Application of naringin to potato virus Y resistance of plants

Abstract

The invention discloses application of naringin in resisting potato virus Y of plants, and belongs to the technical field of biology. According to the invention, a candidate compound naringin is successfully found from a ZINC database by adopting a virtual screening method and taking PVYHC-Pro as a target, and then the inhibition effect of the naringin on PVY is detected by adopting methods such as protein expression and purification, trace thermophoresis and plant living body experiments. Experiments show that after the naringin is sprayed to the nicotiana benthamiana, obvious green fluorescence does not appear on system leaves on the 6th day, and a small amount of fluorescence appears on the 8th day and the 10th day. The nicotiana benthamiana sprayed by contrast DMSO shows a large amount of fluorescence in the 6th day, and the fluorescence is continuously enhanced in the 8th and 10th days. Therefore, the naringin has good inhibitory activity on PVY, that is, the naringin can target PVY HC-Pro protein to interact with the PVY HC-Pro protein, and the accumulation of PVY (potato Y virus) in plants is inhibited.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of naringin in plant resistance to Potato virus Y. Background Art

[0002] Potato virus Y (PVY) is a representative member of the genus Potyvirus and is also one of the important plant viruses that endanger global agricultural production. PVY is mainly transmitted by aphids in a non-persistent manner and can infect many solanaceous cash crops such as potatoes, tobacco, and tomatoes, resulting in leaf yellowing, necrosis, and plant dwarfing, causing billions of dollars in economic losses every year.

[0003] Currently, the control methods mainly rely on disease-resistant varieties and chemical agents, but there are problems such as easy breakthrough of resistance and environmental pollution. There is an urgent need to develop new, highly efficient, and low-toxic antiviral agents. As a key factor in PVY pathogenesis and transmission, the HC-Pro protein has become an important target for the development of antiviral drugs due to its conserved domains and multifunctional characteristics.

[0004] Naringin is a natural flavonoid compound with various biological activities, but its application in the field of plant antiviral has not been fully explored. Research shows that flavonoid compounds can inhibit virus infection by interacting with virus proteins, which provides a theoretical basis for the development of naringin-based PVY inhibitors. However, whether naringin can specifically target the PVY HC-Pro protein and effectively inhibit PVY infection still needs to be further verified. In this study, through a combination of computational simulation and experiments, the interaction mechanism between naringin and HC-Pro and its anti-PVY activity were revealed for the first time, laying a foundation for the development of new bio-based antiviral agents. Summary of the Invention

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] In the first aspect, the present invention provides the application of naringin in plant resistance to Potato virus Y.

[0007] Further, the plant is Nicotiana benthamiana.

[0008] Further, naringin inhibits the infection of Potato virus Y by interacting with the HC-Pro protein in Potato virus Y.

[0009] In the second aspect, the present invention provides the application of naringin in the preparation of products for plant resistance to Potato virus Y.

[0010] Further, the product is an antiviral agent.

[0011] Further, the antiviral preparation also contains a pharmaceutically acceptable carrier or adjuvant.

[0012] In a third aspect, the present invention also provides a preparation for resisting Potato virus Y, which contains naringin.

[0013] Further, the preparation also contains a pharmaceutically acceptable carrier or adjuvant.

[0014] Further, the concentration of naringin in the preparation is 200 - 300 μM.

[0015] In a fourth aspect, the present invention also provides a method for preventing and controlling the infection of plants by Potato virus Y, and the method is to apply the above-mentioned preparation to plants.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] In recent years, as a key factor in virus pathogenesis and transmission, the HC-Pro protein has become an important target for antiviral agents. The research on the structure and function of HC-Pro can provide a theoretical basis for the design of new antiviral agents. Our team previously found through molecular docking, microscale thermophoresis and other studies that diarylurea-derived compounds can bind to the C-terminal domain (307 - 465Aa) of HC-Pro, and finally inhibited the accumulation of PVY in plants, indicating that HC-Pro can be used as a molecular target for antiviral agents. In order to further screen for small molecule compounds for preventing and controlling PVY in this study, the three-dimensional structure of the PVY HC-Pro protein was predicted using AlphaFold3, and the reliability of the prediction model was verified through various evaluation methods. Further, a virtual screening method was used to successfully find the candidate compound naringin from the ZINC database, and then methods such as protein expression and purification, microscale thermophoresis, and in vivo plant experiments were used to detect the inhibitory effect of naringin on PVY. Description of the Drawings

