Bacterium DY1 for degrading crastocellulose eucalyptus and application of bacterium DY1
By screening and applying Trichoderma sp. eucalyptus cellulose DY1, the problem of slow degradation of eucalyptus branches is solved, efficient degradation of eucalyptus branches is achieved, and soil fertility and eucalyptus yield are improved.
Patent Information
- Application Number
- CN202510445022.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-10
- Publication Date
- 2025-07-08
AI Technical Summary
The degradation rate of eucalyptus thick branches is slow, which affects the improvement of soil fertility and stand productivity.
A strain of degraded eucalyptus cervicalis DY1 was provided, classified as Trichoderma sp., and deposited number CGMCC NO.41658. The selected strain has high enzyme activity and can significantly improve the degradation rate of eucalyptus cervicalis.
Through screening, the filter paper disintegration rate reached 66.42%, and the eucalyptus branch degradation rate was close to 32%, which significantly improved soil fertility and eucalyptus yield.
Smart Images

Figure CN120272326A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the technical field of eucalyptus degradation, and particularly relates to a strain of cellulose-degrading bacteria DY1 for eucalyptus thick branches and its application. Background Art
[0002] Eucalyptus is a high-quality fast-growing tree species in tropical and subtropical regions and is a short-cycle fiber material with good economic benefits, making important contributions to China's forestry construction and wood security. However, with the continuous expansion of multi-generation continuous planting and planting area of eucalyptus, ecological problems have also emerged: such as the decline of soil fertility, the reduction of microbial diversity and quantity, serious soil erosion, the decrease of stand productivity, and the supply status of soil organic matter is one of the key factors causing the decline of soil fertility in eucalyptus plantations.
[0003] Currently, preliminary research has found that the no-burning-and-planting mode in clear-cut areas, that is, retaining logging residues in clear-cut areas, is considered one of the scientific management approaches for eucalyptus plantations. Compared with burning residues, retaining residues can supply a large amount of nutrients to the understory soil, is an important source of forest soil organic matter, and is the basis for maintaining forest soil fertility. However, simply retaining residues results in a slow decomposition rate and is prone to fire. The higher the decomposition rate of residues, the more humus is produced, which can improve soil quality, and at the same time, it can also improve the physical structure of the soil and continuously increase nutrients.
[0004] Research shows that after 12 months of decomposition, the mass residue rate from high to low is thick branches > thin branches > leaves. Leaves decompose the fastest, followed by thin branches, and thick branches decompose the slowest. Therefore, it is of great significance to study how to promote the degradation of eucalyptus thick branches. Summary of the Invention
[0005] This application provides a strain of cellulose-degrading bacteria DY1 for eucalyptus thick branches and its application to solve the problem of slow degradation rate of thick branches in eucalyptus residues in related technologies.
[0006] In the first aspect, a strain of cellulose-degrading bacteria DY1 for eucalyptus thick branches is provided, which is classified and named Trichodermasp., and was deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on December 9, 2024, with the deposit number CGMCC NO.41658.
[0007] In the second aspect, an application of a strain of cellulose-degrading bacteria DY1 for eucalyptus thick branches in eucalyptus degradation is provided.
