Application of porcine cumulus cell miR-31 in improving maturation quality of oocytes

By applying pig cumulus cell miR-31, the maturity quality of oocytes is improved, and the problem of insufficient maturity of oocytes in the prior art is solved, and the efficient in vitro maturation of oocytes and the improvement of antioxidant stress ability of oocytes is achieved.

CN120272483APending Publication Date: 2025-07-08YANBIAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510433746.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-08
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

The prior art is difficult to effectively improve the maturity quality of oocytes, resulting in problems such as decreased fertilization rate, reduced embryonic development potential and chromosomal abnormalities.

Method used

By applying pig cumulus cell miR-31, the level of cumulus cell expansion is improved, the mitochondrial membrane potential of oocytes is enhanced, the antioxidant stress ability is improved, and the oocyte apoptosis is inhibited, and recombinant overexpression vectors and host cells are cultured in vitro.

Benefits of technology

Significantly improve the maturation quality of oocytes, enhance mitochondrial function, reduce oxidative stress, target MAPK8 to participate in the JNK pathway, inhibit oocyte apoptosis, and improve the quality of oocytes in vitro.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120272483A_ABST
    Figure CN120272483A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of medical biology, and particularly relates to application of porcine cumulus cell miR-31 in improvement of maturation quality of oocytes, and the nucleotide sequence of the porcine cumulus cell miR-31 is shown as SEQ ID NO.1. The invention also relates to a preparation method of the porcine cumulus cell miR-31. The miR-31 can improve the cumulus expansion level, improve the oocyte quality, enhance the mitochondrial function and reduce oxidative stress, target MAPK8 to participate in a JNK channel, inhibit the apoptosis level of the oocyte and remarkably improve the in-vitro oocyte quality. The miR-31 can be used as a potential biomarker for maturation of oocytes. The results provide a theoretical basis for further discussing the effect of miRNA participating in proliferation and differentiation of animal reproduction related cells and the action mechanism of miRNA on follicle development and oocyte maturation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of pharmaceutical biotechnology, and particularly relates to the application of porcine cumulus cell miR-31 in improving the maturation quality of oocytes. Background Art

[0002] After a long growth and development period, mature oocytes are successfully ovulated from follicles in the mammalian ovary and acquire the ability to be fertilized and develop. The acquisition of this ability is achieved by completing nuclear and cytoplasmic maturation. In vivo, oocyte maturation is affected by multiple factors, including the regulation of the interaction between oocytes and granulosa cells. Cumulus cells form gap junctions with oocytes and support the development of oocytes by providing small molecule substances, such as metabolites.

[0003] During the transformation from primordial follicles to primary follicles, proteins and mRNAs necessary for the maturation process and early embryonic development accumulate in the cytoplasm. In immature oocytes, nuclear maturation includes germinal vesicle breakdown, chromosome condensation and separation, completion of meiosis I, extrusion of the first polar body, and metaphase arrest of the second meiosis MII. The nuclear maturation of mature oocytes is accompanied by the entire follicular development stage. Cytoplasmic maturation is achieved through the accumulation of mRNAs, proteins, metabolic substrates, and nutrients, as well as the reorganization of the cytoskeleton and organelles. The characteristics of cytoplasmic maturation of oocytes are multiple events, including the reorganization of organelles such as mitochondria, endoplasmic reticulum, Golgi apparatus, and lysosomes, and the storage of mRNAs, proteins, and transcription factors required for oocyte maturation. The maturation of oocytes is regulated by multiple factors, including hormone levels, follicular microenvironment, genetic and epigenetic regulation, oxidative stress, and in vitro culture conditions. Abnormal oocyte maturation may lead to a decrease in fertilization rate, reduced embryonic development potential, chromosomal abnormalities, and pregnancy failure. Therefore, improving the maturation quality of oocytes is crucial. Summary of the Invention

[0004] In order to reduce abnormal oocyte maturation and improve the maturation quality of oocytes, the present invention provides the application of porcine cumulus cell miR-31 in improving the maturation quality of oocytes.

[0005] The technical solution adopted by the present invention is as follows:

[0006] The present invention provides the application of porcine cumulus cell miR-31 in improving the maturation quality of oocytes, and the nucleotide sequence of the porcine cumulus cell miR-31 is shown in SEQ ID NO.1.

[0007] Preferably, the improvement of the maturation quality of oocytes includes:

[0008] Enhancing at least one of the cumulus cell expansion level, enhancing the mitochondrial membrane potential of oocytes, enhancing the antioxidant stress of oocytes, and inhibiting oocyte apoptosis.

[0009] Preferably, the enhancing of the cumulus cell expansion level includes: enhancing at least one of the PTGS2 gene expression level in cumulus cells and the PTX3 gene expression level in cumulus cells.

[0010] Preferably, the enhancing of the antioxidant stress of oocytes includes: enhancing at least one of the glutathione content in oocytes, the SOD1 gene expression level in oocytes, and the GPX4 gene expression level in oocytes.

