Breeding method of restorer line with photosensitive characteristic and new rice variety

Abstract

The invention relates to a breeding method of a restorer line with a photosensitive characteristic and a new rice variety. The method comprises the following steps in sequence: (1) performing hybridization by a warm soup castration method to obtain rice seeds, (2) performing primary screening to obtain fragrant rice single plants, and (3) performing variety screening which comprises disease resistance screening, rice quality screening, determination of crop dimension adaptability and photosensitive characteristics and variety screening suitable for a rice and fish planting and breeding mode. The method also comprises the following steps: transforming a crop material for fragrant and disease-resistant strains which do not carry dominant E1 (Ghd7) allelic genes in the steps (2) and (3) by utilizing a CRISPR / Cas9 gene editing technology, and finally obtaining a material carrying the growth period gene Ghd7. The breeding method disclosed by the invention is expected to screen out three-line restorer rice varieties which have the advantages of rice blast resistance, aroma type, excellent rice quality, strong combining ability and sensitive hybrid progeny expression at the same time.

Description

Technical Field

[0001] The present invention relates to a breeding method for a photosensitive characteristic restorer line and a new rice variety, and is applied in the field of cultivating excellent rice varieties. Background Art

[0002] The development of hybrid rice plays a crucial role in promoting grain yield increase and ensuring food security. Due to the existence of the heterosis effect, hybrid rice varieties sometimes show the phenomenon of being later-maturing than their parents. Appropriately extending the growth period (or heading date) can effectively promote the yield of hybrids without affecting crop rotation. However, excessive later-maturing than the parents reduces the wide adaptability of the variety, which becomes one of the obstacles in the breeding of hybrid varieties. The heading date (HD) of rice is jointly determined by three factors: basic vegetative growth, photosensitivity, and thermosensitivity. Among them, photosensitivity is an important indicator reflecting the regional and seasonal adaptability of rice varieties. Early studies have shown that the photosensitivity of rice is regulated by complex genetics, including major photosensitive genes E1, Se-1 and minor photosensitive genes Hd2, Hd5, and Hd9, etc. Most of the functional genes at these photosensitive gene loci have been cloned and studied in depth, including the Ghd7 gene at the E1 locus, the Hd1 gene at the Se-1 locus, Ghd7.1 / DTH7 at the Hd2 locus, DTH8 / Ghd8 at the Hd5 locus, and OsMADS50 at the Hd9 locus. Different haplotypes of photosensitive genes exist in nature, and the combination of these haplotypes causes rich changes in photosensitivity, so that rice varieties show changes in heading date under different photoperiod environments. Different combinations of Ghd7, DTH8, and Hd1 are significantly correlated with the heading date and yield of rice varieties under different photoperiod conditions, and are therefore considered to be key photosensitive genes.

[0003] The latitude adaptability of crops is closely related to the yield of crops. Research shows that there is a positive correlation between the length of the growth period and the yield of crop varieties. Therefore, only varieties with good latitude adaptability can ensure stable and high yields of crops. Too short a growth period will cause crop yield reduction, and too long a growth period will be unfavorable for crop fruiting due to too low temperature in the later stage.

[0004] China has a long history and wide distribution of rice-field fish culture, but it is mainly distributed in the southern hilly mountainous areas, including most areas of Sichuan, Guizhou, and Yunnan in the southwest region, the west and south of Hunan in the central region, Guangxi Zhuang Autonomous Region in the south region, and the southwest of Zhejiang and northwest of Fujian in the east region. The integrated rice-fish farming industry in China is booming, with the industrial scale continuously expanding, the quality and efficiency of industrial development improving simultaneously, new business forms and models emerging continuously, the degree of scale and organization increasing continuously, the level of standardized and standardized production improving, the multi-functional expansion and the value of new elements becoming increasingly prominent, and the pace of brandization, industrialization, and regionalization development accelerating.

[0005] At present, the rice varieties used in the rice-fish farming mode in Fujian Province for production are mainly ordinary rice, and deep-water rice varieties suitable for the rice-fish farming mode have not been developed. Therefore, it is necessary to invent a method for precisely cultivating deep-water rice varieties suitable for the rice-fish farming mode, which not only helps the development of the rice-fish industry but also ensures food security, and is of great significance. Research has found that photosensitive rice varieties have the characteristics of a long growth period and tall plants, which play a protective role in preventing fry from being eaten by birds; at the same time, they have the characteristic of high yield, which is conducive to the development of the integrated rice-fish farming mode, thus ensuring national food security. Summary of the Invention

[0006] In order to precisely select and breed restorer lines with photosensitive characteristics and formulate new photosensitive rice varieties, and overcome the disadvantages of the existing rice-fish rice varieties with short growth periods and poor protection for fry, the present invention provides a method for selecting and breeding restorer lines with photosensitive characteristics and new rice varieties. Through the screening of blast resistance, the screening of rice quality, the determination of crop latitude adaptability and photosensitive characteristics, and the screening of varieties suitable for the rice-fish farming mode in sequence, the selected rice varieties can simultaneously have the advantages of photosensitivity, blast resistance, and good rice quality, and are simultaneously applied to the integrated rice-fish farming mode for planting.

[0007] The object of the present invention is achieved through the following technical solutions:

[0008] A method for selecting and breeding restorer lines with photosensitive characteristics and new rice varieties, comprising the following steps carried out in sequence:

[0009] (1) Hybridization by the warm water emasculation method: Using Minglun Zhenzhan, the winner of the Gold Award for the Appraisal of High-quality Rice in China, as the female parent P1, and Fuhui 2165, a high-quality disease-resistant restorer line, as the male parent P2, hybridize by the warm water emasculation method to obtain rice seeds;

[0010] (2) Preliminary screening to obtain fragrant rice single plants: Soak the seeds of the rice plants obtained in the previous step for germination and then sow them. Backcross with the female parent P1 variety. After harvesting the seeds and planting them, use Indel markers to screen the fragrant E7 genotype, and select the rice single plants containing fragrance among them;

[0011] At the same time, use SNP markers to detect the Ghd7-0 recessive mutant, and select rice single plants that contain both fragrance and carry the dominant E1(Ghd7) allele, have long grains, short and straight flag leaves, and a plant height not exceeding 110 cm, and self-cross again to harvest the seeds of this rice plant;

[0012] (3) Variety screening: The variety screening includes the following steps carried out in sequence:

[0013] ① Disease resistance screening: Sow the seeds of the rice plants obtained in the previous step by strain in multiple severely rice blast-affected areas (such as Chadi Town, Shanghang County, Fujian Province; Mashazhen, Jianyang District, Fujian Province, etc.) for natural induction identification of rice blast. Using the male parent P2 variety as a control, eliminate the susceptible strains, and screen out rice strains resistant to rice blast and containing fragrance. Self-cross them to obtain rice plants resistant to rice blast and containing fragrance.

[0014] ② Grain quality screening: Self-cross the rice plants resistant to disease, with fragrance, and carrying the dominant E1 (Ghd7) allele obtained in the previous step, harvest the seeds and sow them to obtain multiple rice strains. Plant the seeds of each strain into a population, perform group isolation self-crossing and within-group mixed harvesting on each of them respectively to obtain the seeds of each group. Screen out and eliminate the groups whose grain quality does not meet the national third-class or above high-quality rice standard through grain quality analysis, and obtain groups with excellent grain quality, that is, rice mixed-harvesting strains.

[0015] After the screening in the above steps ① - ② is completed, steps ① - ② can be repeated cyclically at least 4 times to obtain a rice variety resistant to disease, with fragrance, and carrying the dominant E1 (Ghd7) allele.

[0016] The national third-class high-quality rice standard is the NY / T 593 - 2021 "Quality of Edible Rice Varieties" standard.

[0017] ③ Determination of crop dimension adaptability and light sensitivity characteristics: After the screening in the above steps ① - ② is completed, plant the obtained rice variety population, select different types of three-line rice male sterile lines (such as wild abortive type, Honglian type, Baotai type) of rice (such as 171A, Qiyuan A, Pinxiang A, etc.) for test crossing, and harvest the hybrid seeds; plant the hybrid F1 and conduct variety inspection and grain quality screening; at the same time, through the evaluation system for predicting the accuracy of the crop day-length recognition simulator, use field data to quantitatively evaluate the prediction accuracy, and screen out the hybrids with long growth periods and the corresponding restorer lines.

