Salt-inducible promoter pagvq5pro and application thereof

Abstract

The present application relates to a kind of salt induction type promoters PagVQ5Pro and its application, it is related to plant genetic engineering technical field, the nucleotide sequence of the promoter PagVQ5Pro as shown in SEQ ID NO.1.The present application is known by GUS dyeing result, and transgenic strain PagVQ5Pro-OE1, 3 of overexpression poplar promoter PagVQ5Pro can significantly enhance GUS dyeing activity under salt induction condition, thus proving that poplar promoter PagVQ5Pro is expressed by salt induction, and it is laid theoretical foundation for its application in stress resistance breeding.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a salt-inducible promoter PagVQ5Pro and its applications. Background Technology

[0002] Poplar (Populus L.) is an important fast-growing timber species widely used in papermaking, ecological restoration, and carbon sink forest construction. However, severe soil salinization severely restricts its planting range and productivity. Salt stress leads to ion imbalance, membrane system damage, and growth inhibition in poplars, necessitating genetic improvement to enhance their salt tolerance. Currently, plant salt tolerance genetic engineering focuses primarily on the overexpression of functional genes (such as ion transporters and antioxidant enzyme genes). However, their constitutive expression may cause energy consumption or growth inhibition under non-stress conditions. Therefore, developing stress-inducible promoters (such as salt-stress-inducible promoters) to achieve precise gene regulation under specific environments is crucial for improving the safety and effectiveness of transgenic technologies.

[0003] Previous studies have shown that the expression level of the CDM1 promoter, cloned from the Arabidopsis CDM1 gene promoter region, is significantly induced by salt. The rice promoter POsSalt1 specifically initiates the expression of exogenous genes in plants under salt stress. These findings indicate the existence of promoter elements in plants that respond to salt stress and can regulate the expression of related genes under these conditions, potentially participating in plant salt tolerance mechanisms and possessing significant application value in agricultural biotechnology. However, research on stress-inducible promoters in poplar is currently limited. Therefore, this invention provides a salt-inducible promoter, PagVQ5Pro, and its applications. Summary of the Invention

[0004] The purpose of this invention is to provide a salt-induced promoter PagVQ5Pro and its applications in order to solve the above-mentioned problems.

[0005] The present invention achieves the above objectives through the following technical solutions:

[0006] This invention provides a salt-inducible promoter PagVQ5Pro, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The present invention also provides an overexpression vector containing the promoter PagVQ 5Pro as described above.

[0008] As a further optimization of the present invention, the overexpression vector is pMDC164.

[0009] The present invention also provides a genetically engineered bacterium containing the above-mentioned overexpression vector.

[0010] As a further optimization of the present invention, the genetically engineered bacteria is Agrobacterium.

[0011] This invention also provides an application of the salt-inducible promoter PagVQ5Pro in plant salt stress-induced expression.

[0012] As a further optimization of the present invention, the promoter PagVQ5Pro drives the expression of the target gene in poplar trees under salt stress.

[0013] As a further optimization of the present invention, the plant is a poplar.

[0014] This invention also provides a method for obtaining the salt-induced expression promoter PagVQ5Pro as described above. Using the nucleotide sequence shown in SEQ ID NO.1 as a template, the nucleotide sequence of PagVQ5Pro is obtained by cloning using DNA molecular cloning technology. The primer sequences for DNA molecular cloning are as follows:

[0015] SEQ ID NO.2: GGATCAAGCCTCAAAATACCT;

[0016] SEQ ID NO. 3: AGTGCGGCCTAACTATACCTT.

[0017] The beneficial effects of this invention are as follows:

[0018] This invention reveals through GUS staining results that transgenic lines (PagVQ5Pro-OE1, 3) overexpressing the poplar promoter PagVQ5Pro can significantly enhance GUS staining activity under salt-induced conditions, thus proving that the poplar promoter PagVQ5Pro is induced by salt, laying a theoretical foundation for its application in stress-resistant breeding. Attached Figure Description

[0019] Figure 1 Agarose gel electrophoresis images (WT: control group; Populus promoter transgenic lines PagVQ5Pro-OE1, 3);

[0020] Figure 2 The images show the salt-induced staining results of leaves from the control group WT and the transgenic poplar promoter lines PagVQ5Pro-OE1 and 3 in the salt-induced experiment of poplar seedlings. Detailed Implementation

[0021] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0022] 1. Materials

[0023] Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.