[0011] The second aspect of the present invention provides a recombinant overexpression vector containing the nucleotide sequence.

[0012] The third aspect of the present invention provides a host cell of the recombinant overexpression vector.

[0013] The fourth aspect of the present invention provides a product for preparing an improved oocyte maturation quality, and the product includes any one of the nucleotide sequence, the recombinant overexpression vector, or the host cell.

[0014] Preferably, the product further includes a pharmaceutically acceptable excipient.

[0015] Preferably, the pharmaceutically acceptable excipient is one or several of a diluent, a disintegrant, a precipitation inhibitor, a glidant, a binder, a dispersant, a suspending agent, an isotonic agent, a thickening agent, an emulsifier, a preservative, and a stabilizer.

[0016] Preferably, the diluent includes any one of starch, lactose, sucrose, and mannitol.

[0017] Preferably, the disintegrant includes any one of starch, microcrystalline cellulose, and low-substituted hydroxypropyl cellulose.

[0018] Preferably, the precipitation inhibitor includes any one of sodium dodecyl sulfate, Tween-80, polyvinylpyrrolidone, and hydroxypropyl methylcellulose.

[0019] Preferably, the glidant includes any one of cationic polyacrylamide, poly(diallyldimethylammonium chloride), and cationic starch.

[0020] Preferably, the binder includes any one of starch paste, hydroxypropyl methylcellulose, and polyvinylpyrrolidone.

[0021] Preferably, the dispersant includes any one of sodium dodecyl sulfate, polyvinylpyrrolidone, and sodium carboxymethylcellulose.

[0022] Preferably, the suspending agent includes any one of gum arabic, tragacanth, sodium carboxymethyl cellulose and hydroxypropyl methylcellulose.

[0023] Preferably, the isotonic agent includes any one of sodium chloride, glucose and mannitol.

[0024] Preferably, the thickening agent includes any one of gum arabic, xanthan gum and sodium carboxymethyl cellulose.

[0025] Preferably, the emulsifier includes any one of sodium dodecyl sulfate, benzalkonium chloride and sorbitan fatty acid ester.

[0026] Preferably, the preservative includes any one of benzoic acid, sorbic acid, methyl p-hydroxybenzoate and benzalkonium bromide.

[0027] Preferably, the stabilizer includes any one of sodium sulfite, sodium bisulfite, tocopherol and disodium ethylenediaminetetraacetate.

[0028] Preferably, the pharmaceutically acceptable dosage form of the product includes one of tablets, capsules, granules, injections, pills, powders, ointments and oral liquids.

[0029] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0030] The present invention provides an application of porcine cumulus cell miR-31 in improving the quality of oocyte maturation. The nucleotide sequence of porcine cumulus cell miR-31 is shown in SEQ ID NO.1. The present invention shows that miR-31 can improve the level of cumulus expansion, improve the quality of oocytes, enhance mitochondrial function, reduce oxidative stress, target MAPK8 to participate in the JNK pathway, inhibit the level of oocyte apoptosis, and significantly improve the quality of in vitro oocytes. miR-31 can be used as a potential biomarker for oocyte maturation. The above results provide a theoretical basis for further exploring the role of miRNA in the proliferation and differentiation of animal reproductive-related cells and its mechanism of action on follicular development and oocyte maturation.

[0031] This invention explores the effect of miR-31 in porcine cumulus cells on cumulus cell expansion and oocyte maturation during in vitro maturation of oocytes. COCs were transfected, and the effect of miR-31 on oocyte maturation was detected by qRT-PCR, fluorescence staining, and WB. The results showed that after porcine COCs were transfected with miR-31, the cumulus expansion genes, oocyte maturation rate, oocyte maturation-related genes, anti-apoptosis-related genes, GSH level, mitochondrial level, mitochondrial membrane potential, lipid droplet size, ATP level, and antioxidant gene expression levels were significantly increased; the ROS level, lipid droplet number, and abnormal distribution rate of cortical granules were significantly decreased. In the miR-31 inhibitor group, the cumulus expansion level, cumulus expansion-related genes, GSH level, lipid droplet number, ER level, mitochondrial level, mitochondrial membrane potential, ATP level, and antioxidant genes were all significantly decreased, while the lipid droplet size and abnormal distribution rate of cortical granules were significantly increased. This invention indicates that miR-31 targets MAPK8 / JNK and promotes in vitro maturation of oocytes. miR-31 can be used as a biomarker for in vitro maturation of oocytes. Brief Description of the Drawings

[0032] Figure 1 Expression of miR-31 in cumulus cells and oocytes before and after COCs maturation.

[0033] Figure 2 Expression of transfected miR-31 in cumulus cells and oocytes. A: From left to right are the bright field and fluorescence images of miR-31 transfected COCs with FAM green fluorescence label; B: Expression level of miR-31 in cumulus cells after transfection; C: Expression level of miR-31 in oocytes after transfection.