[0018] Among them, the method of variety inspection is: Plant the hybrid F1, plant 100 plants for each hybrid F1, with a plant spacing of 20 cm × 20 cm. Randomly select 5 single plants at maturity, measure the plant height, effective panicles, panicle length, total number of grains per panicle, number of filled grains per panicle, 1000-grain weight, seed setting rate, and harvest and air-dry and weigh all the single plants in the plot. Conduct grain quality detection on the harvested paddy; the standard grading for grain quality screening follows the NY / T 593 - 2021 "Quality of Edible Rice Varieties" standard.

[0019] The Crop Daylength Recognition Simulator was constructed by Xiamen University. The Crop Daylength Recognition Simulator is the Environment Adaptation Simulator Based on Crop Daylength Recognition (DEAS). The related paper was published in the journal Nature Food in May 2021. The title of the paper is "Forecasting of Rice Latitude Adaptation through a D aylength-sensing-based E nvironment A daptation S imulator". At the same time, the related patent is also under application. DEAS can predict the photosensitivity of rice.

[0020] ④ Variety screening for suitable rice-fish farming models: The restorer line and sterile line (such as Pinxiang A, Qingxiang A, Fanyuan A, etc.) screened in step ③ above are used for small-area seed production. The hybrid F1 is used for variety screening for suitable rice-fish farming models at multiple sites in different regions (such as Sanming City and Nanping City in Fujian Province), and high-quality rice varieties resistant to rice blast, with good grain quality and photosensitivity suitable for rice-fish farming models are screened out.

[0021] Among them, the specific operation of the hot water emasculation method in step (1) is as follows: Move the plants with rice panicles that have bloomed 1 / 4 out of the paddy field, use scissors to trim off the bloomed grains, soak the trimmed rice panicles in warm water at 45 °C for 5 minutes, take out the rice panicles, wrap the rice panicles with plastic film until the glumes of the grains on the rice panicles open, use scissors to trim off the grains with unopened glumes, and use scissors to cut off half of the glumes of the grains with opened glumes. After trimming, use a hybridization bag for bagging.

[0022] The Indel marker sequence for screening the fragrance E7 genotype using Indel markers in step (2) is: frg-E7-F: GCCGGTGCTCCTTTGTCATCAC (SEQ ID NO.1), frg-E7-R: CAAACCTTAACCATAGGAG (SEQ ID NO.2), band size: 194 (non-fragrant type) / 186 (fragrant type).

[0023] The PCR amplification system and PCR reaction program involved in screening the fragrance E7 genotype using Indel markers in step (2) are as follows:

[0024] The selected primer sequences frg-E7-F and frg-E7-R were synthesized by Fuzhou Shangya Biotechnology Co., Ltd., and PCR was performed on a BIO-RAD gene amplifier. The composition of the 10 μL PCR system is as follows: 5 μL of 2× Taq Plus Master MixⅡ (Dye Plus), produced by Nanjing Novoprotein Scientific Inc., 0.5 μL each of the forward primer frg-E7-F and the reverse primer frg-E7-R at 2 μmol / L, 1 μL of 100 ng template DNA, and 3 μL of ddH2O.

[0025] The PCR reaction procedure is as follows: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 45 s, annealing at 55 °C for 45 s, extension at 72 °C for 45 min; a total of 35 cycles; extension at 72 °C for 7 min; and finally, low-temperature preservation at 4 °C for 10 min.

[0026] Subsequently, the PCR products were electrophoresed on a 6% polyacrylamide gel, stained with the nucleic acid dye Ultra GelRed (10,000×) produced by Nanjing Novoprotein Scientific Inc., and photographed and saved under ultraviolet light using a BIORAD Molecular Imager gel imager.

[0027] When detecting the Ghd7-0 recessive mutant using SNP markers in step (2), the SNP locus of the target gene Ghd7 of the rice variety was genotyped using the KASP marker standard method to distinguish normal functional and premature termination mutants (Ghd7-0).

[0028] The specific primer sequences designed for the KASP marker standard method are as follows:

[0029] PrimerX: gaaggtgaccaagttcatgctCGGCGCCACCGGTGCACG (mutant type G forward primer) (SEQ ID NO.3),

[0030] PrimerY: gaaggtcggagtcaacggattCGGCGCCACCGGTGCACT (mutant type T forward primer) (SEQ ID NO.4),

[0031] PrimerC: GCCGCCGTCGTTGCCGAAGAA (universal reverse primer) (SEQ ID NO.5).

[0032] Note: The lowercase part of the primer sequence is the universal primer part. The uppercase part is the specific primer.

[0033] The sequence of the target gene Ghd7 is as follows:

[0034] Sequence (mutation site / ):

[0035] cgatgatgatggattccccttcgtcttcccgccgagtgcgtgccaggggatcggcgccccggcgccaccggtgca c(G / T)agttccagttcttcggcaacgacggcggcggcgacgacggcgagagcgtggcctggctgttcgatgactacc cgccgccgtcg

[0036] The mutant-specific KASP marker was designed by the Rice Research Institute of Fujian Academy of Agricultural Sciences. The specific primer sequences are PrimerX, PrimerY, and PrimerC. These primers can distinguish the G / T mutation at the 157th base of Ghd7. The mutant Ghd7-0(T) causes the 53rd amino acid of Ghd7 to mutate from E to a stop codon, resulting in premature termination and thus loss of protein function, leading to early heading.

[0037] The PCR amplification system and PCR reaction program used in the standard KASP marker method are as follows:

[0038] The PCR reaction is carried out in a PCR thermal cycler (384-well plate). Each PCR reaction system is 5.0 μL, containing 2.0 μL of DNA with a concentration of 50 ng / μL, 2.5 μL of 2×KASPMasterMix (containing FAM and HEX universal mixed fluorescent primers), and 0.05 μL of the specific primer mixture, supplemented to 5 μL with ddH2O. Among them, in the specific primer mixture, the concentrations of the upstream primers PrimerX and PrimerY are both 12 μmol / L, and the concentration of the common downstream primer PrimerC is 30 μmol / L. The reaction is carried out on an ABIQuantStudio6Flex and the fluorescence values are automatically read, and genotyping is performed using the supporting software;

[0039] The PCR reaction program is as follows:

[0040]

[0041] The breeding method of the photosensitive restorer line and new rice variety with restored photosensitivity characteristics also includes, for the lines in steps (2) and (3) that do not carry the dominant E1 (Ghd7) allele and contain fragrance and disease resistance, using the CRISPR / Cas9 gene editing technology to transform crop materials. Finally, materials carrying the growth period gene Ghd7 are obtained. These materials can be used as parents for the corresponding steps.

[0042] Preferably, a base editor (BE) or a prime editing system (PE) is used to mutate the 157th base T of Ghd7-0 into a non-T base, so that the non-functional premature termination mutant of Ghd7-0 can be transformed into a functional Ghd7.

[0043] The base editor (BE) is an ABE base editor, which realizes the conversion from A to G;

[0044] Among them, when using the ABE base editor for gene editing, it is constructed by using the improved vector hyABE8e-SpRYm of the plant adenine base editing system (DOI: 10.1111 / pbi.13774), and the target is (The bold part is the 20bp target sequence inserted into the vector, the base A to be mutated is marked in red, and the underline represents the PAM recognition site);

[0045] The primer sequences used in the preparation of the PCR ligation product are:

[0046] ABE-F:

[0047] AATAATGGTCTCAGGCGACTAGTGCACCGGTGGCGCCGTTTTAGAGCTAGA AATAGC (SEQ ID NO.6),

[0048] ABE-R:

[0049] ATTATTGGTCTCTAAACGGCGCCACCGGTGCACTAGTGCTTCTTGGTGCC (SEQ ID NO.7).

[0050] When using the prime editing system (PE) for gene editing, the plant PE vector is constructed using the vector system dual-pegRNA (DOI: 10.1038 / s41587-022-01254-w), and the universal template is amplified with the following primers and then ligated into the pH-ePPE vector.