[0018] Figure 1 For the homology modeling of the PVY HC-Pro protein in Example 1 (wherein, Figure A is the three-dimensional structure diagram of the PVY HC-Pro protein obtained by homology modeling; Figure B is the three-dimensional conformation of the PVY HC-Pro protein);

[0019] Figure 2 For the Ramachandran and Errat analysis of the PVY Hc-Pro protein in Example 1 (wherein, Figure A is the Ramachandran plot model evaluation of the PVY Hc-Pro protein, and the amino acid residues falling in the core region and the reasonable region are 100%; Figure B is the Errat model evaluation of the PVY Hc-Pro protein, and the Overall quality factor value is 99.0);

[0020] Figure 3 For the analysis of the binding mode between PVY Hc-Pro and small molecules in Example 1 (where Figure A is the three-dimensional structure of the binding between PVY HC-Pro and naringin and the amino acid sites of the binding; Figure B is the three-dimensional structure of the binding between PVY HC-Pro and ningnanmycin and the amino acid sites of the binding; Figures C and D are 2D diagrams of the molecular docking of PVYHC-Pro protein with naringin and ningnanmycin using Discovery Studio, and the green dashed lines are hydrogen bond interactions);

[0021] Figure 4 For the molecular dynamics analysis in Example 1 (where Figure A is the binding mode of naringin and PVY HC-Pro, the compound is represented by dark-colored rods, and PVYHC-Pro is represented by white. The interactions at key sites and hydrogen bonds are shown by red dashed lines; Figure B is the binding mode of ningnanmycin and PVYHC-Pro, the compound is represented by dark-colored rods, and PVYHC-Pro is represented by white. The interactions at key sites and hydrogen bonds are shown by red dashed lines; Figure C is the comparison of the root mean square deviation of the NAR and NNM complexes; Figure D is the analysis of the radius of gyration of NAR and NNM; Figure E is the number of hydrogen bonds formed by NAR and NNM; Figure F is the root mean square fluctuation value of the residues in the NAR and NNM complexes; Figure G is the solvent accessible surface area value and its probability distribution of NAR and NNM);

[0022] Figure 5 For the expression of HC-Pro in different strains, temperatures and IPTG concentrations in Example 1 (where Figure A: M, Maker; 1 and 2, Rosetta strain; 3 and 4, BL21-star strain; 5 and 6, BL21 strain; Lanes 1, 3, 5 are the protein supernatants, and lanes 2, 4, 6 are the precipitates; Figure B: M, Maker; 1 and 4, 8°C; 2 and 5, 16°C; 3 and 6, 25°C; Lanes 1, 2, 3 are the protein supernatants, and 4, 5, 6 are the precipitates; Figure C: M, Maker; 1 - 6, different IPTG concentrations, 1 and 4, 0.4 mM; 2 and 5: 0.6 mM; 3 and 6, 0.8 mM; Lanes 1, 2, 3 are the protein supernatants, and 4, 5, 6 are the precipitates);

[0023] Figure 6 For the purification of HC-Pro by Ni-NTA column in Example 1 (where Figure A: M, protein Marker; Lanes 1 - 4 represent the HC-Pro protein in the whole cell, supernatant, precipitate and flow-through respectively; Lanes 5 - 16 are the purified HC-Pro protein; Figure B is the ultraviolet absorption peak of the purified HC-Pro protein);

[0024] Figure 7 For the detection of the interaction between naringin and PVY HC-Pro by MST in Example 1;

[0025] Figure 8 To implement the inhibition of PVY infection by naringin in Example 1 (where Figure A shows the GFP fluorescence results at different times after inoculating Nicotiana benthamiana with PVY-GFP; Figure B shows the expression analysis of the PVY CP gene at different times after treatment with antiviral compounds, and the error bars represent the standard errors of three biological replicates, and NbActin is the internal reference gene of Nicotiana benthamiana); Specific implementation mode

[0026] To better illustrate the present invention, the following examples are specifically listed. Obviously, the described examples are only a part of the present invention, rather than all examples. Based on the examples in the present invention, other examples obtained by those skilled in the art without creative efforts all fall within the scope of protection of the present invention.

