Isolation and identification of a benzo[a]pyrene-degrading fungus Nigrospora osmanthi DL-7 from petroleum-contaminated soil and preparation and application of its microbial inoculum

Abstract

This invention discloses a benzo[a]pyrene-degrading fungus, *Nigrospora osmanthi* DL-7, for use in petroleum-contaminated soil, along with its inoculum and applications. This invention domesticated, isolated, and identified a benzo[a]pyrene-degrading strain, *Nigrospora osmanthi* DL-7, from petroleum-contaminated soil in Ningbo. DL-7 can utilize benzo[a]pyrene as a carbon source, even at an initial benzo[a]pyrene concentration of 25 mg·L⁻¹. ‑1 After culturing in an inorganic salt broth for 7 days, the pure DL-7 strain achieved a degradation rate of over 85% for benzo[a]pyrene. When prepared as a bacterial agent, the degradation rate of benzo[a]pyrene could be increased to over 90%. Therefore, this strain and its bacterial agent have good application potential in the bioremediation of polycyclic aromatic hydrocarbons.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of organic pollutant degradation, and particularly relates to isolation and identification of a benz[a]pyrene-degrading fungus Nigrospora osmanthi DL-7 in oil-contaminated soil, preparation of a microbial agent thereof and application. BACKGROUND

[0002] With the rapid development of modern industry, pollution caused by industrial wastewater is becoming increasingly serious. Various organic pollutants, such as polycyclic aromatic hydrocarbons (PAHs), persistently exist. Polycyclic aromatic hydrocarbons are a class of hydrophobic organic compounds with two or more fused rings, which are ubiquitous byproducts in the process of fossil fuels (coal, petroleum, etc.), waste incineration and wood processing. Due to the potential carcinogenic, teratogenic, mutagenic and bioaccumulative properties of PAHs, they can pose a significant threat to the ecological environment and human health, therefore, PAHs pollution has attracted widespread attention. Human activities such as industrial and mining activities, agriculture and high soil environmental background value often lead to serious over-standard of polycyclic aromatic hydrocarbons in the environment and cause pollution. Benz[a]pyrene is a five-ring aromatic hydrocarbon, which has a very close relationship with the carcinogenicity of PAHs. In 2020, the Ministry of Ecological Environment and other departments formulated the "List of Prior Control Chemicals (Second Batch)", which listed it as a priority control pollutant.

[0003] In the natural environment, the degradation of organic pollutants is mainly realized through the metabolic transformation of microorganisms. Microbial remediation technology takes advantage of this biological process by providing necessary conditions for microbial growth through engineering measures, thereby achieving the removal of pollutants in soil. Compared with physical and chemical remediation methods, microbial remediation technology has unique advantages such as low cost and environmental friendliness, and has broad prospects in the application of polycyclic aromatic hydrocarbon contaminated soil remediation. Currently, there are few reported benz[a]pyrene-degrading fungal strains, mainly including Trichoderma, Scedosporium, Fusarium, Penicillium and Aspergillus, etc. Since most of the microorganisms in the environment are not cultivable, many microorganisms, especially those with specific functions, cannot be isolated by pure culture. Therefore, screening strains that can effectively degrade high concentrations of benz[a]pyrene has important application value and practical significance. In this experiment, benz[a]pyrene with a mass concentration of 25 mg·L -1 was used as the substrate for strain degradation in order to provide data support for polycyclic aromatic hydrocarbon biotreatment. SUMMARY

[0004] The first object of the present application is to provide a strain Nigrospora osmanthi DL-7 with the ability of degrading benzene[a]pyrene, which is preserved in the Guangdong Microbial Culture Collection Center (GDMCC) on February 26, 2025, and the address is No. 59, Building 5, 100, Martyrs' Road, Guangzhou, Guangdong, China, Postcode: 510070, and the preservation number is GDMCC No: 65990.

[0005] The present study reports that the strain belongs to Nigrospora osmanthi, which can be isolated from various terrestrial and aquatic habitats. At present, there are still few reports on the degradation of pollutants by Nigrospora osmanthi, and there is no report on the degradation of benzene[a]pyrene by Nigrospora osmanthi at home and abroad. In this study, a strain DL-7 capable of utilizing high-concentration benzene[a]pyrene as a carbon source was isolated from a petroleum-contaminated site in Ningbo. The strain was identified, and its growth characteristics were studied. At the same time, the bacterial agent was prepared to study its degradation characteristics of benzene[a]pyrene, which provides a reference for the bioremediation of PAHs-contaminated environment.