[0051] The primers are as follows:

[0052]

[0053] The present invention also provides a method for quickly obtaining a rice variety carrying the dominant E1 (Ghd7) allele. For the lines that do not carry the dominant E1 (Ghd7) allele and contain fragrance and disease resistance, the CRISPR / Cas9 gene editing technology is used to transform the crop materials. Finally, the materials carrying the growth period gene Ghd7 are obtained;

[0054] Among them, the CRISPR / Cas9 gene editing technology is a base editor (BE) or a prime editing system (PE);

[0055] The base editor (BE) is an ABE base editor, which realizes the conversion from A to G;

[0056] Among them, when using the ABE base editor for gene editing, it is constructed by using the improved vector hyABE8e-SpRYm of the plant adenine base editing system (DOI: 10.1111 / pbi.13774), and the target is ACTAGTGCACCGGTGGCGCC GGG (The bold part is the 20bp target sequence inserted into the vector, the base A to be mutated is marked in red, and the underline represents the PAM recognition site);

[0057] The primer sequences used in the preparation of the PCR ligation product are as follows:

[0058] ABE-F:

[0059] AATAATGGTCTCAGGCGACTAGTGCACCGGTGGCGCCGTTTTAGAGCTAGA AATAGC,

[0060] ABE-R:

[0061] ATTATTGGTCTCTAAACGGCGCCACCGGTGCACTAGTGCTTCTTGGTGCC.

[0062] Compared with the prior art, the advantages of the present invention are as follows:

[0063] 1) The breeding method of a photosensitive characteristic restorer line and a new variety in this application can screen out three-line restorer line rice varieties that simultaneously have blast resistance, fragrance, excellent rice quality, strong combining ability, and photosensitivity in the offspring of hybrids by selecting the female parent and the male parent, and using the screening steps of blast resistance, fragrance, and rice quality in sequence, and cooperating with the determination of crop dimension adaptability and photosensitive characteristics and the determination of combining ability;

[0064] 2) By combining the use of specific Indel primers to screen for fragrance genes and using SNP markers to detect Ghd7-0 recessive mutants, and selecting the agronomic traits such as grain type and plant leaf type that contain both fragrance and carry the dominant E1 (Ghd7) allele, a better-quality three-line restorer line rice variety can be obtained. Description of the Drawings

[0065] Figure 1 It is the gel electrophoresis diagram of the detection of the fragrance E7 genotype in the embodiment of the present invention. Among them, 1: P1, 2: Fuhui 2165; 3-36: individual plants in the population

[0066] Figure 2 It is a sequence alignment diagram of the Ghd7 gene mutation.

[0067] Figure 3 It is a detection result diagram of the KASP marker method.

[0068] Figure 4 It is a vector structure diagram obtained when using the ABE base editor for gene editing.

[0069] Figure 5 It is a comparison diagram of the ABE-mutated plant and the parental plant. Among them, the single plant on the left is the ABE-mutated plant, and the single plant on the right is the control parent. Detailed implementation mode

[0070] The female parent P1 selected for the breeding method of a photosensitive characteristic restorer line provided by the present invention is Minglun Zhenzhan, the gold medal variety in the national high-quality rice evaluation. It is a high-quality hybrid rice restorer line obtained by crossing a triple dominant genic male sterile plant and Ming 1101 and selecting through pedigree method for multiple generations. It was approved by the Fujian Crop Variety Approval Committee in 2019 (Approval No. Min Shen Dao 20190040). The male parent P2 used in this application is Fuhui 2165, which is a high-quality and blast-resistant restorer line.

[0071] The preferred female parent and male parent of the breeding method of a photosensitive characteristic restorer line and a new rice variety of the present invention. First, obtain single plants with the characteristics of high-quality rice, fragrance, and carrying the dominant E1 (Ghd7) allele of the female parent Minglun Zhenzhan; then, variety screening: ① Disease resistance screening: Conduct blast screening in the severely diseased area of blast, and combine with the use of specific Indel primers to screen for fragrance and plants with strong fragrance of the female parent in the field chewing. Select blast-resistant and fragrant plant lines, and can quickly screen for fragrant plant lines while obtaining disease-resistant plant lines; ② Grain quality screening: Select plant lines with high-quality grain through grain quality analysis; ③ Determination of crop dimension adaptability and photosensitive characteristics, and screen plant lines with good restoring ability, strong combining ability and photosensitive characteristics in the hybrid F1; ④ Variety screening suitable for the rice-fish farming mode: Conduct combining ability determination, and through cross-breeding with different types of sterile lines, conduct adaptive planting of rice-fish farming in many places such as Fujian Province, and screen hybrid rice varieties suitable for the rice-fish farming mode. After the above multiple screening steps are carried out in sequence, finally obtain a rice restorer line and a new variety with blast resistance, high-quality grain, photosensitive performance in the hybrid F1 and suitable for rice-fish farming.

[0072] In variety screening, after the screening in steps ① - ② is completed and then cyclically repeated for at least 4 rounds of screening, a restorer line rice variety with disease resistance, stable fragrance, and carrying the dominant photosensitive gene E1 (Ghd7) is obtained. By repeatedly and sequentially repeating the identification steps for blast resistance, fragrance, and rice quality multiple times, finally, a more excellent and stable three-line restorer line rice variety with high quality, blast resistance, stable fragrance, and carrying the dominant photosensitive gene E1 (Ghd7) can be obtained. Through step ④, a hybrid rice variety with photosensitivity, excellent rice quality, blast resistance, and suitable for the rice-fish farming mode can be obtained.

[0073] In step ① of blast resistance screening in variety screening, the obtained rice plants with blast resistance and containing fragrance genes can be propagated and advanced in Hainan; in step ② of rice quality screening, the obtained rice plants with excellent rice quality can be propagated and advanced in Hainan. Propagating and advancing in Hainan can greatly shorten the breeding time.

[0074] In step ③ of the determination of crop dimension adaptability and photosensitive characteristics, after screening out rice single plants with blast resistance, fragrance, and carrying the dominant photosensitive gene E1 (Ghd7), further screen out rice single plants with good appearance quality of rice grains, short and straight flag leaves, and plant height not exceeding 110 cm, and conduct test crosses with different types of three-line male sterile lines of rice, such as 171A, Qiyuan A, and Pinxiang A. Through the evaluation system for predicting the accuracy of the crop day-length recognition simulator, use field data to quantitatively evaluate the accuracy of the prediction, and screen out hybrids and corresponding restorer lines with good plant leaf morphology, high seed setting rate, excellent rice quality, and photosensitivity; through the determination of combining ability, screen out rice lines with restoring genes and good combining ability. Step ② of rice quality analysis and screening includes the following steps carried out in sequence:

[0075] 1) Process the seeds of each population into polished rice, select the polished rice with good appearance quality of rice grains and transparent without ventral white for rice quality testing, so as to screen out the rice mixed-harvesting lines with polished rice having the above characteristics and high head rice rate; at the same time, entrust a third party to measure the fragrance value.

[0076] 2) Taking the female parent P1 variety as a control, cook the polished rice of the rice mixed-harvesting lines screened in step 1) above and the polished rice of the control variety female parent P1 respectively according to the weight ratio of polished rice: water of 1:1.2 - 1.4, and select the polished rice with good palatability and good appearance quality of the cooked rice, so as to screen out the rice mixed-harvesting lines with polished rice having the above characteristics.

[0077] Eliminate the populations whose quality fails to meet the national third-class or above high-quality rice standards through rice quality analysis and screening, and obtain a population with excellent rice quality, namely the rice mixed-harvesting lines; the national third-class high-quality rice standard is the NY / T593 - 2021 "Quality of Edible Rice Varieties" standard.