[0034] Figure 3 Effect of miR-31 on cumulus expansion of COCs. A: From left to right are the degrees of cumulus expansion in COCs after transfection with mimics NC group, miR-31 mimics group, inhibitor NC group, and miR-31 inhibitor group, scale bar = 500 μm; B: Relative cumulus expansion area after transfection; C: Expression of expansion marker genes of miR-31 transfected into mimics NC group and miR-31 mimics group in cumulus cells; D: Expression of expansion marker genes of miR-31 transfected into inhibitor NC group and miR-31 inhibitor group in cumulus.

[0035] Figure 4 Effect of miRNA-31 on the expression of anti-apoptosis-related genes in cumulus cells. A: miR-31 mimics group; B: miR-31 inhibitor group.

[0036] Figure 5 Effect of miR-31 on oocyte maturation. A: Statistical results of oocyte maturation rate after transfection; B: Expression of genes related to oocyte development in miR-31 mimics group after transfection; C: Expression of genes related to oocyte development in miR-31 inhibitor group after transfection.

[0037] Figure 6 Effect of miR-31 on ER level in oocytes. A: Fluorescence images of oocytes in mimics NC group, miR-31 mimics group, inhibitor NC group and miR-31 inhibitor group from left to right; B: Relative fluorescence level of ER in oocytes.

[0038] Figure 7 Effect of miR-31 on the number and size of lipid droplets in oocytes. A: Fluorescence images of lipid droplets in oocytes in mimics NC group, miR-31 mimics group, inhibitor NC group and miR-31 inhibitor group from left to right; B: Number of lipid droplets in oocytes; C: Statistical results of the size of lipid droplets in oocytes.

[0039] Figure 8 Effect of miR-31 on the distribution of cortical granules in mature oocytes. A: Oocytes with normal cortical granule distribution and oocytes with abnormal cortical granule distribution after transfection from left to right; B: Percentage of oocytes with abnormal cortical granule distribution.

[0040] Figure 9 Effect of miR-31 on mitochondria in mature oocytes. A: Fluorescence images of oocytes in mimics NC group, miR-31 mimics group, inhibitor NC group and miR-31 inhibitor group from left to right; B: Relative fluorescence intensity of oocytes.

[0041] Figure 10 Effect of miR-31 on mitochondrial membrane potential in oocytes. A: Fluorescence images of oocytes; B: Relative fluorescence intensity of red / green in cells.

[0042] Figure 11 Effect of miR-31 on ATP level in mature oocytes. A: Fluorescence images of ATP in oocytes in mimics NC group, miR-31 mimics group, inhibitor NC group and miR-31 inhibitor group from left to right; B: Relative content of ATP in oocytes.

[0043] Figure 12Effect of miR-31 on the oxidative stress level of mature oocytes. A: ROS fluorescence images of oocytes in the mimics NC group, miR-31 mimics group, inhibitor NC group, and miR-31 inhibitor group; B: Relative fluorescence level of oocyte ROS; C: GSH fluorescence images of oocytes in the mimics NC group, miR-31 mimics group, inhibitor NC group, and miR-31 inhibitor group; D: Relative fluorescence level of oocyte GSH; E: Statistics of antioxidant-related genes in the miR-31 mimics group; F: Statistics of antioxidant-related genes in the miR-31 inhibitor group.

[0044] Figure 13 Binding sites of target genes and miR-31. A: Binding site of target gene MAPK8 and miR-31; B: Binding site of target gene RIPK1 and miR-31; C: Binding site of target gene ACSL4 and miR-31;

[0045] Figure 14 To verify the expression level of the target gene of miR-31 in cumulus cells. A: miR-31 mimics group; B: miR-31 inhibitor group.

[0046] Figure 15 Effect of miR-31 on the expression levels of MAPK8 and P-JNK / JNK proteins in cumulus cells. A: MAPK8 protein bands in cumulus cells after transfection of COCs; B: Relative expression level of MAPK8; C: P-JNK and JNK protein bands in cumulus cells after transfection of COCs; D: Relative ratio of P-JNK and JNK. Detailed implementation manners

[0047] The present invention is further illustrated by the following specific examples, but does not limit the scope of the present invention. Modifications or substitutions can be made to the details and forms of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but these modifications or substitutions all fall within the protection scope of the present invention.

[0048] The inventive concept of the present invention is as follows:

[0049] Exosomes are small vesicles released from inside the cell to the outside of the cell and play an important role in intercellular information transmission. Exosomes play a crucial role in regulating physiological processes in the body by transferring various signaling molecules, such as proteins, mRNA, DNA, miRNA, and lipids.

