Nitrogen acetylated carbazole alkaloid as well as preparation method and application thereof
By constructing the D-J gene plasmid in Streptomyces J1074, fermenting and isolating the nitrogen acetylated carbazole alkaloid compound ATC-A, the preparation problem of lack of N-acetylated carbazole alkaloids in the prior art was solved, and significant antithrombotic activity was achieved, and clinical application value was achieved.
Patent Information
- Application Number
- CN202510248099.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-04
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2045-03-04
AI Technical Summary
In the prior art, the gene responsible for N-acetylation of carbazole compounds has not been discovered, and effective methods for N-acetylated carbazole alkaloids are lacking in preparation of antithrombotic drugs.
By constructing the plasmid pRJ331 containing the D-J gene and transferring it to Streptomyces J1074, fermenting and isolating the nitrogen acetylated carbazole alkaloid compounds ATC-A and ATC-B, it was prepared by biosynthesis methods, including shock culture, chromatography separation and recrystallization.
The obtained nitrogen acetylated carbazole alkaloid ATC-A showed significant antithrombotic activity in the thrombotic zebrafish model, and had the potential to develop as an antithrombotic drug by downregulating the expression of coagulation cascade-related genes.
Smart Images

Figure CN120271494A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical fields of chemical biology and medicinal chemistry. Specifically, it relates to a nitrogen-acetylated carbazole alkaloid, its preparation method and application. Background Art
[0002] The tricyclic carbazole structure is the core skeleton of many bioactive molecules in drugs. Natural molecules containing the carbazole structure have various biological activities, such as neuroprotection, antibacterial, anti-tumor, antiviral, anti-inflammatory and anti-malarial activities (Chem Rev. 2012, 112, 3193 - 3328; 2015, 94: 405 - 426). The biosynthetic pathways of carbazole natural molecules lavanduquinocin, carquinostatin A and neocarazostatin B derived from Streptomyces use carbazole-3,4-quinone as a common precursor ( Figure 1 is a schematic diagram of the biosynthetic pathway of carbazole natural molecules derived from Streptomyces. Among them, a) is a schematic diagram of the biosynthetic pathway of tricyclic carbazole derived from Streptomyces; b) is a schematic diagram of the comparison of the biosynthetic gene clusters of three types of tricyclic carbazole alkaloids derived from Streptomyces and the identity of the key gene-encoded protein sequences. In the figure, the genes involved in the biosynthesis of carbazole-3,4-quinone are marked in gray. As Figure 1 shown in a) therein) ( 2020, 10(8):1147; 2023 Jan 20;18(1):123 - 133). The biosynthetic gene clusters of LDQ, CQS-A, and NZS-B are respectively BGC, BGC, BGC, containing highly homologous genes responsible for the biosynthesis of carbazole-3,4-quinone ( Figure 1 shown in b) therein). The main steps of the biosynthesis of carbazole-3,4-quinone mainly include: (1) L-tryptophan is deaminated by aminotransferase to produce indole-3-pyruvic acid (IPA); (2) ThDP-dependent acetolactate synthase decarboxylates and couples IPA and pyruvic acid to produce an unstable α-hydroxy- β-keto acid; (3) The decarboxylated intermediate int-1 and the α-hydroxybutyryl group loaded on ACP (acyl carrier protein) condense to form intermediate int-2; (4) Carbazole cyclase cyclizes int-2 to generate carbazole-3,4-quinone ( Figure 1 shown in a) therein) ( (2023 Jan 20;18(1):123 - 133). There are various enzyme - catalytic elements in the bacterial tricyclic carbazole biosynthetic pathway, which can structurally derivatize and modify the carbazole nucleus, such as isoprenylation, methylation, amination, N - acetylation ( 2020, 10(8):1147). Some N - acetylated carbazole alkaloids have good potential for medicinal activities, such as the antioxidant activity of antiostatin A1 ( 1990, 43 (10), 1337 - 1340). N - acetylation is common in the post - modification of natural products and is generally responsible by N - acetyltransferases ( 2008, 9: 628 - 60). However, the N - acetyltransferase gene responsible for modifying the carbazole molecular skeleton has not been reported.
[0003] N - acetylation is common in the post - modification of natural products and is generally catalyzed by a class of N - acetyltransferases. However, the gene responsible for the N - acetylation of carbazole compounds has not been discovered. Summary of the Invention
[0004] The object of the present invention is to provide a nitrogen - acetylated carbazole alkaloid.
[0005] Another object of the present invention is to provide a preparation method of the nitrogen - acetylated carbazole alkaloid.
[0006] Another object of the present invention is to provide an application of the nitrogen - acetylated carbazole alkaloid in the preparation of anti - thrombosis drugs.
[0007] To achieve the above objects, the technical solutions adopted by the present invention are as follows:
[0008] In the first aspect of the present invention, there is provided a nitrogen - acetylated carbazole alkaloid or its medicinal salt, and the structure is selected from one of the following structures:
[0009] .