[0008] The beneficial effects brought by the technical solutions provided in this application include:
[0009] The present application provides a strain of cellulose-degrading bacterium DY1 for eucalyptus thick branches and its application. By separating and purifying eucalyptus soil samples, strain DY1 with better enzyme activity is screened. Its filter paper disintegration rate is 66.42%, and the degradation rate of eucalyptus thick branches is close to 32%. It can improve the decomposition speed of eucalyptus residues. Therefore, it is of great significance for improving the soil fertility of eucalyptus plantations and the yield of eucalyptus. Description of the Drawings
[0010] To more clearly illustrate the technical solutions in the embodiments of the present application, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the drawings in the following description are only some embodiments of the present application. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0011] Figure 1 Schematic diagram of the transparent circle of cellulose bacterium DY1 provided by the present application;
[0012] Figure 2 Schematic diagram of cellulose bacterium DY1 provided by the present application;
[0013] Figure 3 Morphological observation diagram of cellulose bacterium DY1 provided by the present application;
[0014] Figure 4 Schematic diagram of the filter paper disintegration of cellulose bacterium DY1 provided by the present application on the 3rd day;
[0015] Figure 5 Schematic diagram of the filter paper disintegration of cellulose bacterium DY1 provided by the present application on the 5th day;
[0016] Figure 6 Schematic diagram of the filter paper disintegration of cellulose bacterium DY1 provided by the present application on the 7th day. Detailed Embodiments
[0017] To make the objectives, technical solutions, and advantages of the embodiments of the present application clearer, the following will clearly and completely describe the technical solutions in the embodiments of the present application with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are some, but not all, of the embodiments of the present application. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present application without creative efforts fall within the scope of protection of the present application.
[0018] The present application provides a strain of cellulose-degrading bacterium DY1 for eucalyptus thick branches and its application, which can solve the problem of slow degradation rate of thick branches in eucalyptus residues in related technologies.
[0019] See Figures 1 to 6As shown in the figure, the present application provides a strain of eucalyptus thick-branch cellulose-degrading bacterium DY1 (hereinafter referred to as cellulose bacterium DY1).
[0020] Specifically, the cellulose bacterium DY1 is classified and named Trichoderma sp., and was deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on December 9, 2024, with the deposit number CGMCC NO.41658.
[0021] Example 1 Molecular Biological Identification of Cellulose Bacterium DY1
[0022] This cellulose bacterium DY1 is derived from eucalyptus soil samples and rotten branches and leaves in the main eucalyptus-producing areas of Guangxi, Liuzhou and Nanning.
[0023] The gene sequence of cellulose bacterium DY1 is shown in SEQ ID No.1.
[0024] The gene sequence (SEQ ID No.1) of the cellulose bacterium DY1 is as follows:
[0025] GTCTACTGATCCGAGGTCACATTTCAGAAGTTGGGTGTTTAACGGCTGTGGACGCGCCGCGCTCCCGATGCGAGTGTGCAAACTACTGCGCAGGAGAGGCTGCGGCGAGACCGCCACTGTATTTCGGAGACGGCCACCGCCAAGAGGCAGGGCCGATCCCCAACGCCGACCCCCCGGAGGGGTTCGAGGGTTGAAATGACGCTCGGACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTCGAAACGCCTACGAGAGGCGCCGAGAAGGCTCAGATTATAAAAAAACCCGCGAGGGGGTATACAATAAGAGTTTTGGTTGGTCCTCCGGCGGGCGCCTTGGTCCGGGGCTGCGACGCACCCGGGGCAGAGATCCCGCCGAGGCAACAGTTTGGTAACGTTCACATTGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCAGGTCACCCCTTACCGGAAG.
[0026] Example 2 Characterization of Cellulose Bacteria DY1
[0027] The cellulose-degrading fungi in the selected soil samples were preliminarily screened. Add 10 mL of sterile water to an Erlenmeyer flask, weigh 1 g of soil sample and add it to the Erlenmeyer flask, then place the Erlenmeyer flask in a constant temperature shaker, shake at a constant temperature of 28 °C for 30 min to fully mix the soil sample with the sterile water, take out the soil homogenate, perform dilution operations, and take soil suspensions with dilution factors of 10 -1 、10 -2 、10 -3 Using a pipette, aspirate 100 μL of each concentration of soil suspension and evenly spread it onto the cooled and solidified cellulose screening medium (5.0 g of sodium carboxymethylcellulose, 3.0 g of sodium nitrate, 1.0 g of potassium dihydrogen phosphate, 0.6 g of magnesium sulfate heptahydrate, 0.5 g of potassium chloride, 0.001 g of ferrous sulfate heptahydrate, 15.0 g of agar, 1000 mL of distilled water). After the added soil suspension has penetrated the medium, seal it with a sealing film, and then leave it stationary in a constant temperature incubator and incubate at 28 °C for 3 - 5 d. After the incubation is completed, observe the growth status of the cellulose-degrading microorganisms cultured on the cellulose medium.