[0024] 2. Method

[0025] 2.1 Cloning the promoter sequence

[0026] Using the PagVQ5Pro gene cloning primers in Table 1, the nucleotide sequence of the PagVQ1 promoter as shown in SEQ ID NO.1 was cloned from the poplar genome. The PCR product was constructed into a T vector to obtain the PagVQ5Pro cloning vector, which was then preserved and sequenced. The successfully sequenced PagVQ5Pro cloning vector was used as a template for the next step of the experiment.

[0027] Table 1. Primer sequences for PagVQ5Pro gene cloning

[0028]

[0029] 2.2 Construction of PagVQ5Pro promoter overexpression vector

[0030] The overexpression vector for PagVQ5Pro was constructed using Gateway technology, as detailed below:

[0031] 2.2.1 Primer Design and PCR Amplification

[0032] Gateway adapters were added to the F and R ends of the primers in step 2.1 above. The primer sequences with gateway adapters are shown in Table 2. Cloning was performed using the PagVQ5Pro cloning vector as a template.

[0033] Table 2 Primer sequences for PCR amplification

[0034]

[0035] The PCR reaction system is shown in Table 3:

[0036] Table 3 PCR reaction system

[0037]

[0038] Each component was added sequentially to a sterile PCR tube, mixed, centrifuged, and then placed in a gradient PCR instrument for PCR amplification. The program was as follows: 98℃ pre-denaturation for 10 min; 98℃ denaturation for 30 sec; 55℃ annealing for 30 sec; 72℃ extension for 1 min; 72℃ final extension for 10 min. The denaturation-annealing-extension steps were set for 35 cycles. After the reaction, 2.5 μl of 10× DNA Loading Buffer was added to the PCR tube for agarose gel electrophoresis, and the band positions were then observed using a gel imaging system.

[0039] 2.2.2 Gel recovery of PCR products

[0040] Cut the correctly positioned and bright gel block into a sterile 1.5ml dorf tube using a gel cutter. Then, recover the gel using a gel recovery kit (Axygene) as follows:

[0041] a. Add 400 μL of buffer DE-A to a centrifuge tube and heat in a 75°C metal bath until the gel melts;

[0042] b. Add 200 μL of buffer DE-B and mix well. Transfer to a 2.0 ml preparation tube and incubate at 12000 rpm for 1 min.

[0043] c. Discard the waste liquid, add 500 μL of buffer W1, and centrifuge at 12000 rpm for 30 seconds;

[0044] d. Discard the waste liquid, add 700 μL of buffer W2, centrifuge at 12000 rpm for 1 min, and repeat once;

[0045] e. Place the empty tube in a centrifuge and centrifuge at 12,000 rpm for 1 minute to completely remove the liquid from the preparation column;

[0046] f. Place the preparation tube into a sterilized 1.5 ml centrifuge tube and incubate at room temperature for 20 min until the anhydrous ethanol has completely evaporated. Add 25 μL of preheated Elution buffer (65 °C) for elution to obtain a solution containing the target gene PagVQ5Pro. Store at -20 °C.

[0047] 2.2.3 Construction of the vector via BP reaction

[0048] The target gene PagVQ5Pro obtained in step 2.2.2 above was cloned into the intermediate vector pDONR207 via a BP reaction. The reaction system is shown in Table 4.

[0049] Table 4. Reaction system of BP reaction

[0050]

[0051] After 6 hours of ligation at 25℃, the PCR product was recovered via gel extraction (using the same method as step 2.2.2). Then, E. coli transformation and sequencing were performed. The specific experimental steps are as follows:

[0052] a. Add 5 μL of the reaction product to 50 μL of E. coli competent cells, freeze on ice for 30 min, heat shock in a metal bath at 42 °C for 1 min, and then freeze on ice for another 2 min;

[0053] b. Add 200 μL of LB to the laminar flow hood and incubate at 37°C and 180 r / min for 1 h. Then, take 100 μL of bacterial culture from the laminar flow hood and spread it evenly on LB solid medium containing Kan antibiotic using a spreader.

