Lactobacillus paracasei and application thereof

Abstract

The invention belongs to the technical field of microorganisms, and particularly discloses lactobacillus paracasei and application thereof, the lactobacillus paracasei is named as lactobacillus paracasei Jlus66, the lactobacillus paracasei is preserved in China General Microbiological Culture Collection Center on March 31, 2021, the preservation address is No.3, No.1 Yard, Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC No.22101. The lactobacillus paracasei is named as lactobacillus paracasei Jlus66. The lactobacillus paracasei Jlus66 has the obvious beneficial effects in the treatment of the alopecia areata, and the obvious beneficial effects comprise the immune regulation, the anti-oxidation and anti-inflammatory effects and the optimization of the intestinal tract-skin axis. In addition, the medicine is high in safety and small in side effect, so that the medicine becomes a promising adjuvant therapy means.

Description

Technical Field

[0001] The present invention relates to the technical field of microbiology, and particularly to a Lactobacillus paracasei and its application. Background Art

[0002] Alopecia areata is a common non-scarring hair loss disease with a complex pathogenesis, which is closely related to immune imbalance, genetic factors, mental stress, environment and lifestyle. Its clinical features are irregularly shaped hair loss patches, and in severe cases, it may develop into alopecia totalis or alopecia universalis. Relevant studies have shown that long-term high-fat diet (HFD) can naturally induce alopecia areata, because the inflammatory response, reactive oxygen species and lipid-induced stress caused by obesity can significantly inhibit the signaling pathways related to hair follicle development and cyclic regeneration, thus leading to hair loss.

[0003] Although alopecia areata has no direct impact on people's life safety, due to the long course of the disease, patients will have symptoms such as psychological anxiety and depression, which seriously affect the quality of life, physical and mental health of patients. At present, the treatment methods of alopecia areata mainly include drug treatment and hair transplantation, but they have disadvantages such as strong dependence, obvious side effects and high costs. In addition, the existing treatment methods mainly focus on symptom control and are difficult to fundamentally solve the pathological mechanisms such as inflammation, immune abnormality and metabolic disorder. Therefore, how to relieve alopecia areata from the source through safe and efficient methods has become an urgent technical problem to be solved.

[0004] In recent years, the regulatory role of gut microbiota in overall health, especially in the immune system and skin function, has gradually attracted attention. The "gut-skin axis" theory proposes that gut microbiota can affect skin health by regulating the immune system, metabolites and inflammatory responses. At the same time, with the continuous in-depth research on healthy functional microorganisms, more and more studies have shown that probiotics can relieve or improve hair loss symptoms. This is because probiotics can intervene in metabolic disorders and immune disorders by regulating gut microbiota diversity, enhancing intestinal barrier function and inhibiting systemic inflammation. Therefore, probiotics have gradually become a potential option for the treatment of alopecia areata due to their multi-target regulation, high safety and good clinical transformation potential. Summary of the Invention

[0005] In order to solve the above technical problems, the present invention provides a Lactobacillus paracasei and its application, provides a healthier, safer and more effective treatment method for alopecia areata, and provides a theoretical basis and application reference for the intervention of probiotics in metabolic skin diseases.

[0006] To achieve the above object, the present invention is implemented according to the following technical scheme:

[0007] One of the technical solutions of the present invention is a Lactobacillus paracasei named Lactobacillus paracasei Jlus66, which was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on March 31, 2021, with the accession number CGMCC No. 22101, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] Another technical solution of the present invention is the use of Lactobacillus paracasei in the preparation of a drug for inhibiting alopecia areata induced by a high-fat diet.

[0009] A further technical solution of the present invention is a drug for inhibiting alopecia areata induced by a high-fat diet, which contains Lactobacillus paracasei Jlus66.

[0010] Another technical solution of the present invention is a method for preparing a drug for inhibiting alopecia areata induced by a high-fat diet, which includes the following steps: continuously activating the Lactobacillus paracasei Jlus66 three times through an MRS liquid medium, adding the activated Lactobacillus paracasei Jlus66 to the MRS liquid medium at 2% (v / v), anaerobically culturing at 37°C for 24 h, centrifuging at 4000 g for 20 min, discarding the supernatant, collecting the fermentation product and dissolving it with physiological saline to obtain a fermentation broth with a viable cell count of 1×10 7 cfu / mL - 1×10 9 cfu / mL, thus obtaining the drug for inhibiting alopecia areata induced by a high-fat diet.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] (1) Immunomodulatory effect: Jlus66 can regulate the body's immune response and inhibit the attack of abnormal immune responses on hair follicles. Alopecia areata is usually associated with autoimmune diseases. Jlus66 helps to reduce the immune damage of hair follicles and improve hair growth by promoting anti-inflammatory responses and inhibiting the secretion of pro-inflammatory factors.