[0010] In the second aspect of the present invention, there is provided a preparation method of the nitrogen - acetylated carbazole alkaloid, including the following steps:
[0011] Transfer the integrative plasmid pRJ331 containing D - J into Streptomyces J1074 to obtain the strain J1074 / pRJ331;
[0012] Pick the mycelium of J1074 / pRJ331 cultured for 2 - 5 days (preferably 4 days) from the SFM plate containing abramycin, inoculate it into the liquid medium TSBY, and perform the first shaking culture to obtain the primary seed liquid;
[0013] The primary seed solution was inoculated into the liquid medium TSBY and subjected to a second shaking culture, and the fermentation broth was collected;
[0014] The fermentation broth was extracted with an equal volume of ethyl acetate at least three times (preferably five times). The combined organic phases were concentrated in vacuo, redissolved in ethyl acetate, extracted with distilled water, and the organic phase was concentrated into an extract. The extract was subjected to VLC chromatography to obtain nine fractions Fr. A–I;
[0015] Fraction Fr. E was separated by MPLC chromatography equipped with an ODS column, and the fractions were combined according to the UV chromatography. Finally, 18 sub-fractions Fr. E1–18 were obtained;
[0016] Compound ATC-A was obtained by recrystallization from sub-fraction Fr. E8;
[0017] Compound ATC-B was obtained from sub-fraction Fr. E9 by HPLC on a semi-preparative column.
[0018] The conditions for the first shaking culture were: shaking culture at 30 °C and 220 rpm for 3 days.
[0019] The liquid medium TSBY: 3% tryptic soy broth, 10% sucrose, 0.5% yeast extract, 0.1% antifoaming agent.
[0020] The inoculation of the primary seed solution into the liquid medium TSBY was carried out at a volume ratio of 1 / 10.
[0021] The conditions for the second shaking culture were: shaking culture at 30 °C and 220 rpm for 6 days.
[0022] The conditions for the VLC chromatography: The VLC chromatography column was packed with 200 - 300 mesh silica gel, and the eluent was a mixed solvent of petroleum ether / EtOAc / MeOH with a volume ratio ranging from 100 / 1 / 0 to 0 / 0 / 1.
[0023] The conditions for the MPLC chromatographic separation: The flow rate was 20 mL / min, the eluent was 10 - 100% MeOH / H2O containing 0.1% formic acid, v / v, and gradient elution was carried out for 5 h.
[0024] The semi-preparative column: Waters Xbridge C18, 10 × 250 mm, 5 μm, 3 mL / min.
[0025] The HPLC conditions for the semi-preparative column: 35% CH3CN / H2O containing 0.1% formic acid, isocratic elution.
[0026] The solvent for recrystallization from sub-fraction Fr. E8 was methanol.
[0027] The preparation method of the strain J1074 / pRJ331 comprises the following steps:
[0028] In the first step, construct a plasmid containing the D-J gene
[0029] Amplify the D-J genes cassette fragment from the genomic DNA of Streptomyces LHW2432 which produces lavanduquinocin, and introduce it into the NdeI and EcoRV sites of the vector pIB139 to obtain pRJ331;
[0030] In the second step, transfer the plasmid pRJ331 into Streptomyces J1074
[0031] Inoculate pRJ331 / DH10B in LB medium containing apramycin, and culture it with shaking (at 37 °C, shaker rotation speed 220 rpm, for 5 h). Until the measured value of the bacterial liquid concentration OD 600 is about 1.0. Centrifuge the bacterial liquid to remove the supernatant (centrifuge at 6000 rpm for 30 S), resuspend the bacterial cells with LB medium and then centrifuge again to collect the bacterial cells to wash the bacterial cells. The washing step is repeated at least 3 times to obtain the first bacterial cells;
[0032] Streptomyces J1074 is inoculated in the liquid medium TSBY, and cultured with shaking (cultured at 30 °C, 220 rpm for 3 days). Take the Streptomyces bacterial liquid, centrifuge it to remove the supernatant (centrifuge at 12000 rpm for 1 min), resuspend the mycelium with LB medium and then centrifuge again to collect the bacterial cells to wash the bacterial cells. After the washing step is repeated at least 2 times, the second bacterial cells are obtained;
[0033] Mix the first bacterial cells containing pRJ331 / DH10B and the Streptomyces The second bacterial cells of J1074 were mixed in LB medium and evenly spread on an SFM (2% soya flour, 2% D-mannitol, 2% agar) plate medium containing MgCl2. After culturing (cultured at 30 °C for 15 hours), it was covered with a covering solution (an aqueous solution containing 25 μg / mL nalidixic acid and 10 μg / mL apramycin). After the plate was air-dried, colonies were visible after culturing (cultured at 30 °C for 4 d). Single colonies were picked and transferred to an SFM plate (containing antibiotics with a final concentration of 25 μg / mL nalidixic acid and 10 μg / mL apramycin) for verification. Mycelia were picked from the verification plate to extract genomic DNA as a PCR template. PCR verification was performed using primer T-331-S with the sequence of SEQ ID NO. 3 and T-331-A with the sequence of SEQ ID NO. 4, and a 411 bp PCR product was obtained. The PCR product was sequenced and confirmed, and finally the strain J1074 / pRJ331 was obtained.
[0034] The said LB medium: 1% tryptone, 0.5% yeast extract, 1% NaCl.