[0027] The technical solutions of the present invention will be further described below with reference to the drawings and examples.

[0028] Example 1

[0029] 1. Experimental materials and instruments

[0030] Wild-type Nicotiana benthamiana is preserved in this laboratory. During subsequent use and inoculation, the culture conditions of Nicotiana benthamiana are temperature 24°C, humidity 60%, light 16 h, and darkness 8 h;

[0031] Anti-His: The His-tag monoclonal antibody is purchased from BGI Protein, product number AbM59012-8-PU;

[0032] The protein prokaryotic expression strains E. coli BL21(DE3), Rosetta(DE3), and BL21-star are all purchased from Sangon Biotech (Shanghai) Co., Ltd.;

[0033] Protein prokaryotic expression vector: pMCSG19;

[0034] The protein purification system is a product of GE Company; the ultrasonic cell disruptor (TL-150Y) is a product of Jiangsu Tianling Instruments Co., Ltd.; the ice maker (XB-30II) is a product of Ningbo Newzhiyuan Biotechnology Co., Ltd.

[0035] 2. Experimental methods

[0036] 2.1 Protein sequence retrieval and homology modeling

[0037] To obtain a high-quality three-dimensional protein structure model, in this study, AlphaFold3 was used for homology modeling of PVY HC-Pro (NCBI, Sequence ID: QGV12926.1). After the modeling was completed, SAVES v6.0 (https: / / saves.mbi.ucla.edu / ) was used to evaluate the quality of the model. The distribution of amino acid residues was analyzed through a Ramachandran plot to evaluate whether it conforms to the normal protein conformation rules. Generally, when the proportion of amino acid residues in the core region and the reasonable region exceeds 90%, the model is considered to be of qualified quality. In addition, the Errat tool was used to quantitatively evaluate the model from the perspective of atomic interactions. When the Overall quality factor > 85, the model is considered to be of qualified quality. Finally, the protein structure was saved in the PDB format for subsequent molecular docking use.

[0038] Results:

[0039] The three-dimensional structure of the PVY HC-Pro protein was predicted using AlphaFold3, and the optimal structure was selected for subsequent analysis ( Figure 1 A). The surface display diagram exported by the PyMOL software further demonstrated the three-dimensional conformation of the protein, including its surface charge distribution and potential active site regions ( Figure 1 B). The reliability of the AlphaFold prediction results was evaluated through pTM (predicted TM-score) and pLDDT (predicted Local Distance Difference Test) scores. The pTM score is used to evaluate the overall structural similarity of protein complexes, and a value higher than 0.5 indicates a high similarity between the predicted structure and the true structure. The pTM of the PVY HC-Pro protein was 0.67, indicating that its predicted structure has a high confidence level. The pLDDT score is used to evaluate the local structural confidence of each amino acid residue, ranging from 0 to 100, and the higher the score, the higher the confidence level. The pLDDT of the PVY HC-Pro protein > 90, especially in the active site region, where the pLDDT scores were generally higher than 95 ( Figure 1 C), indicating a high reliability of the structural prediction in these regions.

[0040] To verify the accuracy of the model, in this study, the PVY HC-Pro model was evaluated using a Ramachandran plot and Errat. The results showed that 94.5% of the amino acid residues were in the core region, 5.5% were in the allowed region, and no residues were in the outlier region ( Figure 2A), indicating that the backbone conformation of the model conforms to the stereochemical rules of proteins. The residues in the core region are mainly distributed in secondary structure regions such as α-helices and β-sheets, while the residues in the allowed regions are mostly located in loop regions, which is consistent with the distribution of flexible regions in proteins.

[0041] The Errat tool evaluates the quality of the model by analyzing the statistical distribution of non-bonded atom interactions in proteins. The Errat score is expressed as a percentage, and a higher score indicates a better model quality. The Errat score of the PVYHC-Pro protein is 99.02( Figure 2 B), much higher than the benchmark value (50%) of high-quality models, further confirming the high reliability of the model. Especially in the active site region, the distribution of non-bonded atom interactions is consistent with that of known high-quality protein structures, indicating a high accuracy in the structure prediction of this region.