[0078] The following will describe the content of the present invention in detail with reference to the accompanying drawings of the specification and embodiments:

[0079] Example 1 A method for breeding a photosensitive characteristic restoration line and a new rice variety according to the present invention includes the following steps carried out in sequence:

[0080] (1) Hybridization by warm water emasculation method: Using Minglunzhenzhan as female parent P1 and Fuhui 2165 as male parent P2, hybridize by warm water emasculation method to obtain rice seeds;

[0081] (2) Preliminary screening of fragrant rice single plants: Soak and germinate the seeds of the rice plants obtained in the previous step and then sow them. Backcross with the female parent P1 variety to harvest seeds. After planting the harvested seeds, use Indel markers to select rice single plants containing the fragrant E7 genotype, and at the same time use SNP markers to detect the Ghd7-0 recessive mutant. Select rice single plants that contain fragrance and carry the dominant E1(Ghd7) allele, have long grains, short and straight flag leaves, and plant height not exceeding 110 cm, and self-cross again to harvest the seeds of this rice plant;

[0082] (3) Variety screening: The variety screening includes the following steps carried out in sequence:

[0083] ① Disease resistance screening: Sow the seeds of the rice plants obtained in the previous step by strain in heavily rice blast disease areas such as Chadi Town, Shanghang County, Fujian Province and Mashazhen, Jianyang District, Fujian Province for natural induction identification of rice blast. Using the male parent P2 variety as a control, eliminate the susceptible strains, and screen out rice strains resistant to rice blast and fragrant, and self-cross to obtain rice plants resistant to rice blast and fragrant;

[0084] ② Grain quality screening: Self-cross the rice plants containing the fragrance gene obtained in the previous step, harvest the seeds and sow the seeds to obtain multiple rice strains. Plant the seeds of each strain into a population, carry out population isolation self-crossing and within-population mixed harvesting for each of them respectively to obtain the seeds of each population. Screen out and eliminate the populations whose quality does not meet the third-class high-quality rice standard of the Ministry of Agriculture through grain quality analysis to obtain populations with excellent grain quality, that is, rice mixed-harvesting strains;

[0085] After the screening in the above steps ①-② is completed, repeat steps ①-② at least 4 rounds of screening to obtain a rice variety resistant to diseases and containing the fragrance gene.

[0086] ③ Determination of crop dimension adaptability and photosensitivity characteristics: Plant the rice variety planting population obtained after the screening in the above steps ① - ②, select different types of three - line male - sterile lines of rice (the selected three - line male - sterile lines of rice include 171A, Qiyuan A, and Pinxiang A) for cross - matching, and harvest the hybrid seeds; plant the hybrid F1, and conduct variety evaluation and rice quality screening; at the same time, through the evaluation system for predicting the accuracy of the crop day - length recognition simulator constructed by Xiamen University, use field data to quantitatively evaluate the prediction accuracy, and screen out hybrids and corresponding restorer lines with good plant leaf morphology, high seed - setting rate, excellent rice quality, and photosensitivity;

[0087] Among them, the method of variety evaluation is as follows: Plant the hybrid F1, plant 100 plants of each hybrid F1, with a row spacing of 20 cm × 20 cm. At the maturity stage, randomly select 5 single plants, measure plant height, effective panicles, panicle length, total number of grains per panicle, number of filled grains per panicle, 1000 - grain weight, and seed - setting rate, and harvest and air - dry all single plants in the plot for weighing. The harvested paddy is subjected to rice quality detection; the standard grading for rice quality screening is in accordance with the standard of NY / T 593 - 2021 "Quality of Edible Rice Varieties".

[0088] ④ Screening of varieties suitable for the rice - fish farming model: Use the restorer line obtained after the screening in the above step ③ and the male - sterile line Pinxiang A for small - area seed production. The hybrid F1 is screened for varieties suitable for the rice - fish farming model at multiple locations such as Sanming City and Nanping City in Fujian Province, and high - quality rice varieties resistant to rice blast, with excellent rice quality, and photosensitivity are screened out.

[0089] In the variety screening of step (3), in step ③, the evaluation of the prediction accuracy of the crop day - length recognition simulator is carried out for at least 1 round. After the screening is completed, at least 2 rounds of screening are carried out in Fujian and Hainan to obtain stable three - line restorer line rice varieties that are disease - resistant, contain fragrance, and the hybrid F1 shows photosensitivity.

[0090] In step ① of disease resistance screening in step (3), the rice plants with resistance to rice blast and containing fragrance genes are propagated and advanced in generations in Hainan; in step ② of rice quality screening in step (3), the rice plants with excellent rice quality are propagated and advanced in generations in Hainan.

[0091] In step (2), self - crossing is carried out again, and then the number of seeds harvested for planting is more than 3000 plants.

[0092] Among them, the specific operation of the warm - water emasculation method in step (1) is as follows: Move the plants with rice panicles that have flowered 1 / 4 out of the paddy field, use scissors to trim the already - flowered grains, soak the trimmed rice panicles in warm water at 45 °C for 5 minutes, take out the rice panicles, wrap the rice panicles with plastic film until the glumes of the grains on the rice panicles open, use scissors to trim the grains with unopened glumes, cut off half of the glumes of the grains with opened glumes with scissors, and after trimming, cover them with a hybridization bag.

[0093] In step (2), the Indel marker sequences involved in screening for the fragrance E7 genotype using Indel markers are: frg-E7-F: GCCGGTGCTCCTTTGTCATCAC (SEQ ID NO.1), frg-E7-R: CAAACCTTAACCATAGGAG (SEQ ID NO.2), band size: 194 (non-fragrant type) / 186 (fragrant type).

[0094] In step (2), the PCR amplification system and PCR reaction program involved in screening for the fragrance E7 genotype using Indel markers are as follows:

[0095] The primer sequences frg-E7-F and frg-E7-R selected were synthesized by Fuzhou Shangya Biotechnology Co., Ltd., and PCR was performed on a BIO-RAD / Bole gene amplifier PCR instrument; the composition of the 10 μL PCR system: 5 μL of 2×Taq Plus Master MixⅡ (Dye Plus), produced by Nanjing Novoprotein Scientific Co., Ltd., 0.5 μL each of the forward primer frg-E7-F and reverse primer frg-E7-R at 2 μmol / L, 1 μL of 100 ng of template DNA, 3 μL of ddH2O;

[0096] The PCR reaction program is as follows: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 45 s, annealing at 55 °C for 45 s, extension at 72 °C for 45 min; a total of 35 cycles; extension at 72 °C for 7 min; finally, low-temperature preservation at 4 °C for 10 min.

[0097] After that, the PCR products were electrophoresed on a 6% polyacrylamide gel, stained with the nucleic acid fuel Ultra GelRed (10,000×) produced by Nanjing Novoprotein Scientific Co., Ltd., and photographed and saved under ultraviolet light using a BIORAD Molecular Imager gel imager, as Figure 1 shown.

[0098] In step (2), when detecting the Ghd7-0 recessive mutant using SNP markers, the SNP sites of the target gene Ghd7 of the rice variety were genotyped using the KASP marker standard method to distinguish normal functional and premature termination mutants (Ghd7-0);

[0099] The specific primer sequences designed for the KASP marker standard method are:

[0100] PrimerX: gaaggtgaccaagttcatgctCGGCGCCACCGGTGCACG (mutant type G forward primer) (SEQID NO.3),

[0101] PrimerY: gaaggtcggagtcaacggattCGGCGCCACCGGTGCACT (Mutant T forward primer) (SEQ ID NO.4),

[0102] PrimerC: GCCGCCGTCGTTGCCGAAGAA (Universal reverse primer) (SEQ ID NO.5).

[0103] Note: The lowercase part in the primer sequence is the universal primer part. The uppercase part is the specific primer.

[0104] The sequence of the target gene Ghd7 is as follows:

[0105] Sequence (mutation site / ):

[0106] cgatgatgatggattccccttcgtcttcccgccgagtgcgtgccaggggatcggcgccccggcgccaccggtgca c(G / T)agttccagttcttcggcaacgacggcggcggcgacgacggcgagagcgtggcctggctgttcgatgactacc cgccgccgtcg

[0107] The mutant-specific KASP marker was designed by the Rice Research Institute of Fujian Academy of Agricultural Sciences. The specific primer sequences are PrimerX, PrimerY, and PrimerC. These primers can distinguish the G / T mutation at the 157th base of Ghd7. The mutant Ghd7-0(T) will cause the 53rd amino acid of Ghd7 to mutate from E to a stop codon and terminate prematurely, thereby causing the loss of protein function and leading to early heading. The mutant sequence alignment diagram is as Figure 2 shown.