[0035] The first step of constructing a plasmid containing the D-J gene is prepared by the following steps:
[0036] Amplify a PCR fragment containing the D-J genes cassette from the genomic DNA of Streptomyces LHW2432, and recover the target fragment by gel electrophoresis. The primers used are Ldq-S with the sequence of SEQ ID NO. 1 and Ldq-A with the sequence of SEQ ID NO. 2. The vector is obtained by digesting the plasmid pIB139 with NdeI and EcoRV, that is, 2 μg plasmid pIB139, 2 μL each of the restriction endonucleases NdeI and EcoRV, and supplemented with Q-grade water to 40 μL. Digest at 37 °C for 5 h, then add 60 μL of ice-cold isopropanol, centrifuge at 14000 rpm for 10 min. After removing the supernatant, wash the precipitate twice with 80% ethanol, and finally dissolve the DNA with 20 μL of Q-grade water; Use the 2×Ezmax-Muli CloneMix Plus kit to ligate the vector pIB139 (NdeI, EcoRV) and the PCR fragment containing the D-J genescassette; The reaction system is 3 μL of vector DNA (20 ng / μL), 1 μL of insert fragment (60 ng / μL), 4 μL of Q-grade water, react at 50 °C for 1 h, take the reaction solution and transform it by calcium into DH10B, and finally confirm the target clone pRJ331 / through sequencing DH10B。
[0037] In the third aspect of the present invention, there is provided an application of the N-acetylated carbazole alkaloid or its pharmaceutically acceptable salt in the preparation of a drug for anti-thrombosis.
[0038] The present invention conducts a bioactivity evaluation on a thrombotic zebrafish model and finds that compound ATC-A can restore the number of red blood cells in the heart, showing an activity of dose-dependently reducing the staining area / intensity of venous thrombosis and restoring blood flow, and significantly promoting the peripheral platelet circulation of thrombotic zebrafish; the pretreatment of compound ATC-A significantly reverses the up-regulated transcription of genes 、 and related to the coagulation cascade. Therefore, the compounds of the present invention are expected to be developed into anti-thrombotic agents.
[0039] Due to the adoption of the above technical solutions, the present invention has the following advantages and beneficial effects:
[0040] The present invention discloses an N-acetylated carbazole alkaloid produced by fermentation of Streptomyces J1074, and provides a biosynthetic preparation method, which is more environmentally friendly and has lower costs compared with the chemical synthesis method; compound ATC-A provided by the present invention shows significant anti-thrombotic activity in a thrombotic zebrafish model, which may be related to the down-regulation of gene expression related to the coagulation cascade, and has important development prospects and clinical application values. BRIEF DESCRIPTION OF THE DRAWINGS
[0041] Figure 1 is a schematic diagram of the biosynthetic pathway of carbazole natural molecules derived from Streptomyces.
[0042] Figure 2 is a schematic diagram of the 2D NMR (DMSO- ) correlation of compounds ATC-A and ATC-B.
[0043] Figure 3 is a schematic diagram of HR-ESI-MS of compound ATC-A.
[0044] Figure 4 is a schematic diagram of the UV of compound ATC-A.
[0045] Figure 5 is a schematic diagram of the IR of compound ATC-A.
[0046] Figure 6 is of compound ATC-A 1 1H-NMR schematic diagram.
[0047] Figure 7 is of compound ATC-A 13Schematic diagram of \(^{13}\)C-NMR.
[0048] Figure 8 It is the DEPT 135 schematic diagram of compound ATC-A.
[0049] Figure 9 It is of compound ATC-A 1 H- 1 H COSY schematic diagram.
[0050] Figure 10 It is the HSQC schematic diagram of compound ATC-A.
[0051] Figure 11 It is the HMBC schematic diagram of compound ATC-A.
[0052] Figure 12 It is the NOESY spectrum schematic diagram of compound ATC-A.
[0053] Figure 13 It is the HR-ESI-MS schematic diagram of compound ATC-B.
[0054] Figure 14 It is the UV schematic diagram of compound ATC-B.
[0055] Figure 15 It is the IR schematic diagram of compound ATC-B.
[0056] Figure 16 It is of compound ATC-B 1 \(^{1}\)H-NMR schematic diagram.
[0057] Figure 17 It is of compound ATC-B 13 \(^{13}\)C-NMR schematic diagram.
[0058] Figure 18 It is the DEPT 135 schematic diagram of compound ATC-B.
[0059] Figure 19 It is of compound ATC-B 1 H- 1 H COSY schematic diagram.
[0060] Figure 20 It is the HSQC schematic diagram of compound ATC-B.
[0061] Figure 21 It is the HMBC schematic diagram of compound ATC-B.
[0062] Figure 22 It is the NOESY spectrum schematic diagram of compound ATC-B.
[0063] Figure 23 Schematic diagram of the bioactivity evaluation results of compound ATC-A on a thrombotic zebrafish model. Detailed implementation manners
[0064] To illustrate the present invention more clearly, the present invention will be further described below in conjunction with preferred embodiments. Those skilled in the art should understand that the content specifically described below is illustrative rather than restrictive, and should not be used to limit the protection scope of the present invention.
[0065] Depository description:
[0066] Strain name: J1074 / pRJ331;
[0067] Depository number: CCTCC M 2025142;
[0068] Taxonomic nomenclature: ;
[0069] Depository date: January 15, 2025;
[0070] Depository institution: China Center for Type Culture Collection;
[0071] Address of the depository institution: Wuhan University, Wuhan, China.