[0042] In addition, both the Verify 3D score (0.89) and the PROCHECK analysis results indicate that the stereochemical parameters of the PVYHC-Pro protein model are good and meet the standards of high-quality protein structures. The Verify 3D score evaluates the rationality of the model by comparing the three-dimensional structure of the protein with the one-dimensional characteristics of the amino acid sequence. The PROCHECK analysis further verifies that the stereochemical parameters of the model, including bond lengths, bond angles, and dihedral angles, etc., are within the standard range of protein structures. Therefore, the three-dimensional model of the PVYHC-Pro protein predicted by AlphaFold shows high quality and reliability in multiple evaluation methods and is suitable for subsequent molecular docking and virtual screening studies.

[0043] 2.2 Molecular Docking

[0044] Molecular docking was performed using the BIOVIADiscovery Studio 2019 software. Based on the molecular weight range of 150 - 250 Da, the PVY HC-Pro protein was used as the target to screen the ZINC small molecule compound database (https: / / zinc.docking.org / ) by LibDock docking. During the docking process, molecules with a binding energy less than 0 kcal / mol were considered able to bind to the target protein, and the lower the binding energy, the more stable the molecular conformation. According to the scoring results of LibDockScore, the top 3000 compounds with higher scores were selected as candidate molecules for subsequent precise docking.

[0045] The virtual screening process includes the following steps: (1) Processing of the small molecule compound library. The small molecule compound library downloaded from the ZINC database is first subjected to energy minimization and protonation to ensure the rationality of the molecular structure and the accuracy of the charge distribution; (2) Definition of the active site of the PVYHC-Pro protein; (3) Preliminary screening of compounds. Using the LibDock module, based on a molecular weight of 150 - 250 Da, the ZINC small molecule compound database (https: / / zinc.docking.org / ) is preliminarily screened with the PVYHC-Pro protein as the target, and the top 3000 compounds in terms of scoring values are retained. This step aims to quickly narrow down the range of candidate molecules and reduce the subsequent computational amount; (4) Precise docking. For the 3000 compounds preliminarily screened, CDOCKER is used for precise docking. The docking parameters are set as follows: heating temperature 700 K, cooling steps 5000, orientation threshold 0.5, orientation dynamics 20. According to indicators such as binding free energy, hydrogen bond interaction, and hydrophobic interaction, candidate compounds are further screened out.

[0046] Analysis and visualization of the molecular docking results: After the precise docking is completed, the docking results are analyzed based on indicators such as binding free energy, hydrogen bond interaction, and hydrophobic interaction. The lower the binding free energy, the more stable the binding between the ligand and the receptor. Hydrogen bond interaction and hydrophobic interaction further reveal the specific binding mode between the ligand and the receptor. To verify the reliability of the docking results, Discovery Studio 2019 is used to simulate and verify the binding site between the target compound and PVYHC-Pro. First, the protein molecule is preprocessed to remove irrelevant ligands and water molecules in the PDB file and insert polar hydrogen atoms. Subsequently, the small molecule is docked with the protein using LibDock, and the docking conformation with the highest LibDockScore is selected, followed by precise CDOCKER docking. The interaction mode with the highest -CDOCKER_ENERGY (-ECD) and the highest -CDOCKER_INTERACTION_ENERGY (-IECD) is selected as the final docking result. Finally, the PyMOL software is used to visualize the four groups of docking results with the lowest binding energy. The interaction between the PVYHC-Pro protein and the compound is demonstrated through PyMOL and Discovery Studio 2019.

[0047] Results:

[0048] During the virtual screening process, for the small molecules screened from the ZINC small molecule compound database using the PVY HC-Pro protein as the target, compounds with a LibDockScore ranking in the top 5% and a score greater than 110 were selected. Finally, naringin (ZINC ID: 8143604) was found to exhibit a high binding affinity with PVY HC-Pro in both the preliminary screening and the precise docking, and thus was selected as a potential PVY inhibitor.