[0108] The PCR amplification system and PCR reaction program used in the KASP marker standard method are as follows:

[0109] The PCR reaction was carried out in a PCR thermal cycler (384-well plate). Each PCR reaction system was 5.0 μL, containing 2.0 μL of DNA with a concentration of 50 ng / μL, 2.5 μL of 2×KASP MasterMix (containing FAM and HEX universal mixed fluorescent primers), 0.05 μL of specific primer mixture, and supplemented to 5 μL with ddH2O. Among them, in the specific primer mixture, the concentrations of the upstream primers PrimerX and PrimerY were both 12 μmol / L, and the concentration of the common downstream primer PrimerC was 30 μmol / L. The reaction was carried out on an ABI QuantStudio 6 Flex and the fluorescence values were automatically read, and genotyping was performed using the supporting software.

[0110] The PCR reaction program was as follows:

[0111]

[0112] The detection results were as Figure 3 shown. As Figure 3 shown, this marker could genotype rice plants containing two genotypes Ghd7 / Ghd7-0.

[0113] Example 2 A breeding method for a photosensitive restorer line and a new rice variety according to the present invention includes the following steps carried out in sequence:

[0114] (1) Hybridization by warm water emasculation method: Using Minglunzhenzhan as the female parent P1 and Fuhui 2165 as the male parent P2, hybridize to obtain rice seeds by the warm water emasculation method.

[0115] (2) Preliminary screening to obtain fragrant rice single plants: Soak the seeds of the rice plants obtained in the previous step, germinate them, and then sow them. Backcross with the female parent P1 variety to harvest seeds. After planting the harvested seeds, use Indel markers to select rice single plants containing the fragrant E7 genotype, and at the same time use SNP markers to detect Ghd7-0 recessive mutants. Select rice single plants that contain fragrance and carry the dominant E1 (Ghd7) allele, have long grains, short and straight flag leaves, and a plant height not exceeding 110 cm, and self-cross again to harvest the seeds of this rice plant.

[0116] (3) Variety screening: The variety screening includes the following steps carried out in sequence:

[0117] ① Disease resistance screening: Sow the seeds of the rice plants obtained in the previous step by strain in heavily rice blast epidemic areas such as Chadi Town, Shanghang County, Fujian Province and Mashazhen, Jianyang District, Fujian Province, and conduct natural induction identification of rice blast. Using the male parent P2 variety as a control, eliminate the susceptible strains, screen out rice strains resistant to rice blast and containing fragrance, and self-cross to obtain rice plants resistant to rice blast and containing fragrance genes.

[0118] ② Screening of rice quality: Self-cross the rice plants containing the fragrance gene obtained in the previous step, harvest the seeds and sow the seeds to obtain multiple rice lines. Plant the seeds of each line into a population, conduct population isolation self-crossing and within-population mixed harvesting for each population respectively to obtain the seeds of each population. Screen and eliminate the populations whose quality fails to meet the standard of high-quality rice above the third-class issued by the ministry through rice quality analysis, and obtain populations with excellent rice quality, namely rice mixed-harvesting lines;

[0119] After the screening in the above steps ① - ② is completed, repeat steps ① - ② at least 4 rounds of screening, and obtain a rice variety that is disease-resistant and contains the fragrance gene.

[0120] ③ Determination of crop dimension adaptability and light-sensitive characteristics: After the screening in the above steps ① - ② is completed to obtain a rice variety planting population, select different types of three-line male sterile lines of rice (the selected three-line male sterile lines of rice include 171A, Qiyuan A, and Pinxiang A) for test crossing and harvest the hybrid seeds; Plant the hybrid F1 and conduct variety testing and rice quality screening; At the same time, through the evaluation system for predicting the accuracy of the crop day-length recognition simulator constructed by Xiamen University, use field data to quantitatively evaluate the prediction accuracy, and screen out hybrids and corresponding restorer lines with good plant leaf morphology, high seed setting rate, excellent rice quality and light sensitivity.

[0121] ④ Screening of varieties suitable for the rice-fish farming mode: Make small-scale seed production of the restorer line screened in the above step ③ and the male sterile line Qingxiang A, and conduct variety screening for the hybrid F1 in multiple places such as Sanming City and Nanping City in Fujian Province for the rice-fish farming mode, and screen out high-quality rice varieties that are resistant to rice blast, have excellent rice quality and are light-sensitive.

[0122] In the variety screening of step (3), conduct the evaluation of the prediction accuracy of the crop day-length recognition simulator in step ③ for at least 1 round. After the screening is completed, conduct at least 2 rounds of screening in Fujian and Hainan to obtain a stable three-line restorer line rice variety that is disease-resistant, contains fragrance, and the hybrid F1 shows light sensitivity.

[0123] In step ① of disease resistance screening in step (3), propagate and increase the generation of the rice plants that are resistant to rice blast and contain the fragrance gene in Hainan; In step ② of rice quality screening in step (3), propagate and increase the generation of the rice plants with excellent rice quality in Hainan.

[0124] In step (2), conduct self-crossing again, and then the number of seeds harvested and planted is more than 3000 plants.

[0125] The variety evaluation method and rice quality screening criteria involved in this example are the same as those in Example 1. The specific operation of the warm water emasculation method described in step (1), the method of using Indel markers to select rice plants with the fragrant E7 genotype in step (2), and the method of using SNP markers to detect the Ghd7-0 recessive mutant, etc. are the same as those in Example 1.

[0126] Example 3 A breeding method for a photosensitive restorer line and a new rice variety according to the present invention comprises the following steps carried out in sequence:

[0127] (1) Hybridization by the warm water emasculation method: Using Minglunzhenzhan as female parent P1 and Fuhui 2165 as male parent P2, hybridize by the warm water emasculation method to obtain rice seeds;

[0128] (2) Primary screening to obtain rice plants with fragrant genes: Soak the seeds of the rice plants obtained in the previous step, germinate them by soaking, and then sow them. Backcross with the female parent P1 variety to harvest seeds. After planting the harvested seeds, use Indel markers to select rice plants with the fragrant E7 genotype, and at the same time use SNP markers to detect the Ghd7-0 recessive mutant. Select rice plants that contain fragrance and carry the dominant E1 (Ghd7) allele, have long grains, short and straight flag leaves, and a plant height not exceeding 110 cm, and self-cross them again to harvest the seeds of the rice plants;

[0129] (3) Variety screening: The variety screening includes the following steps carried out in sequence:

[0130] ① Disease resistance screening: Sow the seeds of the rice plants obtained in the previous step by strain in the areas with severe rice blast disease (such as Chadi Town, Shanghang County, Fujian Province; Mashazhen, Jianyang District, Nanping City, Fujian Province, etc.), conduct natural induction identification of rice blast disease, use the male parent P2 variety as a control, eliminate the susceptible strains, screen out the rice blast disease-resistant and fragrant rice strains, and self-cross them to obtain rice plants that are resistant to rice blast disease and contain fragrant genes;

[0131] ② Rice quality screening: Self-cross the rice plants with fragrant genes obtained in the previous step, harvest the seeds and sow the seeds to obtain multiple rice strains. Plant the seeds of each strain into a population, conduct group isolation self-crossing and in-group mixed harvesting for each of them respectively to obtain the seeds of each group. Screen and eliminate the groups whose quality does not meet the national third-class or higher premium rice standards through rice quality analysis, and obtain groups with excellent rice quality, that is, rice mixed harvesting strains;

[0132] After the screening in the above steps ①-② is completed, repeat the screening at least 4 rounds in a cycle to obtain a rice variety that is disease-resistant and contains fragrant genes.

[0133] ③ Determination of crop dimension adaptability and light-sensitive characteristics: Plant the rice variety planting population obtained through the screening in the above steps ①-②, select different types of three-line male sterile lines of rice (the selected three-line male sterile lines of rice include 171A, Qiyuan A, and Pinxiang A) for test crossing, and harvest hybrid seeds; plant the hybrid F1, and conduct variety inspection and rice quality screening; at the same time, through the evaluation system for predicting the accuracy of the crop day length recognition simulator constructed by Xiamen University, use the field data to quantitatively evaluate the prediction accuracy, and screen out hybrids with good plant leaf morphology, high seed setting rate, excellent rice quality and light sensitivity and the corresponding restorer lines.