[0072] Example 1 Construction D-J::J1074 heterologous expression strain
[0073] Transfer the integrative plasmid pRJ331 containing D-J into Streptomyces J1074 (the BioSample number of this strain in the National Center for Biotechnology Information database is SAMN02603310) (Zaburannyi N, et al. Insights into naturally minimised Streptomyces albus J1074 genome. BMC Genomics, 2014, 15:97) to obtain the strain J1074 / pRJ331 for heterologous production of ATCs.
[0074] First step, construct a plasmid containing D-J gene.
[0075] Amplify and obtain from the genomic DNA of Streptomyces LHW2432 (strain depository number is CGMCC No. 26633) that produces lavanduquinocin The D-J genes cassette fragment was introduced into the NdeI and EcoRV sites of vector pIB139 to obtain pRJ331.
[0076] The specific steps are as follows: First, a PCR fragment containing the D-J genescassette was amplified from the genomic DNA of Streptomyces LHW2432, and the target fragment was recovered by gel electrophoresis. The primers used were Ldq-S (CAATCGTGCCGGTTGGTAGGATCCACATATGCCCGAAAAAGTGGTTCGCAATGACG, SEQ ID NO. 1) and Ldq-A (AACAGCTATGACATGATTACGAATTCGATATCTTACGCCAAGGCCCGCAGCACCGC, SEQ ID NO. 2). The vector was obtained by digesting plasmid pIB139 with NdeI and EcoRV, i.e., 2 μg of plasmid pIB139, 2 μL each of restriction endonucleases NdeI and EcoRV, supplemented with Q-grade water to 40 μL, digested at 37 °C for 5 h, then 60 μL of ice-cold isopropanol was added, centrifuged at 14000 rpm for 10 min, the supernatant was removed, and the precipitate was washed twice with 80% ethanol, and finally the DNA was dissolved in 20 μL of Q-grade water. The vector pIB139 (NdeI, EcoRV) and the PCR fragment containing the D-J genescassette were ligated using the 2×Ezmax-Muli CloneMix Plus (Shanghai Tulugang Biotechnology Co., Ltd.) kit. The reaction system was 3 μL of vector DNA (20 ng / μL), 1 μL of insert fragment (60 ng / μL), 4 μL of Q-grade water, and reacted at 50 °C for 1 h. 10 μL of the reaction solution was transformed into DH10B by calcium transformation. Finally, the target clone pRJ331 / DH10B was confirmed by sequencing.
[0077] In the second step, plasmid pRJ331 was transferred into Streptomyces J1074.
[0078] pRJ331 / DH10B was inoculated into LB medium (Luria-Bertani Medium, 1% tryptone, 0.5% yeast extract, 1% NaCl), and the final concentration of antibiotics in this medium was: apramycin 50 μg / mL. The culture conditions were 37 °C, shaker speed 220 rpm, for 5 h until the bacterial liquid concentration OD 600The measured value is about 1.0. Take 1.5 mL of the bacterial solution, centrifuge it at 6000 rpm for 30 s, discard the supernatant, then resuspend the bacterial cells with 1 mL of LB medium and centrifuge again to collect the bacterial cells for washing the bacterial cells. Repeat the washing step 3 times to obtain the first bacterial cells.
[0079] Streptomyces Inoculate J1074 into a 100 mL Erlenmeyer flask equipped with a spring, containing 25 mL of liquid medium TSBY (Tryptic Soy Broth, tryptic soy peptone liquid medium, the formula is 3% tryptic soy broth, 10% sucrose, 0.5% yeast extract, 0.1% antifoaming agent), culture it at 30 °C with shaking at 220 rpm for 3 days. Take 0.5 mL of the Streptomyces bacterial solution, centrifuge it at 12000 rpm for 1 min, discard the supernatant, then resuspend the mycelium with 1 mL of LB medium and centrifuge again to collect the bacterial cells for washing the bacterial cells. Repeat the washing step 2 times to obtain the second bacterial cells.
[0080] Mix the first bacterial cells (the amount of bacterial cells is about 20 μL) containing pRJ331 / DH10B and the second bacterial cells (the amount of bacterial cells is about 50 μL) containing Streptomyces J1074 in 150 μL of LB medium, and spread it evenly on the SFM (2% soya flour, 2% D-mannitol, 2% agar) plate medium containing 10 mM MgCl2. After culturing at 30 °C for 15 hours, cover it with a covering solution, and the covering solution is 1 mL of aqueous solution containing 25 μg / mL nalidixic acid and 10 μg / mL apramycin. After the plate is dried, culture it at 30 °C for 4 d, and then the conjugative transconjugants can be seen. Pick a single colony and transfer it to an SFM plate (containing the final concentration of antibiotics: nalidixic acid 25 μg / mL, apramycin 10 μg / mL) for verification. Pick the mycelium from the verification plate to extract genomic DNA as the PCR template, and perform PCR verification with primers T-331-S (SEQ ID NO. 3) and T-331-A (SEQ ID NO. 4) (as shown in Table 1). Obtain a 411 bp PCR product, sequence and confirm this PCR product, and finally obtain the strain J1074 / pRJ331.