[0050] MicroRNA, namely miRNA, is a small single-stranded non-coding RNA molecule with a length of 19 nt to 24 nt. By binding to the 3′ untranslated region (UTR) of the target gene, it negatively regulates gene expression by inducing gene degradation and transcriptional repression. Various reproductive biological processes and signaling pathways are affected by miRNA, including cell proliferation, apoptosis, steroidogenesis, oocyte growth, oocyte maturation, embryonic development, and pregnancy. In the exosomes of follicular fluid, miRNA-378 is abundant, and it has been shown to regulate the expression of aromatase CYP19A1 in porcine granulosa cells, reducing estradiol levels. In bovine cumulus cells, miR-302d regulates the expression of cyclin-dependent kinase inhibitor 1A, reducing the level of DNA damage, and thereby affecting the cell cycle, proliferation level, relative apoptosis level, and steroid hormone secretion and the expression of related genes. Studies have shown that miR-361-5p is upregulated during follicular atresia, and it enhances GC cell apoptosis by directly targeting the 3′ UTR of vascular endothelial growth factor A mRNA and downregulating its expression.

[0051] miR-31 is involved in a variety of biological processes, including fertility, embryonic development, and bone formation. However, the effect of miR-31 on porcine oocyte development is still unclear. In growing follicles of cattle, the expression of miRNA-31 is upregulated, and it is differentially expressed between large atretic follicles and healthy follicles in cattle. miR-31 is upregulated in healthy follicles, indicating that miR-31 may play a potential role in the selection of dominant follicles and follicle fate determination. Previous studies have shown that miR-31 is decreased during the maturation of porcine MII oocytes compared with GV oocytes. Detection of the expression of miR-31 in GV and MII oocytes showed that the expression of miR-31 was decreased in cumulus and oocytes at the MII stage.

[0052] Early on, miR-31 was discovered in Hela cells, located on chromosome band 9p21.3, and is highly evolutionarily conserved among different species. miR-31 is involved in different cellular and developmental processes by regulating genes related to cell proliferation, differentiation, and apoptosis. In bovine granulosa cells, miR-31 promotes apoptosis by targeting FSHR, and inhibiting the expression of miR-31 increases the expression levels of 3β-hydroxysteroid dehydrogenase 3β-HSD and cholesterol side-chain cleavage enzyme P450scc, promoting P4 synthesis, thereby affecting follicular development and follicular atresia. miR-31 is one of the most highly expressed miRNAs during early development of sea urchins. And miR-31 and some verified targets are enriched on the mitotic spindles of sea urchin embryos and mammalian cells. Using sea urchin embryos, it was found that the developmental retardation caused by miR-31 inhibition was associated with increased cytoskeletal and chromosomal defects. However, its effect on in vitro maturation of porcine oocytes remains unclear to date. Therefore, in this invention, miR-31 was overexpressed or inhibited during in vitro maturation of porcine oocytes to explore the effect of miR-31 on cumulus cells and oocyte maturation, providing a theoretical basis for obtaining high-quality oocytes for fertilization and embryo production.

[0053] Based on this, the present invention provides an application of porcine cumulus cell miR-31 in improving the quality of oocyte maturation, and the nucleotide sequence of the porcine cumulus cell miR-31 is as shown in SEQ ID NO.1.

[0054] Intracellular communication between cumulus cells and oocytes is crucial for many processes during oocyte maturation. Cumulus cells can protect oocytes from oxidative stress and reduce apoptosis. HAS2 is essential for hyaluronic acid synthesis, while PTX3 is produced by cumulus cells during their expansion. PTX3 is localized in the matrix and present in cumulus cells. HAS2 and PTX3 are extracellular matrix components necessary for female animal reproduction and are related to cumulus expansion. PTGS2 is indispensable for the transport from cumulus cells to oocytes and the developmental competence of oocytes. Apoptosis of CCs is negatively correlated with the developmental potential of cumulus-expanded oocytes. Abnormal expression of CASPASE3 and BCL2 may be related to oocyte apoptosis. BAX is an apoptosis regulatory factor that can act as a signal transduction factor and has a pro-apoptotic effect in apoptosis of granulosa cells in porcine atretic follicles. After overexpressing miR-31, the level of cumulus expansion in COCs was significantly increased, the cumulus expansion marker genes PTGS2 and PTX3 were elevated, the expression of the apoptosis-related gene BCL2 was significantly increased, and the expression of BAX was significantly decreased. The results indicate that miR-31 is involved in cumulus expansion of porcine COCs, regulates the function of cumulus cells, and plays an important role in nuclear and cytoplasmic maturation of porcine oocytes during IVM.

[0055] Oocytes can prevent the apoptosis of granulosa cells and cumulus cells by maintaining the concentration of BMP15. In human granulosa cells, oocyte maturation, fertilization, and embryo quality are positively correlated with the expression levels of GDF9 and BMP15 genes in the cells. In addition, CDK1 and Cyclin B1 are related to the maturation promoting factor MPF. Together with MPF, these genes regulate the cell cycle through complex mechanisms, affecting the mitotic and meiotic cell cycles as well as oocyte maturation. Overexpression of miR-31 has no effect on the extrusion rate of the first polar body of oocytes, but the expression levels of GDF9, BMP15, CDK1, and CyclinB1 mRNAs in oocytes increase. The results indicate that miR-31 is involved in regulating and improving the maturation of porcine oocytes during IVM.