[0006] The second object of the present application is to provide the application of the above-mentioned Nigrospora osmanthi DL-7 in degrading benzene[a]pyrene.

[0007] Preferably, the degradation of benzene[a]pyrene is the degradation of benzene[a]pyrene in petroleum-contaminated soil.

[0008] Preferably, Nigrospora osmanthi DL-7 is applied to the environment contaminated by benzene[a]pyrene to degrade benzene[a]pyrene.

[0009] The third object of the present application is to provide a benzene[a]pyrene-degrading bacterial agent, which comprises the above-mentioned Nigrospora osmanthi DL-7 as an active ingredient.

[0010] Preferably, the preparation method of the benzene[a]pyrene-degrading bacterial agent is as follows:

[0011] 1) Corn and water are heated to form a paste at a mass ratio of 1:5, and then wood chips, wheat bran and sodium lignosulfonate are added at a mass ratio of 150:100:10:1, and the mixture is kneaded into a ball-shaped culture medium, which is sterilized and dried for use;

[0012] 2) The cultured Nigrospora osmanthi DL-7 is prepared into a bacterial solution;

[0013] 3) The bacteria solution in 2) is added into a sodium alginate solution with a mass concentration of 3% at a mass ratio of 1:10, the spherical culture medium in 1) is mixed with the solution, and after completion, a sterile calcium chloride solution with a mass concentration of 4% is added for hardening treatment to obtain a pill-shaped encapsulated fungus;

[0014] 4) The encapsulated fungus pills are loaded into a sterile culture bag, and cultured in a 28℃ incubator for 3-7 days, and after the surface is covered with white mycelium, the benzo[a]pyrene degradation bacteria agent is obtained.

[0015] Preferably, in step 2), the bacteria solution is a bacteria solution with a mycelium content of 10 g / L.

[0016] A fourth object of the present application is to provide a method for degrading benzo[a]pyrene, which sprays the Nigrospora osmanthi DL-7 described above into an environment containing benzo[a]pyrene to degrade the benzo[a]pyrene.

[0017] Preferably, the Nigrospora osmanthi DL-7 is sprayed into an environment contaminated by benzo[a]pyrene to degrade the benzo[a]pyrene.

[0018] Preferably, the Nigrospora osmanthi DL-7 is sprayed into an environment contaminated by benzo[a]pyrene to degrade the benzo[a]pyrene.

[0019] The present application domesticates and isolates a strain DL-7 from a certain oil-contaminated soil in Ningbo, which degrades benzo[a]pyrene as a carbon source. According to the strain morphology, physiological characteristics, ITS gene sequencing analysis and phylogenetic analysis, the strain is identified as Nigrospora osmanthi DL-7, and the optimal environmental conditions for its growth are: temperature of 28℃, pH value of 7, and no addition of sodium chloride. The ITS gene sequencing analysis result of the strain shows that the strain most similar to DL-7 is Nigrospora osmanthiisolate 39A-1X and Nigrospora osmanthi CGMCC 3.18126 (100%). DL-7 can utilize benzo[a]pyrene as a carbon source, and after being cultured in an inorganic salt culture solution with an initial concentration of 25 mg·L -1 of benzo[a]pyrene for 7 days, the degradation rate of benzo[a]pyrene by the pure strain DL-7 can reach more than 85%. After DL-7 is made into a bacteria agent, the degradation rate of benzo[a]pyrene can be improved to nearly 90%, and therefore, the strain and the bacteria agent have good application potential in the bioremediation of polycyclic aromatic hydrocarbons.

[0020] Nigrospora osmanthi DL-7, which was preserved in Guangdong Microbial Culture Collection Center (GDMCC) on February 26, 2025, at address: 100, Martyrs' Road, Guangzhou, Guangdong, China, 510070, with preservation number: GDMCC No: 65990. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 is the front and back of strain DL-7 in Example 1 grown on PDB medium for 7 days.