[0013] (2) Antioxidant and anti-inflammatory effects: Jlus66 can relieve hair follicle damage caused by free radicals by increasing the activity of antioxidant enzymes and reducing oxidative stress. In addition, Jlus66 can inhibit local and systemic inflammatory responses, reduce inflammatory damage to hair follicles, and further promote hair growth.

[0014] (3) Impact on the gut-skin axis: There is a close connection between the gut microbiota and skin health, known as the "gut-skin axis". Jlus66 can help improve the overall immune status of the body by restoring the balance of the gut microbiota, and thus have a positive impact on skin health. This mechanism of action not only promotes the treatment of alopecia areata but also improves the skin condition.

[0015] (4) High safety and low side effects: Compared with traditional drug treatments, Jlus66 has high safety and a low risk of side effects. Jlus66 has no side effects and will not have obvious negative impacts on the body after long-term use. Therefore, it can provide a safe and sustainable treatment option for patients with alopecia areata.

[0016] In summary, the obvious beneficial effects of Jlus66 in the treatment of alopecia areata include immunomodulation, antioxidant and anti-inflammatory effects, and optimization of the gut-skin axis. In addition, its high safety and low side effects make it a promising adjuvant treatment. Description of the Drawings

[0017] Figure 1 Shows the effect of Jlus66 on the body weight of HFD-induced mice.

[0018] Figure 2 Shows the effect of Jlus66 on the hair of HFD-induced mice.

[0019] Figure 3 Shows the effect of Jlus66 on the liver coefficient of HFD-induced mice.

[0020] Figure 4 Shows the effect of Jlus66 on T-SOD in the serum of HFD-induced mice.

[0021] Figure 5 Shows the effect of Jlus66 on CAT in the serum of HFD-induced mice.

[0022] Figure 6 Shows the effect of Jlus66 on GSH in the serum of HFD-induced mice.

[0023] Figure 7 Shows the effect of Jlus66 on ROS in the serum of HFD-induced mice.

[0024] Figure 8 Shows the effect of Jlus66 on IL-6 in the skin tissue of HFD-induced mice.

[0025] Figure 9 Shows the effect of Jlus66 on IL-8 in the skin tissue of HFD-induced mice.

[0026] Figure 10Effect of Jlus66 on TNF-α in skin tissues of HFD-induced mice.

[0027] Figure 11 Effect of Jlus66 on VEGF in skin tissues of HFD-induced mice.

[0028] Figure 12 Effect of Jlus66 on TGF-β in skin tissues of HFD-induced mice. Detailed implementation manners

[0029] To make the objectives, technical solutions and advantages of the present invention more clear and understandable, the present invention will be further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0030] Example 1. Screening of Lactobacillus paracasei Jlus66

[0031] I. Isolation of candidate strains

[0032] Add 9 mL of physiological saline (NaCl concentration is 0.85% (w / v)) to 1 mL of fermented milk and vortex; prepare a series of dilutions (10 -1 ~10 -8 ) and MRS agar plates containing Bromocresol purple (BCP), and culture at 37°C under anaerobic conditions for 48 h; streak all types of single colonies isolated from the MRS agar streak plates at least three times. Gram-positive strains have a yellow transparent area around the colonies. Microscopic examination of the colonies is carried out, and catalase-negative, Gram-positive rod-shaped and catalase-negative strains are selected, and the isolated strains are re-streaked and purified on MRS agar (pH 6.4) (see specifically: Screening of cholesterol-lowering probiotics and the effect of Lactobacillus paracasei Jlus66 on non-alcoholic fatty liver, author: Li Qian).

[0033] II. Tolerance test under simulated human gastrointestinal conditions

[0034] The isolated candidate strains are successively subjected to acid tolerance test, bile salt tolerance test, bile salt hydrolase activity test, hydrophobicity test, safety evaluation and in vitro cholesterol-lowering test.

[0035] Finally, a strain that shows high survival rate in simulated gastrointestinal fluid, exhibits strong bile salt tolerance and high hydrophobicity is screened out, and this strain is designated as strain Jlus66. And the above results also indicate that strain Jlus66 has the potential to be a probiotic strain.