[0134] ④ Screening of rice-fish varieties: Conduct small-scale seed production for the hybrids obtained through the screening in the above step ③, and carry out the screening of suitable rice-fish farming models at multiple sites in Sanming City and Nanping City, Fujian Province.

[0135] In the variety screening in step (3), in step ③, the evaluation of the prediction accuracy of the crop day length recognition simulator is carried out for at least 1 round. After the screening is completed, at least 2 rounds of screening are carried out in Fujian and Hainan to obtain stable three-line restorer line rice varieties with disease resistance, containing fragrance, and the hybrid F1 showing light sensitivity.

[0136] In the disease resistance screening in step ① of step (3), the rice plants with blast resistance and containing fragrance genes are propagated and advanced in generations in Hainan; in the rice quality screening in step ② of step (3), the rice plants with excellent rice quality are propagated and advanced in generations in Hainan.

[0137] In step (2), self-crossing is carried out again, and then the number of seeds harvested for planting is more than 3,000 plants.

[0138] The variety inspection method and rice quality screening criteria involved in this example are the same as those in Example 1. The specific operation of the warm water emasculation method described in step (1), the method of using Indel markers to select rice single plants containing the fragrance E7 genotype and using SNP markers to detect the Ghd7-0 recessive mutant in step (2), etc. are the same as those in Example 1.

[0139] Example 4

[0140] The breeding method of a restorer line with light-sensitive characteristics and a new variety according to the present invention includes the following steps carried out in sequence:

[0141] (1) Hybridization by warm water emasculation method: Using Minglunzhenzhan as the female parent P1 and Fuhui 2165 as the male parent P2, hybridize to obtain rice seeds by the warm water emasculation method.

[0142] (2) Primary screening to obtain rice single plants containing fragrance genes: Soak the seeds of the rice plants obtained in the previous step for germination and then sow them. Backcross with the female parent P1 variety to harvest seeds. After planting the harvested seeds, use Indel markers to select rice single plants with the E7 genotype, and at the same time use SNP markers to detect Ghd7-0 recessive mutants. Select rice single plants that contain fragrance and carry the dominant E1 (Ghd7) allele, have long grains, short and straight flag leaves, and a plant height not exceeding 110 cm, and self-cross them again to harvest the seeds of this rice plant;

[0143] (3) Variety screening: The variety screening includes the following steps carried out in sequence:

[0144] ① Disease resistance screening: Sow the seeds of the rice plants obtained in the previous step by strain in the areas with severe rice blast disease (such as Chadi Town, Shanghang County, Fujian Province; Mashazhen, Jianyang District, Fujian Province, etc.) for natural induction and identification of rice blast disease. Use the male parent P2 variety as a control, eliminate the susceptible strains, and screen out the rice strains that are resistant to rice blast and contain fragrance, and self-cross them to obtain rice plants that are resistant to rice blast and fragrant;

[0145] ② Grain quality screening: Self-cross the rice plants containing fragrance genes obtained in the previous step, harvest the seeds and sow the seeds to obtain multiple rice strains. Plant the seeds of each strain into a population, carry out group isolation self-crossing and within-group mixed harvesting for each of them respectively to obtain the seeds of each population, and screen out and eliminate the populations whose quality does not meet the standard of high-quality rice above the third-class ministry standard through grain quality analysis to obtain populations with excellent grain quality, that is, rice mixed-harvesting strains;

[0146] After the screening in the above steps ① - ② is completed, repeat the screening at least 4 rounds in a cycle to obtain a rice variety that is disease-resistant and contains fragrance genes.

[0147] ③ Determination of crop dimension adaptability and light sensitivity characteristics: Plant the rice variety planting population obtained after the screening in the above steps ① - ②, select different types of three-line male sterile lines of rice (the selected three-line male sterile lines of rice include 171A, Qiyuan A, Pinxiang A) for test crossing to harvest hybrid seeds; Plant the hybrid F1 and conduct variety testing and grain quality screening; At the same time, through the evaluation system for predicting the accuracy constructed by Xiamen University's crop day length recognition simulator, use field data to quantitatively evaluate the accuracy of the prediction, and screen out hybrids and corresponding restorer lines with good plant leaf morphology, high seed setting rate, excellent grain quality and light sensitivity.

[0148] ④ Variety screening for suitable rice-fish farming mode: Carry out small-scale seed production of the restorer line and the sterile line Fanyuan A screened in the above step ③, and conduct variety screening for the suitable rice-fish farming mode at multiple points in Sanming City, Nanping City, Fujian Province, etc. for the hybrid F1, and screen out high-quality rice varieties that are resistant to rice blast, have excellent grain quality and are light-sensitive.

[0149] In step ① of disease resistance screening in step (3), the obtained rice plants resistant to rice blast and containing fragrance genes are multiplied and advanced in Hainan; in step ② of rice quality screening in step (3), the obtained rice plants with excellent rice quality are multiplied and advanced in Hainan.

[0150] In step (2), selfing is carried out again, and then the number of seeds harvested for planting is more than 3000 plants.

[0151] In step ② of rice quality screening in step (3), after screening out rice single plants containing fragrance genes, further screen out rice single plants with long grains, short and straight flag leaves, and plant height not exceeding 110 cm, and then self-cross to obtain stable rice plants.

[0152] In variety screening in step (3), in step ③, the evaluation of the prediction accuracy of the crop day-length recognition simulator is carried out for at least 1 round. After the screening is completed, at least 2 rounds of screening are carried out in Fujian and Hainan to obtain a stable three-line restorer rice variety that is disease-resistant, contains fragrance, and the hybrid F1 generation shows photosensitivity.

[0153] The seed testing method and rice quality screening criteria involved in this example are the same as those in Example 1. The specific operation of the warm water emasculation method described in step (1), the method of using Indel markers to select rice single plants containing fragrance E7 genotype and using SNP markers to detect Ghd7-0 recessive mutants in step (2), etc. are the same as those in Example 1.

[0154] The rice quality analysis and screening in step ② of step (3) include the following steps carried out in sequence:

[0155] 1) Process the seeds of each population into polished rice, select polished rice with good appearance quality and transparent without ventral white, so as to screen out rice mixed harvest lines with the above characteristics and high head rice rate; at the same time, entrust a third party to measure the fragrance value.

[0156] 2) Using the female parent P1 variety as a control, cook the polished rice of the rice mixed harvest lines screened in step 1) above and the polished rice of the control variety female parent P1 respectively according to the weight ratio of polished rice: water of 1:1.2 - 1.4, and select polished rice with good palatability and good appearance quality after cooking, so as to screen out rice mixed harvest lines with the above characteristics.

[0157] The rice quality analysis and screening methods involved in Examples 1 - 3 are the same as above.

[0158] Experimental data

[0159]

[0160] The experimental data are obtained from the seed testing data of the restorer lines screened by the hybrid F1 seed testing in 4 examples.

[0161] Plant height measurement method: Randomly select 20 plants, measure the length from the base of the main stem to the top of the spike (excluding awns), and take the average value.

[0162] Number of grains per panicle measurement method: At maturity, randomly select 20 plants. The spikelets with 20 grains are counted as effective panicles. Thresh the filled grains and empty grains of each spikelet, count the total number of grains, and total number of grains ÷ number of effective panicles = number of grains per panicle.

[0163] Sowing-heading duration measurement method: Count from the sowing day, and the number of days between the date when 10% of the plants in the population head.

[0164] Amylose content measurement method: The industry standard "Determination of Amylose in Rice - Spectrophotometry" NY / T 2639 - 2014 is used as the detection basis.

[0165] Grain length-width ratio measurement method: After harvesting and air-drying the grains, use a seed counter to randomly select more than 20 grains, measure the length and width of each single grain, repeat 3 times, then calculate the average length and width of the grains, and length value ÷ width value = length-width ratio.

[0166] Fragrance measurement method: Place about 2 g of brown rice in a 25 ml test tube, add 10 ml of 1.7% KOH solution, tightly cover the tube mouth, soak for 10 min at room temperature (25 °C), then open the tube mouth and immediately smell with the nose.