[0022] Figure 2 is the phylogenetic relationship of strain DL-7 and its related bacteria based on ITS gene sequence in Example 1, the construction method is neighbor-joining method, the bootstrap value is set to repeat 1000 times, only the results with bootstrap value greater than 50% are shown in the figure, and the scale of 0.01 represents the substitution rate of each nucleotide.

[0023] Figure 3 is the growth of strain DL-7 in Example 2 under different culture temperatures, salinities, and pH.

[0024] Figure 4 is the degradation efficiency of strain DL-7 and DL-7 microbial agent in inorganic salt medium containing benz[a]pyrene in Example 3 (initial concentration 25 mg·L -1 ). DETAILED DESCRIPTION

[0025] In order to make the objects, technical solutions and advantages of the present application clearer, the present application will be further described in detail below in combination with the drawings and examples. It should be understood that the specific examples described herein are only used to explain the present application and do not limit the present application. In addition, the technical features involved in each embodiment of the present application described below can be combined with each other as long as they do not conflict with each other.

[0026] Example 1 Isolation and identification of Nigrospora osmanthi DL-7

[0027] 1. Materials and methods

[0028] 1.1 Sample source

[0029] Soil samples were obtained from a petroleum contaminated site in Ningbo, China. A high concentration of benz[a]pyrene was used as a carbon source for long-term acclimation. Through multiple screening and purification, a high-efficiency benz[a]pyrene-degrading strain was obtained.

[0030] 1.2 Culture medium

[0031] 1.2.1 Inorganic salt medium

[0032] The inorganic salt medium is used for enrichment culture of microorganisms in samples, and degradation experiment of benz[a]pyrene under pure bacteria and bacterial agent conditions. The medium formula is shown in Table 1 (containing benz[a]pyrene solution), and the preparation method is to add each component into solvent water, mix uniformly, sterilize to obtain.

[0033] Table 1 Inorganic salt medium formula

[0034]

[0035]

[0036] 1.2.2 Nutrient medium

[0037] The nutrient medium is used for the culture of fungi, separation, purification, preservation, and activation of conventional microorganisms. The types and components of the nutrient medium used in this experiment are shown in Table 2. If solid medium is required for the experiment, only 1.5-2% agar powder is added to the original medium formula. If there is no special instruction for the culture conditions of the strain, the pH of the medium is adjusted to 7. The preparation method of the nutrient medium is to add each component into solvent water, mix uniformly, sterilize to obtain.

[0038] Table 2 Potato-Dextrose broth medium (PDB) components

[0039]

[0040] 1.3 Domestication, screening and isolation of strains

[0041] The collected contaminated soil is added to the above inorganic salt medium, and streptomycin sulfate and penicillin (concentration of 100 ug / ml) are added to inhibit bacterial growth. 50 mg·L -1 of benz[a]pyrene is used as the degradation substrate, and the mixture is placed in a 28℃ incubator for dark shaking culture. The inorganic salt medium with benz[a]pyrene as carbon source is used for strain domestication, and 7d is a domestication cycle. 10% of the inoculum is transferred to fresh inorganic salt medium with the same culture system and the above enrichment process is repeated, and this process is repeated three times.

[0042] The fourth generation of the enriched culture sample obtained above was plated by dilution plating method, and the sample was separated with nutrient medium. The plated sample was incubated at the original culture temperature, and after about 48 hours, obvious single colonies were formed on the surface of the culture medium. According to the size, color, mycelium and other characteristics of the colonies, several single colonies with different characteristics were picked and purified by streaking on a nutrient medium plate. If different characteristic single colonies can still be observed on the streaked plate, the streaking separation is performed again until only single colonies with the same characteristics can be observed on the same plate. In the experiment, a strain DL-7 with high degradation performance on benz[a]pyrene was screened. The purified single colony was picked and cultured in a corresponding solid test tube nutrient medium, and was stored at -4°C for a long time after being sealed with sterilized liquid paraffin.

[0043] 1.4 Identification of the strain

[0044] The strain DL-7 was identified according to its morphological characteristics and molecular biological properties.

[0045] 1.4.1 Morphological characteristics

[0046] DL-7 is a fungus isolated from Ningbo oil-contaminated soil. After activation, it can form a white, circular, white and fluffy mycelial upward growth colony with a diameter of 13.5 mm on a PDB plate after 7 days of growth at 28°C under aerobic conditions. The fungus is a specific aerobic fungus. Figure 1 ).