[0028] The screened cellulose bacteria DY1 were inoculated with a sterilized pipette tip as single colonies onto the Congo red medium and cultured at 28 °C for 4 days. Observe the clear zones around the colonies. Based on the ratio of the clear zone diameter to the colony diameter, preliminarily judge the ability of each colony to produce cellulase. Using the ratio of the clear zone diameter to the colony diameter after 4 d of culture as the screening standard experiment, the results are shown in Table 1 and Figures 1 to 3 as shown.
[0029] Table 1
[0030] Strain Diameter of clear zone (mm) Diameter of colony (mm) Clear zone / Colony DY1 78.59 72.69 1.08
[0031] See Figure 1 as shown, the screened strain has an obvious clear zone, and the clear zone / colony diameter is 1.08; combined with Figure 2 as shown, its colony morphology is an irregular circle, and the colony color is dark green. The hyphae are slender and colorless, septate, and highly branched. Combined with Figure 2 and Figure 3 as shown, the conidia are mostly spherical, and the spore walls have small warts. On the PDA medium, the colony is initially white and flocculent, and then turns dark green.
[0032] Example 3 Filter Paper Disintegration Rate Test of Cellulose Bacteria DY1
[0033] The strain was inoculated into a filter paper liquid medium and incubated at 28 °C and 180 r / min. The filter paper was taken out on the 3rd, 5th, and 7th days of incubation to measure the weight loss rate. Before and after disintegration, the filter paper was fully dried in an oven at 100 °C. Taking the weight loss rate (X) of the filter paper as the standard, the formula is:
[0034] X = (m - m1) / m
[0035] Where m is the initial weight of the filter paper and m1 is the weight of the filter paper after degradation.
[0036] After culturing the strains screened by Congo red plates in the filter paper liquid medium for different times, the weight loss rate results of the filter paper are shown in Table 2 and Figures 4 to 6 as shown.
[0037] Table 2
[0038]
[0039]
[0040] See Figures 4 to 6 as shown, Figure 4 , 5 , and 6 are schematic diagrams of the filter paper disintegration on the 3rd, 5th, and 7th days respectively. After 1 day, the colonies gradually adhered to the filter paper and grew, and basically degraded the filter paper. After the 3rd day, the filter paper was completely degraded, and the culture medium became the green color of the strain. While other strains could be completely degraded basically after the seventh day.
[0041] Example 4 Enzyme Activity Test of Cellulose Bacterium DY1
[0042] The bacteria obtained by primary screening were inoculated into a seed medium and cultured at 28 °C and 180 r / min for 3 days to obtain a uniform seed, and then inoculated into a liquid enzyme production identification medium at a ratio of 5% and cultured at 28 °C and 180 r / min for 4 days, and then centrifuged to obtain crude enzyme. The FPA enzyme activity and CMC enzyme activity were measured respectively.
[0043] Among them, the calculation formula for FPA enzyme activity is:
[0044] X1 = A × 1 / 0.5 × n
[0045] Where, X1—the filter paper enzyme activity (FPA) of the sample, u / g (or u / mL);
[0046] A—the amount of reducing sugar obtained (or calculated) from the standard curve according to the absorbance, mg;
[0047] 1 / 0.5—converted to 1 mL of enzyme solution;
[0048] n—the dilution factor of the enzyme sample.
[0049] Calculation formula for CMC enzyme activity:
[0050] X1 = A × 1 / 0.5 × n × 2
[0051] Wherein, X1—the carboxymethyl cellulase activity (CMCA - DNS) of the sample, u / g (or u / mL);
[0052] A—the amount of reducing sugar obtained (or calculated) from the standard curve based on the absorbance, mg;
[0053] 1 / 0.5—converted to 1 mL of enzyme solution;
[0054] n—the dilution factor of the enzyme sample;
[0055] 2—the time conversion coefficient.