[0054] c. Place the culture dish coated with bacterial solution face up in an incubator at 37°C and incubate for 30 minutes. Then invert the dish and incubate for about 12 hours. Observe the growth of bacterial plaques.

[0055] d. Use a pipette tip to pick up a single, well-grown colony and inject it into 1 ml of liquid culture medium containing Kan antibiotic. Place the culture medium in a shaker at 37°C and 220 rpm for 4-5 hours for subculture.

[0056] e. Send the mixed bacterial culture to the biotechnology company for sequencing. Based on the returned results, construct the correct bacterial culture and preserve it (bacterial culture: glycerol = 1:1). The remaining bacterial culture can be further subcultured in large quantities and then plasmids can be extracted and preserved. Alternatively, the plasmids returned by the company can be preserved.

[0057] 2.2.4 LR Reaction for Vector Construction

[0058] After the intermediate vector in step 2.2.3 above was correctly constructed and sequenced, the target gene PagVQ5Pro was constructed into the overexpression vector pMDC164 using the LR reaction, with the vector pMDC164 without the target gene ligated as a control. The reaction system is shown in Table 5.

[0059] Table 5. Reaction system of LR reaction

[0060]

[0061] At 25℃, ligation was performed for 6 hours, followed by gel recovery of the PCR product, transformation, and sequencing (using the same steps as in 2.2.2). Then, plasmids were extracted and finally introduced into Agrobacterium competent cells GV3101, with the specific steps as follows:

[0062] (1) Take out Agrobacterium competent cells (GV3101) from the ultra-low temperature freezer and thaw them on ice to a freeze-thaw state;

[0063] (2) Take 2.5 μl of the recombinant plasmid obtained in step 2.2.3 into 50 μl of Agrobacterium competent cells, bury on ice for 5 min, flash freeze in liquid nitrogen for 5 min, heat shock in a metal bath at 37℃ for 5 min, and continue to bury on ice for 5 min;

[0064] (3) Add 200 μl of LB liquid culture medium to the clean bench and place it in a shaker at 28°C and 200 r / min for 4-5 h.

[0065] (4) Take 100 μl of bacterial culture and spread it evenly on LB solid medium containing two antibiotics, Kan and Rif. First, place it upright in an incubator at 28°C and incubate for 30 min. Then, invert it and incubate in the dark for 2 to 3 days.

[0066] (5) Pick a single colony on the clean bench and put it into 1 ml of LB liquid medium containing Kan and Rif. Then place the culture tube on a shaker at 28°C and 220 r / min for 24-48 h.

[0067] (6) After the bacterial culture is shaken and mixed, bacterial culture PCR is performed (the PCR procedure is the same as step 2.2.1). The reaction system is shown in Table 6. At the same time, ddH2O and plasmid are used to set positive and negative controls to ensure the successful transformation of the recombinant plasmid. After successful transformation, the bacterial culture is stored at -80℃.

[0068] Table 6 Reaction system for bacterial culture PCR

[0069]

[0070]

[0071] 3. Poplar genetic transformation

[0072] 3.1 Genetic transformation steps

[0073] a. Add the Agrobacterium obtained in step 2.2.4 above to LB medium containing the corresponding Kan and Rif and shake vigorously until its OD600 value reaches about 0.6;

[0074] b. In a clean bench, place the cut leaves of 84K poplar with wounds into the bacterial solution from the previous step, and shake on a low-speed horizontal shaker for about 20 minutes.

[0075] c. After the infected leaves have been dried to remove excess bacterial solution, place them in differentiation medium and incubate in the dark at 24°C for 2 days.

[0076] d. After 2 days of dark culture, the leaves are transferred to a selection medium containing hygromycin and termethin for selection. Resistant buds will generally appear in about 20 days.