[0081] Table 1
[0082]
[0083] Step 3, ferment the strain J1074 / pRJ331 and extract and isolate its metabolites to obtain ATCs
[0084] Pick the mycelium of J1074 / pRJ331 cultured for 4 days from the SFM plate (containing 10 μg / mL abramycin), and inoculate it into a 100 mL Erlenmeyer flask with a spring, which contains 25 mL of liquid medium TSBY. Cultivate it at 30 °C with shaking at 220 rpm for 3 days to obtain the primary seed liquid. The primary seed liquid was inoculated into a 500 mL Erlenmeyer flask with a spring at 1 / 10 (v / v), which contains 100 mL of liquid medium TSBY. Cultivate it at 30 °C with shaking at 220 rpm for 6 days, and collect 18 L of fermentation broth.
[0085] Extract the fermentation broth five times with an equal volume of ethyl acetate (EtOAc). Concentrate the combined organic phase in vacuo and then redissolve it in 1 L of EtOAc. Extract the EtOAc phase with 1 L of distilled water to remove sugars and salts, and then concentrate the organic phase into an extract (18 g). The extract was passed through a VLC column packed with 200 - 300 mesh silica gel, and the eluent was a mixed solvent of petroleum ether / EtOAc / MeOH (from 100 / 1 / 0 to 0 / 0 / 1, v / v) to obtain nine fractions Fr. A–I.
[0086] Fraction Fr. E (0.86 g) was separated by MPLC equipped with an ODS column (Santai Technologies, Inc., Spherical C18, 31.2 × 257.4 mm, 15 μm, 100 Å), with a flow rate of 20 mL / min. The eluent was 10 - 100% MeOH / H2O (0.1% formic acid, v / v), and gradient elution was carried out for 5 h. The fractions were combined according to the UV chromatogram, and finally 18 sub - fractions Fr. E1–18 were obtained.
[0087] 4.7 mg of compound ATC - A was obtained from 256.5 mg of sub - fraction Fr. E8 by recrystallization (the solvent is methanol).
[0088] Compound ATC - B (10 mg, t R = 29.2 min) was obtained from 31 mg of sub - fraction Fr. E9 by HPLC using a semi - preparative column (Waters Xbridge C18, 10 × 250 mm, 5 μm, 3 mL / min). The HPLC conditions were: isocratic elution with 35% CH3CN / H2O (0.1% formic acid) at a flow rate of 3 mL / min.
[0089] Structure identification of compound ATC - A and ATC - B:
[0090] The compounds of the present invention were identified by a variety of modern spectroscopic techniques, including NMR, HR - ESI - MS, UV and optical rotation.
[0091] The structures of compounds ATC-A (Antithromcarb-A) and ATC-B (Antithromcarb-B) are as follows:
[0092]
[0093] Compound ATC-A: Reddish-brown needle crystals. UV (MeOH): max (log ) 219 (3.92), 239(3.85), 301 (3.63), 349 (3.19) nm; 1D and 2D NMR data are shown in Table 2 and Figures 2 to 12 as shown; HR-ESI-MS 297.1597 [M + H] + (calcd for C 18 H 21 N2O2 + , 297.1606). Figure 2 is the 2D NMR (DMSO- ) correlation diagram of compounds ATC-A and ATC-B. Figure 3 is the HR-ESI-MS diagram of compound ATC-A. Figure 4 is the UV diagram of compound ATC-A. Figure 5 is the IR diagram of compound ATC-A. Figure 6 is of compound ATC-A 1 1H-NMR diagram. Figure 7 is of compound ATC-A 13 13C-NMR diagram. Figure 8 is the DEPT 135 diagram of compound ATC-A. Figure 9 is of compound ATC-A 1 1H- 1 1H COSY diagram. Figure 10 is the HSQC diagram of compound ATC-A. Figure 11 is the HMBC diagram of compound ATC-A. Figure 12 is the NOESY spectrum diagram of compound ATC-A.
[0094] Compound ATC-B: Reddish-brown needle crystals. UV (MeOH): max (log ) 203 (4.16), 251(4.13), 348 (3.80) nm; 1D and 2D NMR data are shown in Table 3 and Figures 13 to 22As shown, HR-ESI-MS 297.1598 [M + H] + (calcd for C 18 H 21 N2O2 + , 297.1606). Figure 13 is the HR-ESI-MS diagram of compound ATC-B. Figure 14 is the UV diagram of compound ATC-B. Figure 15 is the IR diagram of compound ATC-B. Figure 16 is of compound ATC-B 1 1H-NMR diagram. Figure 17 is of compound ATC-B 13 13C-NMR diagram. Figure 18 is the DEPT135 diagram of compound ATC-B. Figure 19 is of compound ATC-B 1 1H- 1 1H COSY diagram. Figure 20 is the HSQC diagram of compound ATC-B. Figure 21 is the HMBC diagram of compound ATC-B. Figure 22 is the NOESY spectrum diagram of compound ATC-B.
[0095] Table 2 NMR data of ATC-A
[0096]
[0097] Table 3 NMR data of ATC-B
[0098]
[0099] Example 2
[0100] Detection of antithrombotic activity of compound ATC-A:
[0101] Bioactivity assays using a thrombotic zebrafish model showed that compound ATC-A exhibited significant antithrombotic activity, possibly by downregulating the gene expression related to platelet activation and the coagulation cascade.
[0102] 1. Maintenance and embryo collection of zebrafish.