[0056] The results of FPA enzyme activity and CMC enzyme activity are shown in Table 3.
[0057] Table 3
[0058] Strain FPA enzyme activity CMC enzyme activity DY1 1.76 4.93
[0059] In summary, the filter paper disintegration rate of cellulolytic bacterium DY1 after 3 d is 35.06%, the FPA enzyme activity is 1.76, and the CMC enzyme activity is 4.93. Its enzyme activity is relatively high, and it can degrade eucalyptus residues well, thereby increasing the soil fertility of eucalyptus plantations.
[0060] Example 5 Application of Eucalyptus Cellulolytic Bacterium DY1 in the Degradation of Eucalyptus Branches
[0061] The strain DY1, together with two other strains Penicillium sp. G1 and Streptomyces sp. Q7 with the ability to degrade eucalyptus, were respectively used to conduct experimental comparisons on eucalyptus thick branches, eucalyptus thin branches, and eucalyptus leaves.
[0062] Determination of the degradation rate of eucalyptus residues: The eucalyptus residues were dried to a constant weight at 60 °C, crushed and sieved (40 mesh). Each Erlenmeyer flask was filled with 90 mL of a liquid medium with eucalyptus powder as the sole carbon source, sterilized at 121 °C for 20 min, and the addition amount of eucalyptus powder per flask was 2 g. Further, 10 mL of the bacterial suspension was inoculated into the flask, and after culturing on a shaker at 28 °C for 20 d, it was centrifuged at a rate of 5000 r / min for 10 min, and then the supernatant was discarded. The residue was repeatedly centrifuged and washed 3 times with distilled water, dried to a constant weight at 60 °C, and the weight loss rate was calculated.
[0063] The control group was a eucalyptus liquid medium inoculated with 10 mL of sterile water, and 3 repeated experiments were set. The formula for the weight loss rate is X = (m - m1) / m, where m is the initial weight of the eucalyptus powder and m1 is the weight of the eucalyptus powder after degradation.
[0064] By measuring the degradation rate of eucalyptus by the strain, it can be known that the strain DY1 has a high degradation effect on thick branches of eucalyptus, and the measured degradation rate is 31.9%. The specific measurement results are shown in Table 4 below.
[0065] Table 4
[0066] Strain DY1 G1 Q7 Degradation rate of thick branches (%) 31.9 0.97 0.94 Degradation rate of thin branches (%) 1 0.98 0.96 Degradation rate of leaves (%) 0.85 0.86 0.77
[0067] As can be seen from the above table, compared with the other two strains with the ability to degrade eucalyptus, the strain DY1 has a great degradation effect on thick branches of eucalyptus, with a relative increase of about 38 times.
[0068] In summary, from the aspects of clear zone, filter paper disintegration effect, inoculation effect and enzyme activity, the cellulolytic bacterium DY1 screened through the examples of this application has a filter paper disintegration rate of 66.42%. Through the measurement of the degradation rate of eucalyptus by the strain, it is found that the cellulolytic bacterium DY1 has a more excellent degradation effect on thick branches of eucalyptus compared with thin branches and leaves of eucalyptus, and the measured degradation rate is 31.9%. And in the research on eucalyptus-degrading cellulose fungi, it is found that the enzyme activities of the screened cellulose-degrading strains are generally around 0.3, and the enzyme activity of the strain found in this application is significantly higher.
[0069] The above are only specific embodiments of this application, enabling those skilled in the art to understand or implement this application. Various modifications to these embodiments will be obvious to those skilled in the art. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of this application. Therefore, this application will not be limited to these embodiments shown herein, but will conform to the widest scope consistent with the principles and novel features claimed herein.
Claims
1. A cellulose-degrading bacterium DY1 for eucalyptus thick branches, characterized in that: Its classification name is Trichoderma sp., and it was deposited in the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on December 9, 2024, with the deposit number of CGMCC NO. 41658.
2. Application of the eucalyptus thick branch cellulose-degrading bacterium DY1 as described in claim 1 in the degradation of eucalyptus thick branches.