[0077] e. Cut off the resistant seedlings and transfer them to a rooting medium containing the same resistance. After rooting, propagate them and detect the expression level.

[0078] 3.2 Identification of transgenic poplar trees by PCR

[0079] Using the GUS gene primer pair GUS-F / GUS-R (as shown in Table 7), PCR was used to identify whether the pMDC164 vector fragment had been successfully transferred into resistant plants. Meanwhile, non-transgenic poplar (WT) was used as a negative control.

[0080] Table 7 Primers related to GUS transgenic identification

[0081]

[0082] The PCR amplification procedure is shown in Table 8:

[0083] Table 8 PCR Amplification Procedure

[0084]

[0085]

[0086] PCR identification results as follows Figure 1 As shown, the successfully transformed resistant plants PagVQ5Pro-OE1 and 3 were selected as transgenic lines of poplar with PagVQ5Pro overexpression promoter.

[0087] 3.3 Salt Induction Experiment

[0088] 3.3.1 Preparation of culture medium

[0089] Transgenic poplar lines overexpressing PagVQ5Pro (PagVQ5Pro-OE1, 3) and control group (WT) were used for propagation. The culture medium formula was as follows: 1 L system formula (MS: 2.215 g; sucrose 10 g; agar: 8 g).

[0090] 3.3.2 Salt Induction Experiment Procedure

[0091] 1) Pull out the poplar seedlings with their roots after they have grown for 4 weeks and soak them in 200mM NaCl solution (the roots of the poplar seedlings are immersed in the salt solution) for 0 hours, 3 hours, 6 hours and 12 hours respectively. Take leaves from each seedling in the soaking at each time period.

[0092] 2) Place the leaves taken at each time point into 2ml centrifuge tubes and add GUS solution. Soak the entire leaf in GUS solution for dark incubation for 24 hours. Then, put the leaves into centrifuge tubes containing 70% ethanol and boil them in a 95℃ water bath for 10-15 minutes to remove the chlorophyll from the leaves. Observe the leaf color.

[0093] GUS staining principle: The GUS gene encodes β-glucuronidase (GUS), an enzyme that catalyzes the hydrolysis of many β-glucosidase esters. It can break down 5-bromo-4-chloro-3-indolyl-β-glucuronide (X-Gluc) into a blue substance.

[0094] Decolorization results as follows Figure 2 As shown: Based on leaf staining, it can be seen that compared with the control group, the GUS staining activity of the transgenic poplar promoter overexpressing PagVQ5Pro (PagVQ5Pro-OE1, 3) was significantly enhanced under salt-induced conditions, indicating that the promoter PagVQ5Pro is induced to express by salt.

[0095] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A salt-inducible promoter PagVQ5Pro Its characteristics are, The promoter PagVQ5Pro The nucleotide sequence is shown in SEQ ID NO.

1.

2. An overexpression vector, characterized in that, The overexpression vector contains the promoter as described in claim 1. PagVQ5Pro.

3. The overexpression vector according to claim 2, characterized in that, The overexpression vector is pMDC164.

4. A genetically engineered bacterium, characterized in that, The genetically engineered bacteria contain the overexpression vector as described in any one of claims 2-3.

5. The genetically engineered bacterium according to claim 4, characterized in that, The genetically engineered bacterium is Agrobacterium.

6. A salt-induced expression promoter as described in claim 1 PagVQ5Pro Its application in plant salt stress-induced expression is characterized by... The plant in question is a poplar.

7. The application according to claim 6, characterized in that, The promoter PagVQ5Pro The expression of target genes was driven under salt stress in plants.

8. A salt-induced expression promoter as described in claim 1 PagVQ5Pro The method for obtaining is characterized by, Using the nucleotide sequence shown in SEQ ID NO.1 as a template, DNA molecular cloning technology was used to clone the sample. PagVQ5Pro The nucleotide sequence, of which the primer sequences for DNA cloning are as follows: SEQ ID NO.2: GGATCAAGCCTCAAAATACCT; SEQ ID NO. 3: AGTGCGGCCTAACTATACCTT.

Images