinformatics.

[0205] Therefore, it is clear from the above discussion that enhancing the delivery of mRNA vaccines to lymph nodes can result in the vaccine acting simultaneously on activated and naive lymphocytes for lymphocyte proliferation and the generation of antigen-specific T cells and B cells. Compared to widespread immune activation, this antigen-localized activation is also less toxic. Examples

[0206] While certain compounds, compositions, and methods of the present disclosure have been specifically described according to certain embodiments, the following examples are for illustrative purposes only and are not intended to limit it.

[0207] The lipids studied in these examples include: (1) Lipid 1 (also known as Lipid A); (2) Lipid 2 (also known as Lipid B); and (3) Lipid 3. Example 1: Effects of mannitol and solvent on processing temperature and powder size.

[0208] This example describes the effect of temperature on the dry powder product and the effect of solvent on temperature. Although it is feasible to use water as the solvent to manufacture DPP at an inlet temperature of 90 °C, the processing temperature was reduced to prevent any potential mRNA degradation and increase the yield (by minimizing adhesion to the cyclone). The spray drying efficiency and powder size of the dry powder formulation of LNP-encapsulated mRNA prepared in the presence of mannitol were evaluated. Using an aqueous alcohol solution also helped to reduce the particle size of DPP. It was observed that using 5% mannitol in 20% ethanol reduced the processing temperature and powder size.

[0209] Two LNP-encapsulated mRNA formulations were prepared, one with 5% mannitol in water and the second with 4% mannitol in 20% ethanol. To prepare the LNP formulation, for spray drying, the mRNA was first mixed with the LNP using a gear pump. This process encapsulates the mRNA within the LNP. Different mannitol solutions were added to the mRNA-LNP formulation. These mixtures were then subjected to spray drying. The inlet temperature and subsequent outlet temperature were optimized for each formulation of mannitol. Table 1 summarizes the different formulations of mannitol and the powder size of LNP-mRNA.

[0210] Results: It was observed that a solution of 5% mannitol in 20% ethanol produced a powder size of 12 microns. This is in stark contrast to the formulation of 5% mannitol in water (in this case, the powder size was much larger). Additionally, for the solution containing 4% mannitol in 20% ethanol, the inlet and outlet temperatures used for spray drying were much lower. Table 1 - Effect of mannitol formulations in mRNA lyophilization Example 2: Effect of different helper lipids on encapsulation efficiency.

[0211] This example describes how to determine one or more lipids that produce the most desirable values for pre-encapsulation efficiency and powder size. It was observed that lipid 2 in combination with DEPE or DPPC co-lipids provided the most efficient encapsulation efficiency.

[0212] In the presence of mannitol, LNP-encapsulated mRNA formulations were prepared using 2 different ionizable lipids and 3 different co-lipids. For the preparation of the LNP formulations, for spray drying, an acidic aqueous buffer solution of mRNA was first mixed with a lipid solution in ethanol using a gear pump. This process encapsulates the mRNA within the LNP. The LNP was then buffer-exchanged in a solution of 4% w / v mannitol in 20% ethanol and subjected to spray drying. The encapsulation efficiency before spray drying and the reconstituted encapsulation efficiency were calculated. The results are summarized in Table 2.

[0213] Results: It was observed that for lipid 1, there were no significant changes in size, encapsulation efficiency, and powder size when using different co-lipids. For lipid 1, there were no significant differences in yield, LNP size, encapsulation, and DP size when using DPPC and DEPE compared to DOPE. For lipid 2, it was observed that lower encapsulation was obtained when using DPPC and DEPE. Thus, it can be estimated that the co-lipids DPPC and DEPE are incompatible with the ionizable lipid 2 when forming LNP. The feed volume had no significant effect on the process or product characteristics.