[0056] At the same time, the indicators related to cytoplasmic maturation were detected. Mitochondria are oocyte organelles responsible for energy production, calcium homeostasis, cytoplasmic redox regulation, and signal transduction. However, mitochondrial dysfunction can cause perturbations in the oocyte maturation process, ultimately leading to a decline in oocyte quality. The mitochondrial membrane potential MMP generated by the mitochondrial electron transport chain is a key parameter reflecting the mitochondrial functional state. Insufficient ATP supply will have a negative impact on oocyte quality, leading to many adverse events, such as meiotic arrest, abnormal spindle assembly, chromosome segregation errors, and failure of maturation and fertilization. The secretion of CGs and their binding to the plasma membrane are important prerequisites for blocking polyspermy in oocytes. The uniform distribution of CGs in the subcortical region is an important marker of oocyte cytoplasmic maturation and affects subsequent embryo development. Lipid droplets are storage organelles at the center of lipid and energy homeostasis and play a key role in regulating cellular lipid metabolism. During IVM, abnormal lipid metabolism leads to the accumulation of fatty acids FA and the enlargement of lipid droplets in oocytes and cumulus cells. Since the endoplasmic reticulum is an important site for the synthesis of intracellular substances in oocytes, endoplasmic reticulum stress is caused by the accumulation of misfolded proteins, which further leads to the unfolded protein response UPR. Overexpression of miR-31 in oocytes upregulates the mitochondrial membrane potential, increases ATP and mitochondrial content, reduces the lipid droplet content and size, and decreases the abnormal distribution rate of cortical granules. It is shown that miR-31 affects cytoplasmic maturation during the development of porcine oocytes and improves the early developmental potential of oocytes.

[0057] The accumulation of intracellular energy in oocytes helps oocytes resist the excessive production of ROS. The increase in the number and area of lipid droplets in the cytoplasm is closely related to subsequent embryonic development. During IVM, oxidative stress can induce various damages to oocytes, leading to a decline in quality. Excessive ROS can cause a series of oocyte damages, including lipid peroxidation, mitochondrial dysfunction, ATP depletion, apoptosis, and protein oxidative modification. Previous studies have shown that intracellular glutathione is an important antioxidant that plays an important role in detoxifying exogenous substances, maintaining redox homeostasis, and scavenging peroxides. SOD1 and GPX4 are also important antioxidant factors in oocytes, protecting oocytes from oxidative stress. Overexpression of miR-31 reduces the ROS level, increases the GSH level, and elevates the mRNA levels of SOD1 and GPX4 in oocytes. This indicates that miR-31 enhances the antioxidant capacity of porcine oocytes during development.

[0058] Ferroptosis is an iron-dependent regulated necrosis induced by lipid peroxidation in cell membranes. ACSL4 is an important isoenzyme of polyunsaturated fatty acid metabolism that determines ferroptosis sensitivity, which can accelerate the generation of lipid oxides and promote ferroptosis. Receptor-interacting serine / threonine-protein kinase 1, RIPK1, mediates cell death and inflammation. In bovine atretic follicles, the expression level of RIPK1 is significantly elevated compared with healthy follicles. Mitogen-activated protein kinase 8, MAPK8, is an apoptosis-related gene. The upregulation of MAPK8 is related to oocyte dysfunction and is involved in various signaling pathways of granulosa cells. MAPK8 is an important signaling molecule in the C-Jun N-terminal kinase JNK signal transduction pathway. Its functions involve mechanisms such as cell proliferation, cell differentiation, and apoptosis. Studies have shown that MAPK8 is a key element of the JNK signaling pathway. Interference / overexpression of MAPK8 blocks / activates the JNK signaling pathway. The JNK signaling pathway is involved in biological responses such as cell proliferation and differentiation, cell morphology maintenance, cytoskeleton construction, apoptosis, and cell malignant transformation. MiR-31 negatively regulates the mRNA levels of ACSL4, MAPK8, and RIPK1, reduces cumulus cell apoptosis, regulates the MAPK8 / JNK signaling pathway, promotes cumulus expansion, and improves the quality of oocytes.

[0059] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments. In the description of the present invention, unless otherwise specified, the reagents used are commercially available, and the methods used are conventional techniques in the art.

[0060] The abbreviation list of the present invention is shown in Table 1.

[0061] Table 1 Abbreviation list

[0062]

[0063]

[0064] Example 1

[0065] Application of porcine cumulus cell miR-31 in improving the quality of oocyte maturation is as follows:

[0066] The sequence of miR-31 is shown in SEQ ID NO.1.

[0067] SEQ ID NO.1:

[0068] ACTGGAGAGGAGGCAAGATGCTGGCATAGCTGTTAAACTGAGAACC TGCTATGCCAACATATTGCCATCTTTCTTGTC.