[0103] The zebrafish (Danio rerio) strains used in this experiment were AB wild-type and transgenic zebrafish line cd41:eGFP (purchased from the Institute of Biology, Qilu University of Technology). Male and female zebrafish were kept separately in an automatic recirculating aquarium at 28.0 °C ± 0.5 °C with a light / dark cycle of 14 / 10 hours. Embryos were obtained from natural spawning. After fertilization, the eggs were collected, washed and disinfected with methylene blue solution, and then placed in zebrafish embryo culture water containing 5.0 mM NaCl, 0.17 mM KCl, 0.4 mM CaCl2 and 0.16 mM MgSO4 in a constant temperature light incubator at 28.0 °C ± 0.5 °C. At 6 hours post-fertilization (hpf, hours post-fertilization), 1-phenyl-2-thiourea was added to the culture medium to a final concentration of 0.03 mg / mL to inhibit melanin formation. The zebrafish embryo culture water was changed every 24 hours.
[0104] 2. Chemical treatment and thrombus model establishment.
[0105] Zebrafish larvae at 72 hpf were selected under a microscope and transferred to a 24-well culture plate. They were randomly divided into six groups: control group (Ctrl), arachidonic acid (AA) model group, aspirin (ASP) positive control group and experimental groups (2.5 μM, 5 μM, 10 μM). Each group was repeated three times, and each well contained 10 larvae for each repetition. They were pretreated with aspirin (ASP) (22.5 μg / mL) or the test compound. After 6 h of treatment, the solution was aspirated, and then the control group was treated with fish culture water, and the other groups were modeled with 80 μM AA. The plate was incubated at 28 ± 0.5 °C for 1 hour. At the end of the treatment, the liquid was aspirated with a pipette, and then the zebrafish larvae were stained with 1.0 mg / mL O-dianisidine dye liquor in the dark for 10 min. After washing 3 times with zebrafish embryo culture water, each zebrafish was fixed with 4% paraformaldehyde.
[0106] 3. Screening of antithrombin activity by measuring red blood cells in the zebrafish heart.
[0107] Images of zebrafish heart and tail thrombi were taken by a fluorescence microscope (AXIO-V16, Zeiss, Germany). The stained area and intensity of red blood cells in the zebrafish heart and tail thrombi were quantified using Image Pro Plus software (MediaCybernetics, Bethesda, USA).
[0108] 4. Quantification of caudal artery thrombosis and blood flow.
[0109] AB strain zebrafish larvae at 72 hpf were grouped and treated with the above methods. The experimental groups were pretreated with compound ATC-A at concentrations of 2.5, 5, and 10 μM, respectively. Images of cardiac red blood cells and caudal thrombi were taken by fluorescence microscopy. Seven zebrafish were randomly selected from each group for measuring the blood flow velocity of the caudal artery. The Zebralab blood flow system (ViewPoint, Lyon, France) was used to record the dynamic blood flow for 15 seconds. For video analysis, the landmark measurement area of the caudal artery was manually located. The number of all passing red blood cells was automatically calculated, and hemodynamic images were obtained by MicroZebraLab Blood Flow v.3.4.6.
[0110] 5. Real-time quantitative PCR (RT-qPCR) analysis.
[0111] At 79.5 hpf after treatment, 30 healthy zebrafish larvae were collected from each group, and RNA was extracted according to the instructions of the Fast Pure Cell / Tissue Total RNA Isolation Kit-BOX2. RNA was transcribed into cDNA according to HiScript III RTSuperMix for qPCR instructions. According to the ChamQ Universal SYBR qPCR Premix instructions, qPCR analysis was performed using a LightCycler 96 instrument. Each group was subjected to three RT-qPCRs, and the housekeeping gene was used as a control for normalization analysis. The method was used to quantify the relative expression levels of genes related to coagulation cascade factors ( , and ). The primers used for RT-qPCR were (forward: TCTGGAGGACTGTAAGAGGTATGC (SEQ ID NO. 5); reverse: AGACGCACAATCTTGAGAGCAG (SEQ ID NO. 6)), (forward: TCAGTCCAGCGTGCCTTATG (SEQ ID NO. 7); reverse: GCGTATGTCAAGCGGTAAGC (SEQ ID NO. 8)), (forward: TCATCGTCCGCCTTGGAAAA (SEQ ID NO. 9); reverse: TCGGTTCAGGTTTTCCTTCCA (SEQ ID NO. 10)), and (forward: TCAGAGAGCCAAGTGCCAAG (SEQ ID NO. 11); reverse: ACATCTGCGAGTCCTCTCCT (SEQ ID NO. 12)).
[0112] Conclusion: Figure 23 It is a schematic diagram of the bioactivity evaluation results of compound ATC-A on the thrombotic zebrafish model. Among them, a is a schematic diagram of the results of the staining area / intensity of red blood cells in the heart by compound ATC-A, b is a schematic diagram of the staining area and intensity of red blood cells in the caudal artery, c is a schematic diagram of the blood flow velocity in the caudal artery, and d is a schematic diagram of the relative mRNA levels of thrombosis-related genes. #### < 0.0001 vs Ctrl; * < 0.05, ** < 0.01, *** < 0.001, **** <0.0001 vs AA. GraphPad Prism v.9.0 was used for statistical analysis of one-way ANOVA and Dunnett's multiple comparison test. <0.05 was considered significant.