[0049] The molecular docking results showed that naringin formed three hydrogen bonds with the PVY HC-Pro protein, interacting with the residues PRO337, SER341, GLU221, GLY218, ASN214, ASP335, and GLU342 ( Figure 3 A). Among them, the PRO337 and SER341 residues stabilized the binding of the ligand to the receptor by forming hydrogen bonds with the hydroxyl groups of naringin. In addition, stable hydrophobic interactions were formed between the flavonoid backbone of naringin and the residues Val-143, Ile-167, and Leu-191. These hydrophobic interactions were mainly achieved through van der Waals forces, further enhancing the binding stability of the ligand to the receptor. Although the binding free energy of naringin (-7.6 kcal / mol) was slightly lower than that of the control agent Ningnanmycin (NNM) (-8.2 kcal / mol) ( Figure 3 B), its interaction mode with the key residues of the PVY HC-Pro protein indicated that naringin might play an antiviral role by inhibiting the function of the protein active site.

[0050] To more intuitively display the molecular docking results, PyMOL was used to visualize the docking result with the lowest binding energy, showing the interaction between PVY HC-Pro and the compound, including the connected amino acid residues and the bond lengths of the hydrogen bonds. The hydrogen bond lengths between naringin and PVY HC-Pro were (PRO337), (SER341), and (GLU221), indicating strong interactions of these hydrogen bonds ( Figure 3 C). The hydrogen bond lengths between Ningnanmycin and PVY HC-Pro were (ASN214), (LEU336), (LYS321), and (LYS338) ( Figure 3 D).

[0051] 2.3 Molecular Dynamics Simulation and Free Energy Calculation

[0052] To study the dynamic behavior of the ligand-receptor complex, molecular dynamics simulations (MD) were performed using the Amber16 software. First, the antechamber module was used to assign bcc charges to naringin and ningnanmycin, and the topology and coordinate files of the complex were constructed through the Leap module. The AMBER ff14SB force field was used to describe the protein, the GAFF force field was used to describe the ligand, and they were placed in the TIP3P water model (boundary extension ). Before the MD simulation, energy minimization was carried out, followed by a 100-ns simulation. The simulation process included: 10 ps of water molecule equilibration, 50 ps of system heating (from 10 K to 298 K), and 100 ns of simulation. The SHAKE algorithm was used to constrain hydrogen bonds, and the PME method was used to handle long-range electrostatic interactions, with a cutoff radius of During the simulation, the time step was 2 fs, and data were collected every 1 ps. Finally, the Xmgrace software was used to analyze key parameters such as the root mean square deviation (RMSD), radius of gyration (Rg), root mean square fluctuation (RMSF), number of hydrogen bonds, and solvent accessible surface area (SASA) of the system to evaluate the stability and dynamic characteristics of the complex.

[0053] The MM-PBSA method was used to accurately calculate the binding free energy (ΔGbind) of the ligand-receptor complex. The calculation of the binding free energy was based on the principle of thermodynamic cycle and was obtained by comparing the free energy differences between the complex (Gcpx) and the free receptor (Grec) and ligand (Glig). During the calculation, all parameters were set to the default settings of the Amber16 program to ensure the consistency and reliability of the calculation.

[0054] Results:

[0055] To further determine the interaction between naringin and PVYHC-Pro, we performed molecular dynamics simulations. During the 100-ns MD simulation, the conformational fluctuations of the complex of naringin and ningnanmycin with PVYHC-Pro tended to stabilize in the later stage of the simulation. The binding mode extracted from the MD simulation ( Figure 4A, B) show that naringin forms a single hydrogen bond with protein residue S101 through its glycoside group, and its phenolic hydroxyl group forms abundant hydrogen bonds with R71, D85 and Y2 respectively. This interaction limits the degree of freedom of the binding pocket conformation, making the binding of naringin to PVYHC-Pro more stable. In contrast, ningnanmycin only forms a single hydrogen bond with D85, the amino group on the pyrimidine ring and N12 through the amide group, and fails to directly interact with S101 and R71. This weaker binding mode leads to increased flexibility of the R71 side chain.

[0056] To quantify the stability of protein structure, we calculated the root mean square deviation (RMSD) of the protein backbone. The RMSD value reflects the degree of change in the protein conformation relative to the initial structure, and a lower RMSD value generally indicates that the complex structure is more stable. Both the naringin and ningnanmycin systems showed a relatively stable state in the 100ns simulation. Naringin almost reached equilibrium after 25ns of fluctuation, while ningnanmycin experienced slight ups and downs throughout the simulation. Specifically, the average protein backbone RMSD scores of naringin and ningnanmycin were and This indicates that the protein structure fluctuates less and is more stable after binding with naringin ( Figure 4 C).