[0069] 1. The materials and methods used in the present invention are as follows.

[0070] 1.1 In vitro maturation culture.

[0071] The porcine ovaries used in the present invention are from commercial sows raised in a slaughterhouse in Yanji City, Jilin Province.

[0072] The porcine ovaries collected from the slaughterhouse are transported to the laboratory in a thermos flask containing physiological saline with double antibiotics. After trimming the excess tissue around the ovaries, they are rinsed with physiological saline at 37°C until no blood oozes out. Follicles with a diameter of 6 mm are aspirated with a 10 mL syringe and placed in a centrifuge tube, and left standing in a water bath for 30 min. The supernatant is removed, and the precipitate is placed in a culture dish containing washing solution. COCs wrapped with three or more layers of cumulus cells are collected under a microscope and placed in the maturation culture medium that has been equilibrated in an incubator. They are incubated in an IVM I medium in an incubator at 38.5°C and 5% CO2 for 22 h. Then the medium is changed to an IVM II medium and cultured for 22 h. In the culture dish, 50 COCs are placed in each well and cultured in an incubator at 37°C and 5% CO2 for 44 h in vitro until the oocytes are mature.

[0073] The formula of the IVM I medium is: 10% FF, 10% FBS, 10 IU / mL HCG, 10 IU / mL PMSG, 0.06 mg / mL L-cysteine, 7.5 mg / mL penicillin, and 5 mg / mL streptomycin are added to the TCM199 basal medium.

[0074] The formula of the IVM II medium is: 10% FF, 10% FBS, 0.06 mg / mL L-cys, 7.5 mg / mL penicillin, and 5 mg / mL streptomycin are added to the TCM199 basal medium.

[0075] 1.2. Transfect GV-stage COCs with miRNA.

[0076] Connect miR-31 with overexpression vector and low-expression vector respectively to obtain recombinant overexpression vector and recombinant low-expression vector. Use Lipofectamine TM 3000 to transfect the recombinant overexpression vector, recombinant low-expression vector, and the empty vectors of the recombinant overexpression vector and recombinant low-expression vector into cells to obtain miR-31 overexpression group miR-31 mimics, miR-31 inhibition group miR-31 inhibitor, mimics NC control group, and inhibitor control group. Subsequently, culture COCs, and collect cumulus and oocytes after 44 h for experiments.

[0077] 1.3. Collect oocytes and cumulus cells.

[0078] After in vitro culture for 44 h, put the COCs into hyaluronidase, and pipette to remove the cumulus cells around the oocytes. Wash the oocytes three times in PBS and put them into a 1.5 mL centrifuge tube for storage at -80 °C. Pipette the cumulus cells into a 1.5 mL centrifuge tube, centrifuge at 1500 rpm for 5 min, discard the supernatant, then put it into PBS, pipette and centrifuge, wash three times with PBS and store at -80 °C.

[0079] 1.4. Extraction, reverse transcription, and real-time fluorescence quantification of miRNA.

[0080] Extract miRNA from cumulus cells and oocytes according to the miRNeasy Micro Kit kit instructions. Use the MiRcute Plus miRNA First-Strand cDNA Kit for reverse transcription. Reaction program: 42 °C for 60 min, 95 °C for 3 min. The real-time fluorescence quantitative primers for miRNA are shown in Table 2. Use RNU6B as an internal reference and the MiRcute Plus miRNA qPCR Kit for relative quantification. Reaction program: The initial template is denatured at 95 °C for 15 min for 1 cycle; then denatured at 94 °C for 20 s, 60 °C for 34 s, for 45 cycles.

[0081] Table 2 miRNA primer sequences

[0082] Sequence number MicroRNA Primer sequence, 5'→3' SEQ ID NO.2 ssc-miR-31 F: GGCAGGCAAGATGCTGGCATAGCTG SEQ ID NO.3 RNU6B F: CGCGCAAGGATGACACGCAAATTCG

[0083] 1.5. Extraction, reverse transcription, and real-time fluorescence quantification of total RNA.

[0084] Total RNA was extracted from oocytes and cumulus cells using a micro total RNA extraction kit. Reverse transcription was performed using the FastKing One-Step Genomic DNA Removal and cDNA Synthesis Premix Kit, and the reaction program was 42°C for 15 min and 95°C for 3 min. The cDNA sequences of PTX3, HAS2, PGRS2, CDK1, CyclinB, GDF9, BMP15, BCL2, BAX, CASPASE3, SOD1, GPX4, MAPK8, RIPK1, ACSL4, and GAPDH were searched in NCBI, and primers were designed using Primer5.0. The specific primer information is shown in Table 3. The operation was carried out according to the FastStart Universal SYBR Green Master kit. The reaction program was 95°C for 10 min; 95°C for 5 s, 60°C for 30 s, 72°C for 15 s, for 40 cycles.

[0085] Table 3 Primer sequences

[0086]

[0087]

[0088] 1.6. Cortical granule staining of oocytes.