[0214] Table 2 - Encapsulation efficiency and powder size of LNP with different co-lipids

[0215] A similar analysis was repeated using lipid 1 at different lipid:mRNA ratios. Figures 2A - 2D The mRNA loading efficiency, yield, encapsulation efficiency, and powder size were summarized. It was observed that an increase in mRNA loading was achieved by decreasing the N / P ratio or changing the LNP composition. The LNP composition can be changed while maintaining the same yield. No change in encapsulation after spray drying was seen. All combinations produced a desirable powder size. The optimal composition was 375 mg leucine, N / P = 3 (5:60:25:10 LNP composition). Example 3: Determine the leucine and mannitol concentrations for yield, powder size, and encapsulation efficiency.

[0216] This example describes how to determine the mannitol and leucine concentrations that result in the most desirable yield, encapsulation efficiency, and powder size. Amino acid excipients (such as leucine and trilucine) have shown improved powder characteristics and can increase yield by minimizing adhesion to the cyclone separator. Since amino acid excipients have low solubility in 20% ethanol, higher feed volumes are required to incorporate them. Therefore, the effect of increasing the feed volume on formulations without amino acids was first evaluated. Lipid 1-based dry powders made with 2 g mannitol, 50 mg mRNA, and an equivalent lipid mass at feed volumes of 50, 100, 150, and 250 ml did not show significant differences in yield, LNP size, encapsulation, and average particle size.

[0217] Prepare LNP-encapsulated mRNA formulations with different masses of leucine, or mannitol, or combinations of different ratios of leucine and mannitol. To prepare the LNP formulations, for spray drying, first mix the acidic aqueous buffer solution of mRNA with the lipid solution in ethanol using a gear pump. This process encapsulates the mRNA within the LNP. Then buffer exchange the final LNP formulation in a 20% ethanol solution. Prepare different solutions of mannitol, leucine, or combinations of leucine and mannitol in 20% ethanol and then add them to the final mRNA LNP formulation. Then subject these mixtures to spray drying. Optimize the inlet and outlet temperatures for each formulation of mannitol. Figures 2A - 2D The different parameters analyzed are summarized. Dry powders were made using LNPs with a constant lipid content, N / P of 4, and a lipid molar ratio of DMG-PEG-2000:lipid 1:cholesterol:DOPE (5:40:25:30) for this screening. The size of the LNP products used for spray drying was between 60 nm and 80 nm. The yield was significantly improved by using leucine. For example, although 2000 mg mannitol was used, most of the dry powder without leucine adhered to the cyclone separator and only a 10% yield was obtained for this dry powder. However, using only 1500 mg of leucine alone, up to 50% of the product was obtained in the collection vessel. Additionally, a significant increase in yield was detected as the amount of leucine increased. The highest yield of up to 60% was obtained using a 4:1 mixture of mannitol and leucine (500 mg leucine combined with 2000 mg mannitol). Additionally, leucine alone and in combination with mannitol showed a significant decrease in the average particle size of the dry powder ( Figure 2D ). Dry powders made with only mannitol showed a much higher average particle size.

[0218] In some embodiments, the increase in yield and the decrease in the average particle size of DPP can be attributed to the lower solubility of leucine in the water-alcohol solvent and its higher surface activity. The lower solubility of leucine promotes the rapid coating of newly formed DPP, which may prevent adhesion and result in a higher yield. In addition, the higher surface activity reduces the cohesiveness, which may lead to the formation of DPP with a smaller average particle size.

[0219] It was observed that lipid 1 with 750 mg of leucine or 500 mg of leucine + 200 mg of mannitol provided the best mRNA loading efficiency and yield. Other characteristics such as encapsulation efficiency and powder yield are also desired ( Figure 2B and Figure 2C ). As expected, the experimental mRNA weight percentage decreased with an increase in the amount of excipient. ( Figure 2A )

[0220] Results: It was observed that the introduction of leucine reduced the powder size, increased the yield and mRNA loading. No significant change in encapsulation and powder size was observed after spray drying with leucine or leucine / mannitol concentration. Thus, the optimal composition was observed to be 750 mg of leucine or 2500 mg of leucine / mannitol (1:2.3) combination. In independent experiments, it was observed that the combination of mannitol / leucine (1000 mg / 500 mg) was also optimal for yield, powder size, encapsulation efficiency and mRNA weight percentage.