[0057] To gain a deeper understanding of the stability of the protein-ligand complex, we further analyzed the radius of gyration (Rg) and solvent accessible surface area (SASA) of the complex. The radius of gyration reflects the compactness of the protein structure, while SASA characterizes the protein surface area accessible to solvent molecules. The Rg motion of naringin and ningnanmycin remained stable during the simulation, and their average Rg values ​​were 1.420±0.01nm and 1.418±0.01nm, respectively, indicating that both maintained structural integrity during the simulation ( Figure 4 D). However, SASA analysis revealed a more significant difference, with a higher degree of burial on the protein surface when naringin was bound, suggesting that it may achieve stable binding through stronger hydrophobic interactions or more optimal spatial matching ( Figure 4 E). Further probability distribution analysis showed that the SASA value of naringin showed a single narrow peak distribution (half peak width ), indicating that its binding conformation is highly stable; while the SASA distribution range of Ningnanmycin is relatively wide (half-peak width 40nm 2 ), and in the high SASA region (~640nm 2 ) showed a secondary peak, suggesting that there may be a dynamic transition between two binding modes ( Figure 4 F).

[0058] The binding free energy calculation (MM / PBSA) further confirmed that the binding affinity of naringin to PVY HC-Pro was significantly better than that of ningnanmycin. As can be seen from Table 1, the binding free energy of naringin was -37.46 ± 2.8 kcal / mol, while that of ningnanmycin was -34.20 ± 3.8 kcal / mol. This result was consistent with the trend of SASA analysis. In addition, hydrogen bonds are key factors in protein-ligand interactions, and their formation and stability directly affect the affinity and specificity of the complex. From the hydrogen bond diagram ( Figure 4 G), it can be seen that more hydrogen bonds were formed between naringin and PVY HC-Pro.

[0059] To evaluate the conformational fluctuations of the residues in the protein binding pocket, we calculated the root mean square fluctuation (RMSF). The RMSF value reflects the average conformational change degree of protein residues during the simulation. As Figure 4 shown in H, the average RMSF value of the residues in the protein binding pocket when naringin was bound was lower than that of the ningnanmycin system This result indicated that the binding of naringin more effectively inhibited the conformational fluctuations of the protein binding site, thereby enhancing the overall stability of the complex.

[0060] Table 1 Binding free energy of compounds to PVYHC-Pro

[0061]

[0062]

[0063] 2.4 Expression of recombinant protein in prokaryotic cells

[0064] (1) The PVYHC-Pro gene was ligated to the vector pMCSG19 (containing His tag) and transformed into Escherichia coli Rosetta(DE3), BL21-star, and BL21(DE3), and then spread on LB plates containing Amp and cultured overnight at 37 °C;

[0065] (2) The monoclonal was inoculated into LB liquid medium containing Amp and cultured at 37 °C and 200 rpm for 12 h;

[0066] (3) The bacteria were cultured with shaking at a ratio of 1:100 at 37 °C and 220 rpm until the OD 600 reached 0.5, and then isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.4 mM, 0.6 mM, or 0.8 mM, and the protein was induced to express for 12 - 18 h at 8, 16, or 25 °C respectively;

[0067] (4) Collect the bacterial liquid, centrifuge at 5,000 rpm for 10 min at 4°C, discard the supernatant, and collect the precipitate.

[0068] (5) Suspend the precipitate with pre-cooled protein lysis buffer; wherein, the protein lysis buffer composition is: 20 mM Tris-HCl, pH 7.4, 1 mM EDTA, 200 mM NaCl, 10% glycerol, add 1 mM PMSF and 1 mM DTT before use.

[0069] (6) Add lysozyme, and use an ultrasonic disruptor to fully disrupt the bacterial cells, ultrasonic for 4 s, interval 6 s, for a total of 10 min.

[0070] (7) Centrifuge at 15,000 rpm for 10 min at 4°C.

[0071] (8) Carefully aspirate the supernatant and store it at -80°C or perform SDS-PAGE electrophoresis detection.