[0167] Rice blast resistance identification method: Implement according to "Technical Regulations for Identification and Evaluation of Rice Blast Resistance in Rice Variety Trials" (NY / T 2646 - 2014). Those rated below level 3 are determined to be resistant to rice blast.

[0168] Photoperiod sensitivity detection method: Sow the hybrid F1 in May in Shaxian District, Sanming City, Fujian Province, and in early July in Longhai City, Zhangzhou City, Fujian Province. The heading date in Shaxian District is from the end of September to the middle of October, and the heading date in Longhai City is from the end of September to the beginning of October. Then it can be judged that the hybrid F1 has photoperiod sensitivity.

[0169] It can be seen that the three-line restorer rice variety selected in this application, which is disease-resistant, contains fragrance genes and shows photoperiod sensitivity in the hybrid F1 generation, has good rice quality and strong resistance.

[0170] Example 5: A method for quickly obtaining a rice variety carrying the dominant E1 (Ghd7) allele (this method is essentially a creation of a rice variety with a delayed heading date).

[0171] For the lines in the corresponding steps of the present invention (such as steps (2) and (3) in Examples 1-4) that do not carry the dominant E1 (Ghd7) allele and contain fragrance and disease resistance, the CRISPR / Cas9 gene editing technology is used to transform crop materials, and finally, materials carrying the growth period gene Ghd7 are obtained.

[0172] The CRISPR / Cas9 gene editing technology described above is ABE (adenine base editor). By mutating the 157th base T of Ghd7-0 to a non-T base, the non-functional Ghd7-0 premature termination mutant can be changed into Ghd7.

[0173] Efficient creation of ABE base editor:

[0174] Among current base editors, CBE (cytosine base editor) only supports the conversion of C to A / T / G, while ABE (adenine base editor) can achieve the conversion from A to G. Therefore, in the present invention, ABE is used to convert the complementary strand T of the mutant base to C, thereby restoring protein activity.

[0175] The inventors used the improved vector hyABE8e-SpRYm of the plant adenine base editing system (DOI: 10.1111 / pbi.13774) for construction, and the target was (The bold part is the 20bp target sequence inserted into the vector, the base A to be mutated is marked in red, and the underline represents the PAM recognition site). Primer sequences: ABE-F: AATAATGGTCTCAGGCGACTAGTGCACCGGTGGCGCCGTTTTAGAGCTAGA AATAGC, ABE-R:

[0176] ATTATTGGTCTCTAAACGGCGCCACCGGTGCACTAGTGCTTCTTGGTGCC

[0177] Preparation of PCR ligation products: Amplify the ligation products according to the following table;

[0178] Table PCR amplification system and reaction conditions

[0179]

[0180] After the program ends, we purify the PCR products and then carry out ligation. The vector used is hyABE8e-SpRYm, and the Golden Gate ligation method is used for one-step digestion and ligation. The digestion and ligation system is as follows in the table.

[0181] Table vector digestion system and program

[0182]

[0183] The carrier structure diagram obtained is as follows Figure 4 As shown, subsequent transformation of rice was carried out using Agrobacterium-mediated method.

[0184] Agrobacterium-mediated transformation of rice:

[0185] ① Callus pre-culture: Select calli with uniform size and good state, closely place them on NB induction medium, and pre-culture them at 28 °C in the dark for 2 - 3 days for subsequent infection. Transfer the pre-cultured calli to a 50 ml centrifuge tube, pour in the activated Agrobacterium liquid, infect for 90 s, discard the liquid, spread the calli on filter paper that has been autoclaved in advance to absorb the residual bacterial liquid, dry them in a laminar flow cabinet, and then transfer them to a co-culture medium covered with a layer of sterile filter paper, and culture them in the dark at 28 °C for 1 day.

[0186] ② Screening of positive calli and obtaining of transgenic plants: The calli after one day of co-culture are placed one by one on a screening medium with hygromycin Hyg resistance, and cultured in the dark at 28 °C. Replace the medium every about 14 days. During this period, the calli will turn brown and new light white calli will grow. Place the same clone together for culture, and keep a certain distance between each clone to avoid confusion. After screening for about three generations, transfer the newly grown calli to pre-differentiation. After transferring the light white or bright yellow calli to the pre-differentiation medium, culture them under full light at 28 °C. Green dots will appear after about 1 week of culture. Continue to culture until roots and buds are differentiated, then transfer them to the rooting medium. When the seedlings are strong and the roots are well-developed, they can be removed from the medium for transplantation.

[0187] The following is the corresponding base sequence after successful mutation using this gene editing technology:

[0188] The mutated sequence

[0189]

[0190] The correct mutation frequency obtained: 65.3%

[0191] The phenotype of the mutated plants is as follows Figure 5 As shown. After mutation, under long-day conditions, it shows photosensitivity and the heading date is postponed by 45 days.

[0192] Example 6: A method for rapidly obtaining a rice variety carrying the dominant E1 (Ghd7) allele (this method is essentially a creation of rice with a postponed heading date).

[0193] For the lines in the corresponding steps of the present invention (such as steps (2) and (3) in Examples 1-4) that do not carry the dominant E1 (Ghd7) allele and contain fragrance and disease resistance, the CRISPR / Cas9 gene editing technology is used to transform crop materials. Finally, materials carrying the growth period gene Ghd7 are obtained.

[0194] The CRISPR / Cas9 gene editing technology described above is a PE base editor. By mutating the 157th base T of Ghd7-0 to a non-T base, the non-functional Ghd7-0 premature termination mutant can be changed into Ghd7.

[0195] High-precision creation of PE base editor:

[0196] The inventor uses the vector system dual-pegRNA (DOI: 10.1038 / s41587-022-01254-w) to construct a plant PE vector, and the universal template is amplified with the following primers and then ligated into the pH-ePPE vector.

[0197] The primers are as follows:

[0198]

[0199] PCR ligation product preparation: The ligation product is amplified according to the following table

[0200] Table PCR amplification system and reaction conditions

[0201]

[0202] Vector linearization: Perform according to the following digestion system

[0203]

[0204] The correctly digested product and the PCR ligation product are recovered by agarose gel, and the amplified fragment is fused into the linear vector using homologous recombination ligation. After transforming Escherichia coli to obtain the correct positive clone, the bacteria are preserved and the plasmid is extracted.

[0205] Table Vector homologous recombination ligation system and program

[0206]

[0207] The above vector is transferred into Agrobacterium, and Agrobacterium-mediated transformation of rice is carried out (the method is the same as the ABE vector transformation method).

[0208] The sequence after mutation by this gene editing method is as follows:

[0209]

[0210] The correct mutation frequency is obtained: 13.2%

[0211] The phenotypes of the plants mutated by this gene editing technology are similar to those of Figure 5 those described above, and will not be elaborated here.

[0212] From the mutation frequency data of Examples 5 and 6, it can be seen that by using a base editor (BE) or a prime editing system (PE) to mutate the 157th base T of Ghd7-0 to a non-T base, the non-functional Ghd7-0 premature termination mutant can be transformed into Ghd7. Although the PE system has more precise editing ability, its editing efficiency is low, while the editing window of BE editing (such as ABE adenine base editor) is variable, but the editing efficiency is very high. The ABE system is recommended to achieve site-directed editing of Ghd7-0.

[0213] The above describes the embodiments of the present invention. However, the above embodiments are not limited to the above specific implementation manners. The above specific implementation manners are merely illustrative and not restrictive. Under the inspiration of this embodiment, those of ordinary skill in the art can also make many forms, all of which fall within the protection scope of this embodiment.