[0221] A similar analysis was repeated using lipid 3 with leucine, mannitol, or a combination of leucine and mannitol. Figures 3A - 3D The different parameters analyzed were summarized. It was observed that there was no need for a change in composition or lipid to mRNA (N / P) ratio. It was observed that 250 mg of leucine provided a reasonable dry powder yield and produced a 5% mRNA loading. Example 4: Effect of reducing lipid concentration on dry powder characteristics.

[0222] After evaluating the role of the excipient dose at a constant lipid content, the effect of reducing the lipid mass was evaluated. To reduce the total lipid content of the LNP, the N / P ratio (the ratio of ionizable lipid to mRNA) was decreased and / or the LNP composition was modified by increasing the molar percentage of the ionizable lipid.

[0223] The effect of reducing the lipid content on DPPs made with leucine alone or in combination with mannitol is shown in Figure 4. Due to the lower lipid content of the LNP, the yield of the dry powder was improved ( Figure 4A)。For example, 15 mg of leucine per mg of mRNA results in a yield of more than 30% for the dry powder manufactured using a modified lipid composition of LNP with N / P of 7 and DMG-PEG-2000:lipid 1:cholesterol:DOPE (5:50:30:15). However, for the dry powder manufactured using a conventional lipid composition of LNP with N / P of 7 and DMG-PEG-2000:lipid A:cholesterol:DOPE (5:40:25:30), a yield of less than 20% is obtained using the same amount of leucine. Similarly, for the DPP manufactured under a modified lipid composition of LNP with N / P of 7 and DMG-PEG-2000:lipid 1:cholesterol:DOPE (5:50:30:15), a yield of 50% is obtained using a combination of 1000 / 500 mg of mannitol / leucine. On the other hand, for a conventional lipid composition of LNP with N / P of 10 and DMG-PEG-2000:lipid 1:cholesterol:DOPE (5:40:25:30), a yield of approximately 30% is detected using the same amount of mannitol / leucine. Reducing the lipid mass by decreasing the N / P and modifying the composition may result in a lower melting degree and thus a lower tendency to adhere, which increases the yield. For most formulations prepared with a lower lipid mass, there is no significant difference in encapsulation efficiency ( Figure 4C ). The average particle size of all DP formulations is below 3 μm ( Figure 4D ). The experimental mRNA weight % increases slightly with the decrease in lipid mass ( Figure 4D ).

[0224] Although not shown here, the results obtained for the dry powder based on lipid 2 are similar to those obtained for lipid 1, where leucine alone or in combination with mannitol increases the yield and decreases the average particle size of the dry powder. In addition, increasing the mRNA weight percentage and yield by reducing the lipid mass results in no significant difference in encapsulation and the average particle size of the dry powder product.

[0225] Scanning electron microscopy (SEM) was used to visualize the DPP. The powder sample was sprayed onto a carbon adhesive tape mounted on the short column of the SEM. Excess powder was removed by blowing with clean compressed air. Before imaging, the powder sample was sputter-coated with approximately 11 nm of gold-palladium alloy in two cycles to avoid overheating.

[0226] Figures 5A - 5G Scanning electron microscopy (SEM) images of some representative dry powder products manufactured using lipid 1 are depicted in. Although not shown here, similar surface features were observed for the lipid 2 dry powder. The dry powder manufactured using mannitol alone showed large spherical aggregates ( Figure 5A ), while small raisin-like particles were obtained using leucine alone (Figure 5B )。These leucine-only particles exhibit a shrunken, collapsed appearance with significant porosity. The surface features are not significantly changed due to the reduced lipid content of the LNP of these particles. As Figure 5C and Figure 5D shown, raisin-like particles were obtained for both N / P 3 and the modified LNP composition, respectively. The dry powder particles obtained using the leucine-mannitol combination appeared smoother and more spherical ( Figure 5E ). The surfaces of these particles began to show slight indentations, shrinkage, and shallow depressions due to beam damage caused by prolonged exposure to the electron beam, as Figure 5F shown. Additionally, when cross-sections of the particles were taken, these particles appeared solid on the inside ( Figure 5G ). The spherical morphology of the mannitol / leucine combination DPP can be attributed to the higher excipient content and the presence of mannitol, which may provide a higher amount of matrix-forming material. Example 5: In vitro potency of dry powders formed with leucine and / or mannitol.