[0047] 1.4.2 Molecular biological properties

[0048] Molecular biological property identification mainly includes sequencing and construction of a phylogenetic tree. Before sequencing and constructing a phylogenetic tree, the DNA of the fungus needs to be extracted (the fungal genomic DNA rapid extraction kit used in the experiment is from Shengong Bioengineering (Shanghai) Co., Ltd.). In order to study the taxonomy of the fungus, it is usually necessary to amplify the ITS gene and construct a phylogenetic tree. The amplified gene is a piece of DNA in the part of the eukaryotic rRNA encoding part, which is usually used for detecting and identifying fungi due to its high conservation, specificity and suitable sequence length.

[0049] Polymerase chain reaction (PCR) is mainly used to amplify different gene fragments. Different primers (ITS1: 5'-TCCGTAGGTGAACCTGCGG-3'; ITS4: 5'-TCCTCCGCTTATTGATATGC-3') are needed for PCR. The PCR amplification reaction system: 10x buffer 2.5 μl, Mg 2+(25mmol / l)1.5μl, dNTP (25mmol / l) 0.3μl, forward primer (10mmol / l) 0.5μl, reverse primer (10mmol / l) 0.5μl, Taq enzyme: 0.25μl, DNA group template 0.1μl, deionized water 19.35μl. PCR amplification reaction conditions: 95℃ pre-denaturation 3min, 95℃ 45s, 56℃ annealing 30s, 72℃ extension 45s, 30 cycles. 72℃ extension 10min, after the reaction, store at 4℃. After amplifying the required gene, prepare a gel block with 0.75-1% agarose and add nucleic acid stain GelRed. Add the PCR product and DNA markers containing various length fragments to the gel block and place it in an electrophoresis apparatus. Load the electrophoresis apparatus with TBE (Tris borate) buffer and operate the electrophoresis apparatus at a certain voltage for 20min. Then, observe under a 300nm ultraviolet lamp to determine whether the PCR product amplification reaction was successful. Then, sequence the amplified PCR product using the same primers as the amplification primers.

[0050] The ITS gene sequence obtained by sequencing was uploaded to EzTaxon-e (http: / / eztaxon-e.ezbiocloud.net / ). The website compares the submitted sequence with the ITS gene sequences of the typical strains of the recognized species, and obtains the similarity information between the sequences. According to the results of sequence alignment analysis, the corresponding typical strain can be selected as the model strain of the isolated strain in this experiment, and the ITS gene sequence of the model strain can also be obtained to construct a phylogenetic analysis to prove that the model strain and the isolated strain have differences, thereby identifying the isolated strain. The phylogenetic tree is constructed using MEGA 5.05 program, and the neighbor-joining method, minimum evolution method and maximum parsimony method are usually used to construct the phylogenetic tree, among which the most commonly used is the neighbor-joining method, and the self-exhibition value is usually set to repeat 1000 times.

[0051] A 553bp ITS gene sequence was obtained by PCR and gene sequencing. Through ITS gene alignment, it was found that the strain had a 100% gene similarity with Nigrospora osmanthi isolate 39A-1X and Nigrospora osmanthi CGMCC 3.18126 (GenBank accession numbers MT556397.1 and NR 153474.1, respectively). From the above results, it can be concluded that the fungus DL-7 isolated in this experiment is Nigrospora osmanthi.

[0052] The ITS gene sequence of DL-7 and the ITS gene sequence with high similarity are used to make a phylogenetic tree, so as to obtain the homology result between the ITS gene of DL-7 and the ITS gene with high similarity. The phylogenetic tree constructed by the adjacent connection method is shown in Figure 2 At present, there are few reports on the application of the strain in the field of environment. Therefore, it is of important theoretical and practical significance to obtain high-efficiency benzo[a]pyrene-degrading bacteria for the treatment and deep remediation of benzo[a]pyrene-contaminated water and soil and PAHs pollution.