Claims

1. A breeding method for a photosensitive characteristic restoring line and a new rice variety, characterized in that: It includes the following steps carried out in sequence: (1) Hybridization by warm water emasculation method: Using Minglun Zhenzhan as female parent P1 and Fuhui 2165 as male parent P2, hybridize by warm water emasculation method to obtain rice seeds; (2) Initial screening to obtain fragrant rice single plants: Soak the rice seeds obtained in the previous step for germination and then sow them. Backcross with the female parent P1 variety to harvest seeds. After planting the harvested seeds, use Indel markers to screen for the fragrant E7 genotype, and select the rice single plants containing fragrance among them; Meanwhile, use SNP markers to detect the Ghd7-0 recessive mutant, and select the rice single plants that contain fragrance and carry the dominant E1(Ghd7) allele, have long grains, short and straight flag leaves, and plant height not exceeding 110 cm, and self-cross again to harvest the seeds of this rice plant; (3) Variety screening: The variety screening includes the following steps carried out in sequence: ① Disease resistance screening: Sow the seeds of the rice plants obtained in the previous step by strain in multiple rice blast epidemic areas for natural induction identification of rice blast. Using the male parent P2 variety as a control, eliminate the susceptible strains, and screen out the rice strains resistant to rice blast and containing fragrance, and self-cross to obtain the rice plants resistant to rice blast and containing fragrance; ② Grain quality screening: Self-cross the rice plants resistant to disease, fragrant, and carrying the dominant E1(Ghd7) allele obtained in the previous step, harvest the seeds and sow the seeds to obtain multiple rice strains. Plant the seeds of each strain into a population, carry out population isolation self-crossing and in-group mixed harvesting for each of them respectively to obtain the seeds of each population, and screen and eliminate the populations whose grain quality does not meet the standard of high-quality rice above the third-class ministry standard through grain quality analysis to obtain the populations with excellent grain quality, that is, the rice mixed harvesting strains; ③ Determination of crop dimension adaptability and light sensitivity characteristics: After the screening in the above steps ①-② is completed to obtain the rice variety planting population, select different types of three-line male sterile lines of rice for test crossing and harvest the hybrid seeds; Plant the hybrid F1 and conduct variety inspection and grain quality screening; Meanwhile, through the evaluation system for predicting the accuracy of the crop day-length recognition simulator, use the field data to quantitatively evaluate the prediction accuracy, and screen out the hybrids with long growth periods and the corresponding restorer lines; ④ Variety screening for suitable rice-fish farming mode: Carry out small-scale seed production with the restorer line and male sterile line screened in the above step ③. The hybrid F1 conducts variety screening for suitable rice-fish farming mode at multiple points in different regions, and screen out the high-quality rice varieties resistant to rice blast, with excellent grain quality, and light-sensitive suitable for the rice-fish farming mode.

2. The breeding method of the photosensitive characteristic restoring line and new rice variety according to claim 1, characterized in that: The specific operation of the warm water emasculation method in step (1) is as follows: Move the plants with rice ears that have blossomed 1 / 4 outside the paddy field, use scissors to trim off the blossomed grains, soak the trimmed rice ears in warm water at 45°C for 5 minutes, take out the rice ears, wrap the rice ears with plastic film until the glumes of the rice grains open, use scissors to trim off the grains with unopened glumes, and use scissors to cut off half of the glumes of the grains with opened glumes. After trimming, use a hybridization bag for bagging.

3. The breeding method of the photosensitive characteristic restorer line and the new rice variety according to claim 1, wherein: In step (2), the Indel marker sequences involved in screening for the fragrance E7 genotype using Indel markers are as follows: frg-E7-F: GCCGGTGCTCCTTTGTCATCAC, frg-E7-R: CAAACCTTAACCATAGGAG, band size: 194 (non-fragrant type) / 186 (fragrant type).

4. The breeding method of the photosensitive characteristic restorer line and the new rice variety according to claim 3, characterized in that: In step (2), the PCR amplification system and PCR reaction program involved in screening for the fragrance E7 genotype using Indel markers are as follows: Composition of the 10 μL PCR system: 5 μL of 2× Taq Plus MasterMixⅡ (Dye Plus), 0.5 μL each of the forward primer frg-E7-F and reverse primer frg-E7-R at 2 μmol / L, 1 μL of 100 ng template DNA, 3 μL of ddH2O; The PCR reaction program is as follows: Pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 45 s, annealing at 55 °C for 45 s, extension at 72 °C for 45 min; a total of 35 cycles; extension at 72 °C for 7 min; finally, preservation at low temperature at 4 °C for 10 min.

5. The breeding method of a photosensitive characteristic restorer line and a new rice variety according to claim 1, characterized in that: In step (2), when detecting the Ghd7-0 recessive mutant using SNP markers, the SNP sites of the target gene Ghd7 of the rice variety were genotyped using the KASP marker standard method to distinguish normal functional and premature termination mutants (Ghd7-0); The specific primer sequences designed for the KASP marker standard method are as follows: PrimerX: gaaggtgaccaagttcatgctCGGCGCCACCGGTGCACG (mutant type G forward primer), PrimerY: gaaggtcggagtcaacggattCGGCGCCACCGGTGCACT (mutant type T forward primer), PrimerC: GCCGCCGTCGTTGCCGAAGAA (universal reverse primer).

6. The breeding method of the photosensitive characteristic restorer line and new rice variety according to claim 5, characterized in that: The PCR amplification system and PCR reaction program used in the KASP marker standard method are as follows: Each PCR reaction system is 5.0 μL, containing 2.0 μL of DNA at a concentration of 50 ng / μL, 2.5 μL of 2× KASP MasterMix (containing FAM and HEX universal mixed fluorescent primers), 0.05 μL of specific primer mixture, supplemented to 5 μL with ddH2O; among them, in the specific primer mixture, the concentrations of the upstream primers PrimerX and PrimerY are both 12 μmol / L, and the concentration of the universal downstream primer PrimerC is 30 μmol / L; the reaction is carried out on an ABI QuantStudio6Flex and the fluorescence values are automatically read, and genotyping is performed using the supporting software; The PCR reaction program is as follows:

7. The breeding method of the photosensitive characteristic restoring line and the new rice variety according to claim 1, wherein: It also includes, for the lines without the dominant E1 (Ghd7) allele and with fragrance and disease resistance in steps (2) and (3), using the CRISPR / Cas9 gene editing technology to transform crop materials, and finally obtaining materials carrying the growth period gene Ghd7.

8. The breeding method of the photosensitive characteristic restorer line and the new rice variety according to claim 7, characterized in that: By using a base editor (BE) or a prime editing system (PE) to mutate the 157th base T of Ghd7-0 to a non-T base, the non-functional Ghd7-0 premature termination mutant can be transformed into a functional Ghd7.

9. The breeding method of the photosensitive characteristic restorer line and the new rice variety according to claim 8, characterized in that: The base editor (BE) is an ABE base editor, which realizes the conversion from A to G; Among them, when performing gene editing using the ABE base editor, it was constructed using the improved vector hyABE8e-SpRYm of the plant adenine base editing system (DOI: 10.1111 / pbi.13774), and the target site was ACTAGTGCACCGGTGGCGCC GGG ; The primer sequences used for preparing the PCR ligation product are as follows: ABE-F: AATAATGGTCTCAGGCGACTAGTGCACCGGTGGCGCCGTTTTAGAGCTAGA AATAGC, ABE-R: ATTATTGGTCTCTAAACGGCGCCACCGGTGCACTAGTGCTTCTTGGTGCC.

10. A method for quickly obtaining a rice variety carrying the dominant E1 (Ghd7) allele, characterized in that: For the lines without the dominant E1 (Ghd7) allele and with fragrance and disease resistance, use the CRISPR / Cas9 gene editing technology to transform crop materials, and finally obtain materials carrying the growth period gene Ghd7; Among them, the CRISPR / Cas9 gene editing technology is a base editor (BE) or a prime editing system (PE); The base editor (BE) is an ABE base editor, which realizes the conversion from A to G; When performing gene editing using the ABE base editor, it was constructed using the improved vector hyABE8e-SpRYm of the plant adenine base editing system (DOI: 10.1111 / pbi.13774), and the target was ACTAGTGCACCGGTGGCGCC GGG (The bold part is the 20bp target sequence inserted into the vector, the base A to be mutated is marked in red, and the underline represents the PAM recognition site); The primer sequences used for preparing the PCR ligation product are as follows: ABE-F: AATAATGGTCTCAGGCGACTAGTGCACCGGTGGCGCCGTTTTAGAGCTAGA AATAGC, ABE-R: ATTATTGGTCTCTAAACGGCGCCACCGGTGCACTAGTGCTTCTTGGTGCC.

Images