[0072] Using affinity chromatography purification technology, the affinity purification of PVY HC-Pro protein (with His tag) is achieved through the chelation of His tag with nickel ions in the nickel column. First, load the supernatant of the disrupted Escherichia coli into the nickel ion affinity column. At this stage, most of the miscellaneous proteins cannot bind to the nickel column and flow out with the breakthrough solution, while the target protein with His tag specifically binds to nickel ions through its polyhistidine sequence and is adsorbed on the column. Subsequently, use the eluent to wash the affinity column to remove the residual non-specific binding miscellaneous proteins. Finally, use the eluent containing imidazole for elution, dissociate the target protein from the column and collect it to complete the purification process.

[0073] Results:

[0074] Transform the recombinant plasmid pMCSG19-HC-Pro (with His tag) into Rosetta(DE3), BL21-star, and BL21(DE3) strains, and induce culture for 16 h at 16°C under the condition of 0.8 mM IPTG. The extracted protein was detected by SDS-PAGE. The results showed that the recombinant plasmid was induced to express in Rosetta(DE3), BL21-star, and BL21(DE3) strains, and an obvious band appeared at 57.9 kDa. Figure 5A), the protein size was consistent with the expectation, indicating that the recombinant protein pMCSG19-HC-Pro could be expressed in the form of inclusion bodies in three strains (lanes 2, 4, and 6). Soluble protein was not expressed in the BL21-star strain (lane 3), and less soluble protein was expressed than inclusion bodies in the Rosetta(DE3) strain (lanes 1 and 2). The strain with the best soluble protein expression was BL21(DE3) (lanes 5 and 6). Therefore, the BL21(DE3) strain was the optimal strain for HC-Pro protein expression.

[0075] After screening out the suitable strain for HC-Pro protein expression, the optimal expression temperature was further screened. Induction was carried out at 8 °C, 16 °C, and 25 °C respectively. The results showed that the HC-Pro protein was expressed at each temperature, but the protein expression was the best at 25 °C ( Figure 5 B). Therefore, 25 °C was selected for subsequent experiments, and the optimal induction time of 12 h at this temperature was used for induction.

[0076] After screening by strain and temperature, we screened the IPTG induction concentration. The recombinant plasmid pMCSG19-HC-Pro was transformed into the BL21(DE3) strain and cultured at 25 °C. When OD 600 = 0.5, IPTG with concentrations of 0.4, 0.6, and 0.8 mM was added for induction. The results showed that the HC-Pro protein was expressed under induction with different concentrations of IPTG, but the most protein was expressed in the supernatant at 0.8 mM, which was the optimal condition ( Figure 5 C).

[0077] Based on the above experimental results, the final optimized parameters were determined as follows: After ligating the PVYHC-Pro gene to the vector, it was transformed into Escherichia coli BL21(DE3), spread on an LB plate containing Amp, and cultured overnight at 37 °C; The monoclonal was inoculated into an LB liquid medium containing Amp, cultured at 37 °C and 200 rpm for 12 h; The bacteria were shaken again at a ratio of 1:100, cultured at 37 °C and 220 rpm until OD600 reached 0.5, and isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.8 mM, and the protein was induced to express at 25 °C for 12 h.

[0078] To obtain the purified HC-Pro protein, affinity purification was carried out using an AKTA system equipped with a nickel (Ni) column, and a single band was successfully obtained ( Figure 6 A, lanes 13 - 16), and the corresponding ultraviolet (UV) absorption peak was also a single peak ( Figure 6 B), indicating good purification effect and it could be used for downstream experiments.

[0079] 2.5 MST Binding Experiment

[0080] (1) Take 90 μL of the purified PVY HC-Pro protein sample at 10 μM, add 10 μL of the labeling agent, mix well, and incubate in the dark for 30 min;

[0081] (2) Add the labeled protein sample to the elution column and detect the fluorescence value of the labeled protein (the protein sample with a fluorescence value of 400 - 1200 is the best);

[0082] (3) Prepare naringin, ningnanmycin, and ribavirin reagent solutions with 16 concentration gradients (0.01, 0.02, 0.05, 0.1, 0.2, 0.5, 1, 2, 5, 10, 20, 50, 70, 80, 90, 100 μM). Take 10 μL of the test agent to be measured and mix it well with an equal amount of the labeled protein, and incubate in the dark for 5 min;

[0083] (4) Aspirate 10 μL of the mixed sample with a capillary tube, add it to the MST instrument for measurement, analyze and process it through the Affinity Analysis software, and fit the data curve to obtain the dissociation constant K d .