[0227] This example describes the in vitro potency of different mRNA encapsulations. It was observed that all formulations showed reasonable potency.

[0228] Twenty-four hours before using the dry powder transfection, HEK cells were plated at 0.5 x 10 6 cells / well in a 12-well plate. In the presence of leucine, mannitol, or both, cells were transfected with mRNA encapsulated in Lipids 1, 2, and 3 at different N / P ratios, and the expression of firefly luciferase (FFL) was observed. The dry powder samples were reconstituted in OPTIMEM medium at a 0.5 mg / ml mRNA concentration to generate a stock solution. The reconstituted dry powder was then diluted to the desired mRNA concentration and used to transfect HEK cells. Protein expression was measured using ELISA 24 hours later. Cells expressing mCherry mRNA were counted using FACS analysis. Figure 6A Summarizes the normalized relative light units of all formulations. It was observed that all categories showed potency. However, mRNA encapsulated in Lipid 3 showed lower potency when compared to other lipids.

[0229] In independent experiments, all DPPs formulated with FFL mRNA showed successful in vitro transfection. As Figure 6B shown, DPPs formulated with various combinations of excipients and different lipid contents showed luminescence in transfected HEK293 cells, with a good correlation between the dose and the expression of mCherry. Figure 6C and Figure 6DDose - response activity was shown, where both the number of cells showing the mCherry signal and the amount of mCherry protein expressed using this DPP increased with the increase in the amount of mRNA. These initial experiments showing no significant loss of mRNA integrity due to the spray - drying process and successful in vitro transfection demonstrated the feasibility of using this DPP for in vivo evaluation. Based on these promising results, several lead DPPs formulated with various combinations of excipients and lipids were selected for in vivo evaluation.

[0230] These experiments showing no decline in mRNA integrity due to the spray - drying process and in vitro transfection efficiency demonstrated the initial feasibility of DPP. Example 6: Evaluation of mRNA integrity.

[0231] This example describes the evaluation of the integrity of spray - dried mRNA formulations. It was observed that mRNA integrity was maintained.

[0232] Given the brief exposure of LNP to heat and stress during spray - drying, the integrity of mRNA after spray - drying was evaluated for DPP. As Figures 7A - 7B shown, compared with the control mRNA standard ([[]] Figure 7B ), the mRNA extracted from DPP ([[]] Figure 7A ) showed overlapping peaks, and there was no significant difference in mRNA integrity, as measured by capillary electrophoresis (CE). The mRNA encapsulated in Lipid 1 and Lipid 3 was subjected to gel filtration, and peak shape and elution volume were used to determine the integrity of mRNA. Figure 7A and Figure 7B summarize the mRNA elution curves.

[0233] It was observed that there was no change in mRNA integrity after spray - drying. Similar results were obtained for all FFL mRNA DPPs and mCherry DPPs used in Example 5. Example 7: In vivo potency of dry powders formed with leucine and / or mannitol.

[0234] This example describes the evaluation of the in vivo potency of dry powder formulations.

[0235] Dry powder (2 mg each) was administered intratracheally in 6 - 8 week - old CD - 1 male mice using a dry powder insufflator. Saline was used as a negative control for potency and inflammatory response, while LPS dissolved in saline was used as a positive control for TNF - α measurement. Saline and LPS solutions were administered intratracheally using a catheter. Twenty - four hours after intratracheal administration, 15 mg / mL D - luciferin was given to all animals via subcutaneous (SC) injection at 3 mg / animal (0.2 mL / animal). After euthanizing the animals, BALF was collected for inflammatory response, and the lungs and trachea were harvested in a petri dish for IVIS imaging.