[0053] The ITS gene sequence of DL-7 is shown as SEQ ID NO. 1, and specifically is as follows:

[0054] TCCGTAGGGGGAACCTGCGGAGGGATCATTACAGAGTTATCCAACTCCCAAACCCATGTGAACATATCTCTTTGTTGCCTCGGCGCAAGCTACCCGGGACCTCGCGCCCCGGGCGGCCCGCCGGCGGACAAACCAAACTCTGTTATCTTCGTTGATTATCTGAGTGTCTTATTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTAAGCACAGCTTATTGTTGGGCGTCTACGTCTGTAGTGCCTCAAAGACATTGGCGGAGCGGCAGCAGTCCTCTGAGCGTAGTAATTCTTTATCTCGCTTCTGTTAGGCGCTGCCCCCCCGGCCGTAAAACCCCCAATTTTTTCTGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAGGCGGAGGAA.

[0055] From the above results, it can be concluded that the strain DL-7 isolated in this experiment is of the species Nigrospora osmanthi. It is named Nigrospora osmanthi DL-7, which was preserved in Guangdong Microbial Culture Collection Center (GDMCC) on February 26, 2025, at address: 59, Building 5, 100, Martyrs' Road, Guangzhou, Guangdong, China, Postcode: 510070, with preservation number: GDMCC No: 65990.

[0056] Example 2 Growth conditions of Nigrospora osmanthi DL-7

[0057] Determination of growth temperature:

[0058] Prepare the nutrient medium required for the growth of the strain (Example 1), and sterilize it in a sterilization pot after preparation. The activated strain Nigrospora osmanthi DL-7 is inoculated into the nutrient medium (experimental group), and the medium without fungal inoculation is used as control (control group). The medium is cultured at different temperatures for 7 days. The control group and each temperature corresponding experimental group have three repeats. The growth of the fungus is observed every day. After 7 days, the medium is poured into a weighed centrifuge tube and centrifuged at 4500 rpm for 30 min. After pouring off the supernatant, it is placed in a 60°C oven until the weight is constant. The dry weight of the fungal mycelium is calculated. The test temperatures are as follows: 23°C, 28°C, 33°C, 35°C and 38°C.

[0059] Determination of growth pH:

[0060] Prepare the nutrient medium required for the growth of the strain (Example 1), and adjust the pH of the culture solution with the following buffer systems: pH 4.0-5.0, 0.1 mol / l sodium citrate and 0.1 mol / l citric acid; pH 6.0-8.0, 0.1 mol / l NaOH and 0.1 mol / l KH2PO4; pH 9.0, 0.1 mol / l NaHCO3 and 0.1 mol / l Na2CO3. The fungus Nigrospora osmanthi DL-7 is inoculated into the medium, with three repeats for each pH. The nutrient medium without fungal inoculation is used as control. The medium is cultured at the optimum temperature for new fungus growth for 7 days. The growth of the fungus is observed every day. After 7 days, the medium is poured into a weighed centrifuge tube and centrifuged at 4500 rpm for 30 min. After pouring off the supernatant, it is placed in a 60°C oven until the weight is constant. The dry weight of the fungal mycelium is calculated. The tested pH is as follows: 4.0, 5.0, 6.0, 7.0, 8.0, 9.0.

[0061] Salt concentration tolerance:

[0062] The nutritional medium required for the growth of the strain was configured (Example 1), and the salt concentration of the medium was adjusted. The activated new fungus Nigrospora osmanthi DL-7 was inoculated into the sterilized medium, three replicates were made for each salt concentration, and un-inoculated nutritional medium was used as a control. The medium was placed in a new fungus growth optimum temperature incubator for 7 days. After 7 days, the medium was poured into a weighed centrifuge tube and centrifuged at 4500 rpm for 30 min. After pouring off the supernatant, it was placed in a 60°C oven and dried to a constant weight. The fungal mycelium dry weight was calculated to determine the salt concentration range that the new fungus could tolerate. The salt concentrations tested were as follows: mass fraction 0%, 2%, 4%, 6%, 8%, and 10%.

[0063] The results are shown in Table 1. Figure 3 As shown in Table 1, in the nutritional broth medium, DL-7 could grow at a temperature of 18-38°C, with an optimum growth temperature of 28°C, which was the enrichment temperature of the fungus. The fungus could grow at a pH of 4.0-9.0, with an optimum growth pH of 7.0, but the growth decreased significantly as the alkalinity increased. The salt tolerance of the fungus was weak, and the growth was best in the absence of salt. The fungus could grow at a salt concentration of 0% to 4%, but the growth decreased significantly as the salinity increased, and the fungus hardly grew at a salt concentration of 6%.