[0113] After thrombosis, the number of red blood cells in the heart decreased, and the number of red blood cells in the tail increased. Figure 23 In a, compared with the control group, the staining area and intensity of red blood cells in the heart of the AA model group were significantly reduced, indicating that AA successfully induced thrombosis in zebrafish. Compared with the model group, the staining area and intensity of red blood cells in the heart of the positive control Asp were significantly increased, indicating that Asp significantly improved AA-induced thrombosis. In addition, compared with the model group, the zebrafish hearts in the experimental groups (2.5 μM, 5 μM, 10 μM) showed an increase in the staining area and intensity of red blood cells, indicating that compound ATC-A has a therapeutic effect on AA-induced thrombosis in zebrafish. Among the three concentrations of compound ATC-A, compound ATC-A at a concentration of 2.5 μM had the same activity as the positive control drug aspirin (ASP).
[0114] Figure 23In b, it shows that compared with the control group, the staining area and intensity of red blood cells in the tails of zebrafish in the AA model group were significantly increased. Compared with the model group, the staining area and intensity of red blood cells in the tails of the positive control Asp group were decreased, indicating that Asp improved AA-induced thrombosis. In addition, compared with the model group, the zebrafish tails in the experimental groups (2.5 μM, 5 μM, 10 μM) showed a decrease in the staining area and intensity of red blood cells, indicating that the compound ATC-A has a therapeutic effect on AA-induced thrombosis in zebrafish and shows an activity of dose-dependently reducing the staining area / intensity of tail thrombus. Figure 23 In c, it shows that compared with the control group, the blood flow velocity and heart rate of the zebrafish tail blood vessels in the AA model group were significantly slowed down. Compared with the model group, Asp and the compound ATC-A significantly improved the blood flow velocity and heart rate. The pretreatment of the compound ATC-A showed a dose-dependent restoration of blood flow, thus significantly promoting the peripheral platelet circulation in thrombotic zebrafish. Thrombin , fibrinogen, a key protein in the coagulation cascade and when the levels are significantly increased, it will lead to a hypercoagulable state and thrombosis ( . 2023, 314, 116397). Figure 23 In d, it shows that compared with the control group, in the AA model group , and showed upregulated expression. Compared with the model group, the positive control Asp and the compound ATC-A significantly reversed the upregulated expression of , and , indicating that the compound ATC-A exerts an antithrombotic function by inhibiting platelet activation and the coagulation cascade.
[0115] In this invention, a bioactivity evaluation was conducted on a thrombotic zebrafish model, and it was found that the compound ATC-A can restore the number of red blood cells in the heart, shows an activity of dose-dependently reducing the staining area / intensity of venous thrombus and restoring blood flow, and significantly promotes the peripheral platelet circulation in thrombotic zebrafish; the pretreatment of the compound ATC-A significantly reversed the upregulated transcription of genes , and related to the coagulation cascade. Therefore, the compound of this invention is expected to be developed into an antithrombotic agent.
[0116] The above are only the preferred embodiments of the present invention, and do not impose any form of limitation on the present invention. Although the present invention has been disclosed as above with the preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art of this patent, without departing from the scope of the technical solution of the present invention, can make some changes or modifications using the technical content prompted above to form equivalent embodiments of equivalent changes. However, as long as it does not depart from the content of the technical solution of the present invention, any simple modification, equivalent change and modification made to the above embodiments according to the technical essence of the present invention still fall within the scope of the technical solution of the present invention.
Claims
1. A nitrogen-acetylated carbazole alkaloid or a medicinal salt thereof, characterized in that, The structure is selected from one of the following structures: 。 2. The preparation method of the N-acetylated carbazole alkaloid according to claim 1, characterized in that, It includes the following steps: Transfer the integrative plasmid pRJ331 containing D-J into Streptomyces J1074 to obtain the strain J1074 / pRJ331; Pick the mycelium of J1074 / pRJ331 cultured for 2 - 5 days from the SFM plate containing abelamycin, inoculate it into the liquid medium TSBY, and perform the first shaking culture to obtain the primary seed liquid; Inoculate the primary seed liquid into the liquid medium TSBY, perform the second shaking culture, and collect the obtained fermentation broth; Extract the fermentation broth with an equal volume of ethyl acetate at least three times, concentrate the combined organic phase under vacuum, redissolve it in ethyl acetate, extract it with distilled water, concentrate the organic phase into an extract, and obtain nine fractions Fr. A - I through VLC chromatography; Fraction Fr. E is separated by MPLC chromatography, equipped with an ODS column, and the fractions are combined according to the ultraviolet chromatography, and finally 18 sub - fractions Fr. E1 - 18 are obtained; Compound ATC - A is obtained by recrystallization from sub - fraction Fr. E8; Compound ATC - B is obtained from sub - fraction Fr. E9 by HPLC on a semi - preparative column.
3. The preparation method of the nitrogen-acetylated carbazole alkaloid according to claim 2, wherein The conditions for the first shaking culture: shaking culture at 30 °C and 220 rpm for 3 days; The liquid medium TSBY: 3% tryptic soy broth, 10% sucrose, 0.5% yeast extract, 0.1% antifoaming agent.