[0236] As Figure 8A shown, all FFL dry powder products using Lipid 1 or Lipid 2 showed bioluminescence in the trachea and lungs of mice, indicating successful delivery of functional DPPs with the required average particle size (<4 μm) and sufficient deposition, sedimentation, and subsequent absorption in the lung parenchyma. The saline and lipopolysaccharide (LPS) controls did not show any bioluminescence. Overall, all dry powder products showed good bioluminescence distribution in the trachea and both lungs, fully indicating sufficient deposition, sedimentation, and subsequent absorption of the dry powder products in the lung parenchyma. Overall, the protein expression of Lipid 1 DPP increased significantly by using mannitol and leucine in combination (instead of using leucine alone) or by reducing the lipid content.

[0237] In addition, the lower solubility of leucine in hydroalcoholic solvents and its higher surface activity may lead to the formation of low - density corrugated dry powder product particles with improved aerosol properties. Figure 8B The average radiance of dry powder products of both Lipid 1 and Lipid 2 is shown. Generally, all dry powder products of ionizable Lipid 2 showed higher average radiance compared to the case of Lipid 1, which may be attributed to the higher intrinsic potency of ionizable Lipid 2. It was found that the potency of dry powder products of Lipid 1 was controlled by the LNP composition rather than the excipient, lipid content, and mRNA weight percentage. As an example, when manufactured using leucine alone, no significant difference in average radiance was detected at two different higher lipid A to mRNA weight ratios. Similarly, changes in LNP composition did not show any significant difference in the average radiance of the mannitol - leucine combination. On the other hand, the cumulative average radiance of two mannitol - leucine DPPs was higher (p - value 0.0224) compared to two leucine - based DPPs. For lipid A DPP, this higher expression of the mannitol - leucine combination can be attributed to its spherical morphology, better atomization, dispersibility, and deposition in lung tissue. Cumulatively, DPPs prepared using ionizable Lipid 2 LNP showed significantly higher average radiance (p - value 0.0082) compared to the case of Lipid 1, which may be attributed to the higher intrinsic activity of ionizable Lipid 2 compared to the case of Lipid 1 (Figure 8B and Figure 8C )。For lipid B DPP, no statistically significant difference in mean radiance was detected by changing the excipient or lipid amount, which may be attributed to the higher intrinsic activity (potency) of lipid 2. In summary, significant improvements in formulation characteristics and delivery efficiency were achieved when beneficial conditions were realized for mRNA LNP-DPP. Example 8: Evaluation of mRNA integrity under accelerated thermal stability at 25 °C

[0238] This example evaluated whether there was a thermal stability advantage associated with changing the formulation type by comparing the mRNA degradation curves between dry powder formulations and liquid formulations under accelerated thermal stability conditions. It was observed that the dry powder formulation had better mRNA integrity after storage at 25 °C for 4 weeks compared to the liquid formulation.

[0239] Briefly, a dry powder formulation containing LNP-encapsulated mRNA was prepared using mannitol and leucine as excipients as described previously. This dry powder formulation was stored at -80 °C for approximately one year and then used in this accelerated study. A liquid control formulation was prepared with the same mRNA using a composition similar to that of the dry powder formulation, but it was not spray-dried. This liquid LNP formulation was stored in a final buffer of 10% trehalose. Then both formulations were stored in an incubator at 25 °C, and the change in mRNA integrity % was analyzed weekly over a 4-week period.

[0240] As Figure 9 shown, the decrease in mRNA integrity % in the dry powder formulation after storage at 25 °C for 4 weeks was less than 10%, while the decrease in mRNA integrity % in the liquid control formulation after storage at 25 °C for 4 weeks exceeded 30%. These results indicate that the dry powder formulation maintains improved mRNA integrity compared to the liquid formulation under accelerated thermal stability conditions at 25 °C.

Claims

1. A dry powder formulation comprising messenger RNA (mRNA) encapsulated in lipid nanoparticles (LNP), wherein these LNPs comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids, wherein the dry powder formulation comprises leucine and mannitol in a weight ratio between 1:1 and 1:10, and wherein the dry powder formulation has an average particle size between 1 - 8 μm.

2. The dry powder formulation according to claim 1, wherein the weight ratio of leucine to mannitol is 1:

8.

3. The dry powder formulation according to claim 1, wherein the weight ratio of leucine to mannitol is 1:

4.