[0064] Example 2 Benzo[a]pyrene degradation experiment of Nigrospora osmanthi DL-7

[0065] 1. Preparation of the microbial agent, the steps are as follows:

[0066] 1) Corn was heated with water at a mass ratio of 1:5 to make a paste, and then wood chips (passed through a 200-mesh sieve), wheat bran, and sodium lignosulfonate were added at a mass ratio of 150:100:10:1. The mixture was kneaded into a ball, and the ball-shaped culture medium was obtained by placing it in a pill-making machine to a diameter of 8 mm. The ball-shaped culture medium was sterilized and dried for use.

[0067] 2) The cultured DL-7 fungus was prepared into a mycelium content of 10 g / L.

[0068] 3) The fungus solution was added to a 3% mass concentration sodium alginate solution at a mass ratio of 1:10, and the ball-shaped culture medium was mixed with the solution. After completion, a 4% mass concentration sterile calcium chloride solution was added, and the hardening treatment was performed for 20 min to obtain the encapsulated fungus in the form of pills.

[0069] 4) The encapsulated fungus pills were placed in a sterile culture bag, and cultured in a 28°C incubator for 3-7 days. When the surface was covered with white mycelium, the DL-7 microbial agent was obtained.

[0070] 2. Benzo[a]pyrene degradation experiment

[0071] The activated strain DL-7 or DL-7 agent after 7 days of culture was inoculated into the inorganic salt medium (Example 1) containing 25 mg / L of benz[a]pyrene initially, and was cultured with shaking, 3 replicates for each treatment, under the conditions of temperature 28℃, pH 7.0, and no addition of NaCl. The inoculation amount of the pure strain DL-7 and the DL-7 agent was 10% by mass ratio. The treatment without addition of the pure strain and the agent was the control treatment. -1

[0072] The samples of each treatment were taken for chemical analysis, and the specific steps were as follows: (1) sample pretreatment: each culture sample was added into dichloromethane for extraction, and 5 μL of recovery indicator (deuterated-PAHs) with a concentration of 200 mg / L was added, and after shaking well, it was transferred into a separatory funnel for standing. After layering, the organic phase was collected, and the lower liquid was put back into the flask for repeated extraction with an equal volume of dichloromethane, and the extracted liquid was transferred into a flat-bottom flask containing a proper amount of activated copper sheet for rotary evaporation, and was concentrated to about 2 mL, and a small amount of n-hexane (about 5 mL) was added, and rotary evaporation was performed to 2 mL, and the organic solvent was replaced with n-hexane for three times. The concentrated liquid after replacement was purified with a glass packed column (about 9 mm in diameter). The column packing was 3 cm 3% deactivation neutral alumina, 3 cm 3% deactivation silica gel and 1 cm anhydrous sodium sulfate from bottom to top. The column was activated with a proper amount of n-hexane, and 15 mL of n-hexane / dichloromethane (volume ratio 1:1) mixed reagent was used to elute the packed column, and the eluent was collected with a brown reagent bottle for about 15 mL, and was concentrated to about 0.5 mL by nitrogen blowing, and finally was transferred into a 1.5 mL cell bottle for freezing preservation. 5 μL of internal standard hexamethylbenzene was added before instrument analysis, and the concentration was 200 mg / L. (2) Instrument analysis: the content of PAHs in each treatment sample was determined by using Agilent 7890 gas chromatograph-5975 mass spectrometer. The chromatographic column used was Agilent DB 5-MS capillary column (column length 30 m, inner diameter 0.25 mm, film thickness 0.25 μm). The obtained data was processed by using Agilent chromatography workstation, and the quantification of benz[a]pyrene was performed by using 6-point calibration curve and internal standard method. The concentration of microbial cells was determined by using the oven drying weighing method.