[0089] Oocytes at metaphase II of meiosis II, i.e., MII oocytes, were washed 3 times with PBS and then placed in 4% paraformaldehyde for fixation at room temperature for 1 h. After washing 3 times with PBS, they were placed in 0.5% Triton for permeabilization for 30 min. After washing 3 times with PBS, they were blocked with 5% BSA for 1 h. Finally, after washing 3 times with PBS, the oocytes were placed in 100 μg / mL PNA-FITC and incubated in the dark at room temperature for 30 min for staining, then washed 3 times with PBS, and observed and photographed under a fluorescence microscope. Each group consisted of 30 oocytes and was repeated three times.

[0090] 1.7. Measurement of mitochondrial membrane potential of oocytes.

[0091] MII oocytes were washed 3 times with PBS, and then each group of oocytes was placed in a mixture of 100 μL IVM and 100 μL JC-1 working solution, incubated in the dark at 37°C in a 5% CO2 incubator for 30 min, and then the oocytes were transferred to 100 μL JC-1 staining buffer prepared in advance and washed 2 times, and then 100 μL IVM was added to the second washing well, and observed and photographed under a fluorescence microscope in the dark environment. Each group consisted of 30 oocytes and was repeated three times.

[0092] 1.8. Mitochondrial staining of oocytes.

[0093] MII oocytes were washed three times with PBS and then placed into 200 nM Mito-Tracker working solution, incubated for 30 min under incubator conditions, washed three times with PBS, and observed and photographed under a fluorescence microscope. Each group consisted of 30 oocytes and was repeated three times.

[0094] 1.9. ROS and GSH staining of oocytes.

[0095] MII oocytes were washed three times with PBS and then placed into 1 μM DCFH-DA and 1 μM CMF2HC staining solutions, incubated for 30 min in the dark in a 37 °C, 5% CO2 incubator, washed three times with PBS, and finally observed under a fluorescence microscope. Each group consisted of 30 oocytes and was repeated three times.

[0096] 1.10. Lipid droplet and ATP staining of oocytes.

[0097] BODIPY493 / 503 is a neutral lipid dye that has recently been used to detect lipid droplets in oocytes and has been shown to bind to the lipid droplet protein ADRP in mice and cattle. MII oocytes were washed three times with PBS and then fixed in 4% paraformaldehyde fixative at room temperature for 1 h. After washing three times with PBS, the oocytes were placed into 10 μg / mL BODIPY493 / 503 and 500 nM BODIPYFL ATP staining solutions, incubated for 30 min in the dark at room temperature, washed three times with PBS, and then observed under a microscope. Each group consisted of 30 oocytes and was repeated three times.

[0098] 1.11. Endoplasmic reticulum staining of oocytes.

[0099] ERTrackerRed is a red dye that can specifically bind to the endoplasmic reticulum (ER) in cells. After live staining of oocytes, it can show the distribution of ER in the oocyte cytoplasm. MII oocytes were washed three times with PBS and then placed into 1 μM ERTrackerRed staining solution, incubated for 30 min in the dark in a 37 °C, 5% CO2 incubator, washed three times with PBS, and then observed under a fluorescence microscope. Each group consisted of 30 oocytes and was repeated three times.

[0100] 1.12. Western blot.

[0101] Take out the cryopreserved MII-stage cumulus cells, lyse the cells with RIPA lysis buffer, pipette up and down repeatedly, shake on an ice shaker for 30 min, centrifuge at 4°C and 12,000 g for 15 min, and collect the supernatant. Detect the protein concentration using a BCA protein concentration assay kit. According to the SDS-PAGE gel kit, prepare the separating gel and stacking gel, mix according to the volume ratio of protein to loading buffer of 4:1, incubate in a water bath at 99°C for 5 min, load the sample and the marker according to the calculated data, and end the electrophoresis when the sample runs to the position near the bottom of the gel plate. After transferring to PVDF, wash the membrane with 1×TBST, place it on a shaker, wash 3 times, 10 min each time. Block with 5% skim milk powder, place it on a shaker for 1 h. After blocking, wash the membrane with 1×TBST, place it on a shaker, wash 3 times, 10 min each time. Add the primary antibody at a dilution of 1:1000 and incubate overnight at 4°C. Wash the membrane with 1×TBST, place it on a shaker, after washing 3 times, incubate with the secondary antibody at a dilution of 1:1000 for 1 h. Wash the membrane with 1×TBST, place it on a shaker, wash 3 times, 10 min each time. Evenly drip the developing solution on the PVDF membrane and then take a picture.

[0102] 1.13 Statistical analysis.

[0103] All experiments were performed with three biological replicates. The obtained results were statistically analyzed using GraphPad Prism 10 software, by one-way ANOVA or independent samples T-test. The results were expressed as mean ± standard deviation. P<0.05 was considered statistically significant, and P<0.01 indicated extremely significant differences. The fluorescence intensity was quantified using ImageJ software. In all figures, * indicates significant differences, p<0.05, and ** indicates extremely significant differences, p<0.01.