4. A dry powder formulation comprising messenger RNA (mRNA) encapsulated in lipid nanoparticles (LNP), wherein these LNPs comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids, wherein the dry powder formulation comprises hydrophobic amino acids at a concentration between 4% and 65%, and wherein the dry powder formulation has an average particle size between 1 - 8 μm.

5. The dry powder formulation according to claim 4, wherein the hydrophobic amino acid is leucine, isoleucine, trileucine, proleucine, glycine, valine, phenylalanine, methionine, proline or tryptophan.

6. The dry powder formulation according to claim 5, wherein the hydrophobic amino acid is leucine.

7. The dry powder formulation according to any one of claims 1 - 6, wherein these mRNA-encapsulating lipid nanoparticles have an N / P ratio between 2 and 6.

8. The dry powder formulation according to claim 7, wherein the N / P ratio is between 3 and 4.

9. The dry powder formulation according to claim 8, wherein the N / P ratio is 3.

10. The dry powder formulation according to any one of claims 1 - 9, wherein these LNPs further comprise one or more cholesterol-based lipids.

11. The dry powder formulation according to any one of claims 1 - 10, wherein, by mole%, the one or more cationic lipids account for about 30% - 70% of the total lipids in these LNPs.

12. The dry powder formulation according to any one of claims 1 - 11, wherein, by mole%, the one or more PEG-modified lipids account for about 1% - 15% of the total lipids in these LNPs.

13. The dry powder formulation according to any one of claims 1 - 12, wherein, by mole%, the one or more non-cationic lipids account for about 10% - 40% of the total lipids in these LNPs.

14. The dry powder formulation according to any one of claims 10 - 13, wherein, by mole%, the one or more cholesterol-based lipids account for about 5% - 40% of the total lipids in these LNPs.

15. The dry powder formulation according to any one of claims 10 - 14, wherein the molar ratio of the one or more cationic lipids to the one or more non-cationic lipids to the one or more cholesterol-based lipids to the one or more PEG-modified lipids in these LNPs is approximately 60:25:10:

5.

16. The dry powder formulation according to any one of claims 10 - 14, wherein the molar ratio of one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids in these LNPs is about 40:25:30:

5.

17. The dry powder formulation according to any one of claims 1 - 16, wherein the average particle size is between 1 - 5 μm.

18. The dry powder formulation according to any one of claims 1 - 17, wherein the average particle size is between 1 - 3 μm.

19. The dry powder formulation according to any one of claims 1 - 18, wherein, by weight, the mRNA accounts for more than 2% of the dry powder formulation.

20. The dry powder formulation according to any one of claims 1 - 19, wherein, by weight, the mRNA accounts for more than 3% of the dry powder formulation.

21. The dry powder formulation according to any one of claims 1 - 20, wherein, by weight, the mRNA accounts for more than 4% of the dry powder formulation.

22. The dry powder formulation according to any one of claims 1 - 21, wherein the encapsulation efficiency of these LNPs is greater than 60%.

23. The dry powder formulation according to any one of claims 1 - 22, wherein the encapsulation efficiency of these LNPs is greater than 70%.

24. The dry powder formulation according to any one of claims 1 - 23, wherein the encapsulation efficiency of these LNPs is greater than 80%.

25. The dry powder formulation according to any one of claims 1 - 24, wherein the mRNA maintains 80% or greater integrity after spray drying.

26. The dry powder formulation according to any one of claims 1 - 25, wherein the mRNA maintains 90% or greater integrity after spray drying.

27. The dry powder formulation according to any one of claims 1 - 26, wherein the mRNA maintains 95% or greater integrity after spray drying.

28. The dry powder formulation according to any one of claims 1 - 27, wherein the mRNA maintains 80% or greater integrity after storage at room temperature for 6 months or longer.

29. The dry powder formulation according to any one of claims 1 - 28, wherein the mRNA maintains 90% or greater integrity after storage at room temperature for 6 months or longer.

30. The dry powder formulation according to any one of claims 1 - 29, wherein the mRNA maintains 80% or greater integrity after storage at 4°C for 6 months or longer.