[0073] The results showed that the degradation rate of benz[a]pyrene itself for 7 days was 24.2%. According to the determination and analysis by GC-MS, it was found that both the strain DL-7 and the agent could degrade benz[a]pyrene, and the degradation rate could reach more than 85% after 7 days of culture in the inorganic salt medium containing 25 mg / L of benz[a]pyrene. Figure 4 The degradation rate of the pure strain DL-7 to benz[a]pyrene was 86.4%, and the degradation efficiency of the agent to benz[a]pyrene was 88.8%, which indicated that the strain DL-7 was a strong strain capable of degrading benz[a]pyrene, and the degradation ability of the strain was not affected after being made into an agent. ​

[0074] Conclusion

[0075] 1) A strain of benzo[a]pyrene-degrading bacteria DL-7 was isolated from Ningbo oil-contaminated soil and made into a solid bacterial agent.

[0076] 2) The strain DL-7 is a special aerobic bacteria that can form a white, round, white fuzzy mycelium colony with a diameter of about 13.5 mm. According to molecular biology analysis, the fungus DL-7 isolated in this experiment is Nigrospora osmanthi strain, and its phylogenetic tree is drawn. There are few reports on the application of this strain, especially the research on its degradation of benzo[a]pyrene has not been reported.

[0077] 3) The optimal growth conditions of strain DL-7 are temperature 28℃, pH 7.0, and no NaCl added. DL-7 can use benzo[a]pyrene as carbon source and degrade it. After 7 days of culture in inorganic salt medium with initial concentration of 25mg·L -1 -1, its degradation rate can reach 86.4%. The solid bacterial agent made of DL-7 has better degradation effect on benzo[a]pyrene, reaching 88.8%. In summary, DL-7 is a strain that can degrade benzo[a]pyrene, has strong adaptability to polycyclic aromatic hydrocarbons, and the bacterial agent made of it has better degradation effect, which has good application potential in bioremediation.

Claims

1. Nigrospora osmanthi DL-7, accession number: GDMCC No: 65990.

2. The application of Nigrospora osmanthi DL-7 as described in claim 1 in the degradation of benzo[a]pyrene.

3. The application according to claim 2, characterized in that, The aforementioned degradation of benzo[a]pyrene refers to the degradation of benzo[a]pyrene in petroleum-contaminated soil.

4. The application according to claim 2, characterized in that, The method involves applying Nigrospora osmanthi DL-7 to degrade benzo[a]pyrene in environments contaminated with benzo[a]pyrene.

5. A benzo[a]pyrene degrading bacterial agent, characterized in that, It contains Nigrospora osmanthiDL-7 as described in claim 1 as an active ingredient.

6. The benzo[a]pyrene degrading bacterial agent according to claim 5, characterized in that, The preparation method of the benzo[a]pyrene degrading bacterial agent is as follows: 1) After heating corn and water to a mass ratio of 1:5 to make a paste, add sawdust, wheat bran and sodium lignosulfonate at a mass ratio of 150:100:10:1, knead into a ball, put the ball-shaped culture medium mixture into a pelletizing machine to make spherical culture medium, sterilize and dry for later use. 2) Prepare a bacterial culture of Nigrospora osmanthi DL-7; 3) Add the bacterial solution from 2) to a 3% sodium alginate solution at a mass ratio of 1:

10. Mix the spherical culture medium from 1) thoroughly with this solution. After completion, add a 4% sterile calcium chloride solution and harden the mixture to obtain spherical encapsulated fungi. 4) Place the sealed fungal pellets into a sterile culture bag and incubate at 28°C for 3-7 days. Once the surface is covered with white mycelium, it becomes a benzo[a]pyrene degrading agent.

7. The benzo[a]pyrene degrading bacterial agent according to claim 6, characterized in that, In step 2), the bacterial solution is a bacterial solution with a mycelial content of 10 g / L.

8. A method for degrading benzo[a]pyrene, characterized in that, The Nigrospora osmanthiDL-7 of claim 1 was sprayed in an environment containing benzo[a]pyrene to degrade benzo[a]pyrene.

9. The method according to claim 8, characterized in that, The method involves spraying Nigrospora osmanthi DL-7 into an environment contaminated with benzo[a]pyrene to degrade benzo[a]pyrene.

10. The method according to claim 8, characterized in that, The method involves applying Nigrospora osmanthi DL-7 to petroleum-contaminated soil to degrade benzo[a]pyrene.

Images