[0084] Results:

[0085] To verify the direct interaction between naringin (NAR) and PVY HC-Pro, the microscale thermophoresis (MST) technique was used to detect the affinities of HC-Pro with naringin, ningnanmycin, and ribavirin, respectively. The results showed that the binding force of HC-Pro with naringin (K d = 2.44 ± 3.73) was similar to that of the positive control ningnanmycin (K d = 0.52 ± 0.15), both having relatively high affinities, and it did not bind to the negative control agent ribavirin ( Figure 7 ). The above results indicate that naringin can directly interact with PVY HC-Pro, suggesting its potential to inhibit PVY.

[0086] 2.6 Naringin inhibition of PVY infection experiment

[0087] To detect whether naringin can inhibit the infection of PVY, two days after inoculating Nicotiana benthamiana with PVY-GFP, spray the leaves of Nicotiana benthamiana with naringin (250 μM). The control groups were treated with ningnanmycin (NNM) and 0.1% DMSO respectively. The dosage of the reagents was the same as that of the experimental group, and the leaves of Nicotiana benthamiana were sprayed equally. Observe the GFP fluorescence signals at different times (6, 8, 10 d) after infection with an ultraviolet lamp.

[0088] The results showed that no obvious green fluorescence was observed in the systemic leaves of Nicotiana benthamiana sprayed with naringin and ningnanmycin on the 6th day, and a small amount of fluorescence appeared on the 8th and 10th days. A large amount of fluorescence was observed in the Nicotiana benthamiana sprayed with the control DMSO on the 6th day, and the fluorescence continued to increase on the 8th and 10th days. This indicates that naringin has good inhibitory activity against PVY( Figure 8 A).

[0089] Subsequently, we extracted the samples at the above treatment times, reverse-transcribed them, and then detected the expression of the PVY CP gene by qRT-PCR. The primer sets used for detection were PVY-CP-F: GATGAATGGGCTTATGGTTTGGTG (SEQ ID NO.1); PVY-CP-R: GATTTGCCTAAGGGTTGGTTTCG (SEQ ID NO.2);

[0090] The reaction system involved in the PCR detection is shown in Table 2 below:

[0091] Table 2 PCR reaction system

[0092]

[0093] The PCR reaction procedure was as follows:

[0094] Two-step real-time fluorescence quantitative PCR amplification was used:

[0095] 1) Pre-denaturation: 95°C, 3 min;

[0096] 2) Cycling reaction: denaturation at 95°C for 10 s; annealing at 60°C for 30 s; 40 cycles;

[0097] 3) Melting curve: 95°C, 15 s; 60°C, 60 s; 95°C, 15 s.

[0098] It was found that the expression levels of PVY CP in each treatment group gradually accumulated over time after inoculation. However, the expression levels of the PVY CP gene after NAR and NNM treatments were significantly lower than those in the control treatment group, indicating that NAR can inhibit the transcription of the PVY CP gene( Figure 8 B). The above results indicate that naringin has a good inhibitory effect on the infection of PVY.

[0099] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention should fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of naringin in plant resistance to Potato virus Y.

2. The application according to claim 1, wherein The plant is Nicotiana benthamiana.

3. The application according to claim 1, wherein The naringin inhibits the infection of Potato virus Y by interacting with the HC-Pro protein in Potato virus Y.

4. Application of naringin in the preparation of a product for plant resistance to Potato virus Y.

5. The application according to claim 4, wherein The product is an antiviral preparation.

6. The application according to claim 5, characterized in that, The antiviral preparation further contains a pharmaceutically acceptable carrier or adjuvant.

7. An agent against Potato virus Y, characterized in that, Contains naringin.

8. The preparation according to claim 7, characterized in that, The preparation further contains a pharmaceutically acceptable carrier or adjuvant.

9. The preparation according to claim 7, characterized in that, The concentration of naringin in the preparation is 200 - 300 μM.

10. A method for preventing and controlling the infection of plants by Potato virus Y, characterized in that, The method is to apply the preparation according to any one of claims 7 - 9 to the plant.

Images