[0036] Subsequently, strain Jlus66 was subjected to 16S rDNA sequencing, and the obtained 16S rDNA gene sequence was as follows:

[0037] CCCCGTCAATTCATTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAATGCTTAATGCGTTAGCTGCGGCACTGAAGGGCGGAAACCCTCCAACACCTAGCATTCATCGTTTACGGCATGGACTACCAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAGCGTCAGTTACAGACCAGACAGCCGCCTTCGCCACTGGTGTTCTTCCATATATCTACGCATTTCACCGCTACACATGGAGTTCCACTGTCCTCTTCTGCACTCAAGTTTCCCAGTTTCCGATGCGCTTCCTCGGTTAAGCCGAGGGCTTTCACATCAGACTTAAAAAACCGCCTGCGCTCGCTTTACGCCCAATAAATCCGGATAACGCTTGCCACCTACGTATTACCGCGGCTGCTGGCAC。

[0038] Through NCBI Basic Local Alignment Search Tools (BLAST) (GenBank accession number MF489184), it was found that the 16S rDNA gene sequence of strain Jlus66 had a similarity threshold of 99% with Lactobacillus paracasei. Finally, it was named Lactobacillus paracasei Jlus66 and was deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on March 31, 2021, with the deposit number CGMCC No. 22101, and the deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0039] Example 2. Application research of Lactobacillus paracasei in the preparation of drugs for inhibiting alopecia areata induced by high-fat diet 1. In-vivo experiment on mice

[0040] 1) Preparation of the fermentation broth of Lactobacillus paracasei Jlus66

[0041] The Lactobacillus paracasei Jlus66 was continuously activated three times through MRS liquid medium. The activated Lactobacillus paracasei Jlus66 was added to MRS liquid medium at 2% (v / v), anaerobically cultured at 37 °C for 24 h, centrifuged at 4000 g for 20 min. After discarding the supernatant, the fermentation product was collected and dissolved with physiological saline to obtain a fermentation broth with a viable count of 1×10 7 cfu / mL - 1×10 9 cfu / mL.

[0042] 2) Grouping and treatment of mice

[0043] Forty 2-month-old male C57BL / 6 mice were selected for the experiment. The mice were adaptively fed for one week, during which standard feed and pure water were provided. After the adaptive feeding, the mice were weighed and numbered, and then randomly divided into 4 groups of 10 mice each, namely:

[0044] (1) Control group (Group C): Standard feed + 1 mL of physiological saline;

[0045] (2) Model group (Group M): High-fat feed + 1 mL of physiological saline;

[0046] (3) Low-dose group (Group L): High-fat feed + 1 mL of Lactobacillus paracasei bacterial liquid (1×10 7 cfu / mL);

[0047] (4) High-dose group (Group H): High-fat feed + 1 mL of Lactobacillus paracasei bacterial liquid (1×10 9 cfu / mL).

[0048] Taking the line connecting the two ears of the mouse as the horizontal axis (about 2 cm), and taking 2 cm backward from this as the vertical axis, a 2×2 cm 2 square observation area was established at the neck. Gavage was performed at 8:00 am every day for 12 weeks. After the modeling was completed, the mice were fasted for 16 h, anesthetized by injecting sodium pentobarbital, and the blood, hair, viscera, and skin tissues of the mice were collected for subsequent experiments. SPSS (26.0) software was used to analyze the experimental data, and all experimental results were expressed as mean ± standard error (n≥6). ANOVA analysis was used, followed by Tukey post hoc multiple comparisons. If p < 0.05, it was considered statistically significantly different, and if p < 0.01, it was considered extremely statistically significantly different.

[0049] 2. Observation of characterization indicators

[0050] 1) Body weight change

[0051] Record the weights of 4 groups of mice at fixed times every week, and calculate the weight changes. The results are as Figure 1 shown. As Figure 1 shown, long-term high-fat diet significantly increased the body weight of mice (p < 0.01), while supplementing low-dose Jlus66 significantly reduced the body weight of mice (p < 0.01). Among them, the results of the high-dose group were more significant (p < 0.01).

[0052] 2) Observation of general condition and hair

[0053] Observe the general conditions of mice such as mental state, behavioral activities, and food intake every day, and observe the skin, hair color, and hair loss in the observation area on the back of the neck by naked eyes. The results are as Figure 2 shown. As Figure 2 shown, compared with group C, mice in group M showed obvious phenomena such as hair loss and greasy hair. This phenomenon was improved in the two groups of mice supplemented with Jlus66. Among them, the effect of group H was more significant, with almost no hair loss and the hair being more shiny.

[0054] 3) Determination of organ coefficients

[0055] The organ coefficient was calculated according to the formula: organ coefficient = organ mass / body weight of experimental mice × 100%. The results are as Figure 3 shown. As Figure 3 shown, long-term high-fat diet increased the liver coefficient of mice (no significant difference), while supplementing high-dose Jlus66 significantly reduced the liver coefficient (p < 0.01).