4. The preparation method of the N-acetylated carbazole alkaloid according to claim 2, characterized in that, The inoculation of the primary seed liquid into the liquid medium TSBY is carried out at a volume ratio of 1 / 10. The conditions for the second shaking culture: shaking culture at 30 °C and 220 rpm for 6 days.
5. The preparation method of the N-acetylated carbazole alkaloid according to claim 2, characterized in that, The VLC chromatography conditions: The VLC chromatography column is filled with silica gel of 200 - 300 mesh, and the eluent is a mixed solvent of petroleum ether / EtOAc / MeOH with a volume ratio ranging from 100 / 1 / 0 to 0 / 0 / 1; The MPLC chromatography separation conditions: The flow rate is 20 mL / min, the eluent is 10 - 100% MeOH / H2O containing 0.1% formic acid, v / v, and gradient elution is carried out for 5 h.
6. The preparation method of the N-acetylated carbazole alkaloid according to claim 2, characterized in that, The HPLC conditions on the semi - preparative column: 35% CH3CN / H2O containing 0.1% formic acid, isocratic elution; The solvent for recrystallization from sub - fraction Fr. E8 is methanol.
7. The preparation method of the nitrogen-acetylated carbazole alkaloid according to claim 2, characterized in that, The preparation method of the strain J1074 / pRJ331 includes the following steps: Step 1: Construct a plasmid containing D-J gene Amplified from the genomic DNA of Streptomyces LHW2432, which produces lavanduquinocin D-J gene cassette fragment, and introduced it into the NdeI and EcoRV sites of vector pIB139 to obtain pRJ331; Step 2: Transfer plasmid pRJ331 into Streptomyces J1074 Inoculate pRJ331 / Culture DH10B in LB medium containing apramycin, and culture it with shaking until the OD value of the bacterial liquid is about 1.
0. Centrifuge the bacterial liquid to remove the supernatant, resuspend the bacteria with LB medium, and then centrifuge again to collect the bacteria to wash the bacteria. The washing step is repeated at least 3 times to obtain the first bacteria; 600 The measured value is about 1.
0. Centrifuge the bacterial liquid to remove the supernatant, resuspend the bacteria with LB medium, and then centrifuge again to collect the bacteria to wash the bacteria. The washing step is repeated at least 3 times to obtain the first bacteria; Streptomyces J1074 was inoculated into the liquid medium TSBY and cultured with shaking. After the Streptomyces bacterial solution was centrifuged, the supernatant was removed. The mycelium was resuspended with LB medium and then centrifuged again to collect the thallus for washing the thallus. The washing step was repeated at least 2 times to obtain the second thallus; The first bacterial cells containing pRJ331 / DH10B and the second bacterial cells containing Streptomyces J1074 were mixed in LB medium, evenly spread on an SFM plate medium containing MgCl2, covered with a covering solution after incubation, and visible conjugative transposons were observed after the plate dried. Single colonies were picked and replated on an SFM plate. Mycelia were picked from the replated plate to extract genomic DNA as a PCR template, and PCR verification was performed using the primer T-331-S with the sequence of SEQ ID NO. 3 and T-331-A with the sequence of SEQ ID NO. 4 to obtain a 411-bp PCR product. The PCR product was sequenced and confirmed, and finally the strain J1074 / pRJ331 was obtained.
8. The preparation method of the N-acetylated carbazole alkaloid according to claim 7, characterized in that, The LB medium: 1% tryptone, 0.5% yeast extract, 1% NaCl.
9. The preparation method of the N-acetylated carbazole alkaloid according to claim 7, wherein The preparation method of the plasmid containing D-J gene comprises the following steps: Amplified from the genomic DNA of Streptomyces LHW2432 to obtain a PCR fragment containing the D-J genes cassette, and the target fragment was recovered by gel electrophoresis. The primers used were Ldq-S with the sequence of SEQ ID NO. 1 and Ldq-A with the sequence of SEQ ID NO.
2. The vector was obtained by digesting the plasmid pIB139 with NdeI and EcoRV, i.e., 2 μg of plasmid pIB139, 2 μL each of the restriction endonucleases NdeI and EcoRV, supplemented with Q-grade water to 40 μL, digested at 37 °C for 5 h, then 60 μL of ice-cold isopropanol was added, centrifuged at 14000 rpm for 10 min, the supernatant was removed, and the precipitate was washed twice with 80% ethanol, and finally the DNA was dissolved in 20 μL of Q-grade water; the 2×Ezmax-Muli CloneMix Plus kit was used to ligate the vector pIB139 and the PCR fragment containing the D-J genes cassette; the reaction system was 3 μL of vector DNA, 1 μL of insert fragment, 4 μL of Q-grade water, reacted at 50 °C for 1 h, and the reaction solution was taken for calcium transformation of DH10B, and finally the target clone pRJ331 / DH10B was confirmed by sequencing.
10. Use of the N - acetylated carbazole alkaloid or its pharmaceutically acceptable salt according to claim 1 in the preparation of a drug for anti - thrombosis.
Citation Information
Patent Citations
Carbazole alkaloid compound as well as preparation method and application thereof
CN116444540A
Indole alkaloid derivative as well as preparation method and application thereof
CN116555082A
Carbazole compound
JP1991227971A