31. The dry powder formulation according to any one of claims 1 - 30, wherein the mRNA maintains 90% or greater integrity after storage at 4°C for 6 months or longer.

32. The dry powder formulation according to any one of claims 1 - 31, wherein the mRNA maintains 80% or greater integrity after storage at 25°C for 4 weeks or longer.

33. The dry powder formulation according to any one of claims 1 - 32, wherein the mRNA maintains 90% or greater integrity after storage at 25°C for 4 weeks or longer.

34. The dry powder formulation according to any one of claims 1-33, wherein the mRNA maintains an integrity of 95% or greater after storage at 25 °C for 4 weeks or longer.

35. The dry powder formulation according to any one of claims 1-34, wherein the dry powder formulation has a water content of less than 0.5%.

36. The dry powder formulation according to any one of claims 1-35, wherein the dry powder formulation has a water content of less than 0.1%.

37. The dry powder formulation according to any one of claims 1-36, wherein the mRNA encodes a therapeutic protein.

38. The dry powder formulation according to any one of claims 1-37, wherein the mRNA encodes an antigen.

39. The dry powder formulation according to any one of claims 1-38, wherein the mRNA encodes a vaccine.

40. The dry powder formulation according to any one of claims 1-39, wherein the dry powder formulation is inhalable.

41. The dry powder formulation according to any one of claims 1-40, wherein the dry powder formulation is nebulizable after reconstitution.

42. A method for in vivo delivery of mRNA, the method comprising administering to a subject in need thereof a dry powder formulation according to any one of claims 1-41.

43. A method for treating a disease or disorder in a patient, the method being by administering to the patient a dry powder formulation according to any one of claims 1-41.

44. The method according to claim 42 or 43, wherein the dry powder formulation is administered by inhalation.

45. The method according to claim 42 or 43, wherein the dry powder formulation is administered by intranasal spray.

46. The method according to claim 42 or 43, wherein the dry powder formulation is administered by an inhaler.

47. A method for preparing a dry powder formulation, the method comprising: a) providing a mixture comprising lipid nanoparticles encapsulating mRNA, b) adding leucine and mannitol to the mixture at a weight ratio between 1:1 and 1:10, c) spray drying the mixture, and d) obtaining the dry powder formulation having an average particle size between 1-8 μm, and wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids.

48. The method according to claim 47, wherein the weight ratio of leucine to mannitol is 1:

8.

49. The method according to claim 47, wherein the weight ratio of leucine to mannitol is 1:

4.

50. A method for preparing a dry powder formulation, the method comprising: a) providing a mixture comprising lipid nanoparticles (LNP) encapsulating mRNA, b) adding a hydrophobic amino acid to the mixture at a concentration between 4.0% and 65%, c) spray drying the mixture, and d) obtaining the dry powder formulation having an average particle size between 1-8 μm, and wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids.

51. The method according to claim 50, wherein the hydrophobic amino acid is leucine, isoleucine, trileucine, proleucine, glycine, valine, phenylalanine, methionine, proline or tryptophan.

52. The method according to claim 51, wherein the hydrophobic amino acid is leucine.

53. The method according to any one of claims 47 - 52, wherein the method further comprises the step of adding 20% ethanol to the mixture.

54. The method according to any one of claims 47 - 53, wherein the spray drying step occurs at a temperature less than 90°C.

55. The method according to any one of claims 47 - 54, wherein the spray drying step occurs at a temperature between 20°C and 70°C.

56. The method according to any one of claims 47 - 55, wherein the LNPs encapsulating the mRNA have an N / P ratio between 2 and 6.

57. The method according to any one of claims 47 - 56, wherein the N / P ratio is between 3 and 4.

58. The method according to any one of claims 47 - 57, wherein the N / P ratio is 3.

59. The method according to any one of claims 47 - 58, wherein the LNPs further comprise one or more cholesterol - based lipids.

60. The method according to any one of claims 47 - 59, wherein, on a molar percentage basis, the one or more cationic lipids account for about 30% - 70% of the total lipids in the LNP.