[0056] 3. Detection of serum oxidative damage indicators

[0057] Take serum samples and detect the contents of total superoxide dismutase (T-SOD), catalase (CAT), glutathione (GSH), and reactive oxygen species (ROS), which are serum oxidative damage indicators, according to the method described in the kit instruction manual. The results are as Figures 4 - 7 shown. As Figure 4 shown, long-term high-fat diet significantly reduced the level of T-SOD in the serum of mice (p < 0.05), while supplementing high-dose Jlus66 significantly increased the level of T-SOD (p < 0.05). As Figure 5 shown, long-term high-fat diet significantly reduced the level of CAT in the serum of mice (p < 0.05), while supplementing high-dose Jlus66 significantly increased the level of CAT (p < 0.05). As Figure 6 shown, long-term high-fat diet significantly reduced the level of GSH in the serum of mice (p < 0.01), while supplementing high-dose Jlus66 significantly increased the level of GSH (p < 0.05). As Figure 7As shown, long-term high-fat diet significantly increased the level of ROS in the serum of mice (p < 0.01), while supplementation with low-dose Julius66 significantly reduced the level of ROS (p < 0.05), and the results in the high-dose group were more significant (p < 0.01).

[0058] 4. Detection of inflammatory factor indexes in skin tissue

[0059] 1) Pretreatment of skin tissue samples

[0060] Weigh the skin tissue stored at -80°C, cut the skin tissue into small pieces, add 9 times the tissue mass of pre-cooled PBS, and grind it with a tissue homogenizer to make skin homogenate. The whole grinding process is carried out in an ice bath. Centrifuge the grinding solution at 4°C and 12,000g for 20 minutes, collect the supernatant, and store it at -80°C for later use.

[0061] 2) Detection of inflammatory factors in skin tissue

[0062] Detect the contents of interleukin-6 (IL-6), interleukin-8 (IL-8) and tumor necrosis factor-α (TNF-α) in the skin tissue homogenates of the 4 groups respectively, and the operation method refers to the kit instructions. The results are as Figures 8 - 10 shown.

[0063] As Figure 8 shown, long-term high-fat diet significantly increased the level of IL-6 in the skin tissue of mice (p < 0.05), while supplementation with high-dose Julius66 significantly reduced the level of IL-6 (p < 0.05)

[0064] As Figure 9 shown, long-term high-fat diet significantly increased the level of IL-8 in the skin tissue of mice (p < 0.05), while supplementation with low-dose Julius66 significantly reduced the level of IL-8 (p < 0.05), and the results in the high-dose group were more significant (p < 0.05). As Figure 10 shown, long-term high-fat diet significantly increased the level of TNF-α in the skin tissue of mice (p < 0.01), while supplementation with low-dose Julius66 significantly reduced the level of TNF-α (p < 0.01), and the results in the high-dose group were more significant (p < 0.01).

[0065] 5. Detection of growth factor indexes in skin tissue

[0066] Detect the contents of vascular endothelial growth factor (VEGF) and transforming growth factor-β (TGF-β) in the skin tissue homogenates of the 4 groups respectively, and the operation method refers to the kit instructions. The results are as Figures 11 - 12 shown.

[0067] As Figure 11As shown, long-term high-fat diet significantly reduced the level of VEGF in mouse skin tissue (p < 0.05), while supplementation with high-dose Jlus66 significantly increased the level of VEGF (p < 0.05). As Figure 12 shown, long-term high-fat diet significantly reduced the level of TGF-β in mouse skin tissue (p < 0.05), while supplementation with low-dose Jlus66 significantly increased the level of TGF-β (p < 0.01), and the results in the high-dose group were more significant (p < 0.01).

[0068] In summary, the obvious beneficial effects of Jlus66 in alopecia areata treatment include immunomodulation, antioxidant and anti-inflammatory effects, and optimization of the gut-skin axis, and it can be used to prepare drugs for inhibiting alopecia areata induced by high-fat diet.

[0069] The technical solution of the present invention is not limited to the limitations of the above specific embodiments, and any technical deformation made according to the technical solution of the present invention falls within the protection scope of the present invention.

Claims

1. A Lactobacillus paracasei, characterized in that, It is named Lactobacillus paracasei Jlus66, and was deposited on March 31, 2021 at the General Microbiology Center of the China Microbial Culture Collection Center, CGMCC No. 22101, with the deposit address being No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. Use of the Lactobacillus paracasei as described in claim 1 in the preparation of a drug for inhibiting alopecia areata induced by a high-fat diet.

3. A drug for inhibiting alopecia areata induced by a high-fat diet, characterized in that, It contains the Lactobacillus paracasei Jlus66 as described in claim 1.

4. A preparation method of a drug for inhibiting alopecia areata induced by a high-fat diet as described in claim 3, characterized in that, It includes the following steps: The Lactobacillus paracasei Jlus66 was continuously activated three times through MRS liquid medium. The activated Lactobacillus paracasei Jlus66 was added to MRS liquid medium at 2% (v / v), anaerobically cultured at 37 °C for 24 h, centrifuged at 4000 g for 20 min. After discarding the supernatant, the fermentation product was collected and dissolved with physiological saline to obtain a fermentation broth with viable cell counts of 1×10 7 cfu / mL - 1×10 9 cfu / mL, that is, the drug for inhibiting alopecia areata induced by high-fat diet was obtained.

Images