61. The method according to any one of claims 47 - 60, wherein, on a molar percentage basis, the one or more PEG - modified lipids account for about 1% - 15% of the total lipids in the LNP.

62. The method according to any one of claims 47 - 61, wherein, on a molar percentage basis, the one or more non - cationic lipids account for about 10% - 40% of the total lipids in the LNP.

63. The method according to any one of claims 59 - 62, wherein, on a molar percentage basis, the one or more cholesterol - based lipids account for about 5% - 40% of the total lipids in the LNP.

64. The method according to any one of claims 59 - 63, wherein the molar ratio of the one or more cationic lipids to the one or more non - cationic lipids to the one or more cholesterol - based lipids to the one or more PEG - modified lipids in the lipid nanoparticles is approximately 60:25:10:

5.

65. The method according to any one of claims 59 - 63, wherein the molar ratio of the one or more cationic lipids to the one or more non - cationic lipids to the one or more cholesterol - based lipids to the one or more PEG - modified lipids in the lipid nanoparticles is approximately 40:25:30:

5.

66. The method according to any one of claims 47 - 65, wherein the average particle size is between 1 - 5 μm.

67. The method according to any one of claims 47 - 66, wherein the average particle size is between 1 - 3 μm.

68. The method according to any one of claims 47 - 67, wherein, by weight, the mRNA accounts for more than 2% of the dry powder formulation.

69. The method according to any one of claims 47 - 68, wherein the mRNA accounts for more than 3% by weight of the dry powder formulation.

70. The method according to any one of claims 47 - 69, wherein the mRNA accounts for more than 4% by weight of the dry powder formulation.

71. The method according to any one of claims 47 - 70, wherein the encapsulation rate of these LNPs is greater than 60%.

72. The method according to any one of claims 47 - 71, wherein the encapsulation rate of these LNPs is greater than 70%.

73. The method according to any one of claims 47 - 72, wherein the encapsulation rate of these LNPs is greater than 80%.

74. The method according to any one of claims 47 - 73, wherein the mRNA maintains an integrity of 80% or greater after spray drying.

75. The method according to any one of claims 47 - 74, wherein the mRNA maintains an integrity of 90% or greater after spray drying.

76. The method according to any one of claims 47 - 75, wherein the mRNA maintains an integrity of 95% or greater after spray drying.

77. The method according to any one of claims 47 - 76, wherein the mRNA maintains an integrity of 80% or greater after storage at room temperature for 6 months or longer.

78. The method according to any one of claims 47 - 77, wherein the mRNA maintains an integrity of 90% or greater after storage at room temperature for 6 months or longer.

79. The method according to any one of claims 47 - 78, wherein the mRNA maintains an integrity of 80% or greater after storage at 4°C for 6 months or longer.

80. The method according to any one of claims 47 - 79, wherein the mRNA maintains an integrity of 90% or greater after storage at 4°C for 6 months or longer.

81. The method according to any one of claims 47 - 80, wherein the mRNA maintains an integrity of 80% or greater after storage at 25°C for 4 weeks or longer.

82. The method according to any one of claims 47 - 81, wherein the mRNA maintains an integrity of 90% or greater after storage at 25°C for 4 weeks or longer.

83. The method according to any one of claims 47 - 82, wherein the mRNA maintains an integrity of 95% or greater after storage at 25°C for 4 weeks or longer.

84. The method according to any one of claims 47 - 83, wherein the dry powder formulation has a water content of less than 0.5%.

85. The method according to any one of claims 47 - 84, wherein the dry powder formulation has a water content of less than 0.1%.

86. The method according to any one of claims 47 - 85, wherein the mRNA encodes a therapeutic protein.

87. The method according to any one of claims 47 - 86, wherein the mRNA encodes an antigen.

88. The method according to any one of claims 47 - 87, wherein the mRNA encodes a vaccine.

89. The method according to any one of claims 47 - 88, wherein the dry powder formulation is inhalable.

90. The method according to any one of claims 47 - 89, wherein the dry powder formulation is nebulizable after reconstitution.

Images