[0104] 2. The results are as follows.

[0105] 2.1 Expression level of miR-31 in porcine COCs.

[0106] The expression levels of miR-31 in cumulus cells and oocytes of COCs before and after maturation were detected by qRT-PCR. The results are as Figure 1 shown. The expression levels of miR-31 in MII-stage oocytes and cumulus cells were significantly lower than those in GV-stage oocytes.

[0107] 2.2 Transfection efficiency of miR-31 in porcine COCs.

[0108] To explore the effect of miR-31 on porcine COCs, miR-31 labeled with FAM green fluorescence was transfected into porcine COCs. After 6 h, pictures were taken under a fluorescence microscope to observe the transfection efficiency. The results are shown in Figure 2, Cumulus cells and oocytes were collected 38 h after transfection and culture, and the expression levels of miR-31 in cumulus cells and oocytes were detected by qRT-PCR. The results showed that after transfection with miR-31 mimics, the expression level of miR-31 in cumulus and oocytes was significantly increased compared with the control group, while after transfection with miR-31 inhibitor, the expression level was significantly decreased compared with the control group.

[0109] 2.3, Effect of miR-31 on cumulus cell expansion.

[0110] To investigate the effect of miR-31 on cumulus cell expansion, the cumulus cell expansion was observed under a microscope after culturing transfected COCs in vitro for 44 h. The results were as Figure 3 shown. Compared with the control group, the cumulus expansion level in the miR-31 mimics group was significantly increased. While the cumulus expansion level in the miR-31 inhibitor group was significantly decreased. The expression levels of HAS2, PTGS2 and PTX3 in cumulus were detected by qRT-PCR. Compared with the control group, the expression levels of PTGS2 and PTX3 in cumulus cells in the miR-31 mimics group were significantly increased, while the expression level of HAS2 did not change significantly, while the expression levels of HAS2, PTGS2 and PTX3 in the miR-31 inhibitor group were significantly lower than those in the control group.

[0111] 2.4, Effect of miR-31 on the expression of apoptosis genes in cumulus cells.

[0112] To explore the effect of miR-31 on cumulus cell apoptosis, the expressions of anti-apoptosis related genes BCL2, BAX and CASPASE3 in cumulus cells were detected. The results were as Figure 4 shown. Compared with the control group, the expression level of BCL2 in cumulus cells in the miR-31 mimics group was significantly increased, and the expression level of BAX was significantly decreased. The expression level of BCL2 in the miR-31 inhibitor group was significantly decreased, and the expression levels of BAX and CASPASE3 were significantly increased. It is indicated that overexpression of miR-31 can improve the anti-apoptosis ability of oocytes.

[0113] 2.5, Effect of miR-31 on nuclear maturation of porcine oocytes.

[0114] To explore the effect of miR-31 on oocyte maturation, after transfection of COCs for 44 h, the extrusion of the first polar body was observed under a microscope. The results were as Figure 5As shown, compared with the control group, the maturation rate of the miR-31 mimics group was significantly increased. Although the miR-31 inhibitor group decreased compared with the control group, there was no significant difference. It indicated that overexpression of miR-31 could increase the extrusion rate of the first polar body of oocytes. After in vitro culture for 44 h, oocytes in each group were collected. The expression levels of GDF9, BMP15, CDK1, and CyclinB1 in oocytes were detected. As shown in the figure, compared with the control group, the expression levels of GDF9, BMP15, CDK1, and CyclinB1 in oocytes of the miR-31 mimics group were significantly increased, p < 0.05, and the expression levels of GDF9, BMP15, CDK1, and CyclinB1 in the miR-31 inhibitor group were significantly decreased, p < 0.05.

[0115] 2.6. Effects of miR-31 on endoplasmic reticulum stress of oocytes.

[0116] Oocytes were stained with ERTrackerRed staining agent. The results were as Figure 6 shown. Compared with the control group, there was no significant difference in the ER stress level of oocytes in the miR-31 mimics group, while the ER stress level in oocytes of the miR-31 inhibitor group was significantly increased.

[0117] 2.7. Effects of miR-31 on lipid droplet content and size of oocytes.

[0118] Oocyte lipids were stained with BODIPY493 / 503. The results were as Figure 7 shown. Compared with the control group, the number of lipid droplets in oocytes of the miR-31 mimics group was significantly increased, and the size of lipid droplets was significantly decreased, while the number of lipid droplets in the miR-31 inhibitor group was significantly decreased, and the size of lipid droplets was significantly increased. The results indicated that after overexpression of miR-31, the volume of lipid droplets became smaller, the content increased, and the distribution was dense.

[0119] 2.8. Effects of miR-31 on the distribution of cortical granules in mature oocytes.

[0120] During oocyte maturation, the gradual translocation of cortical granules to the periphery is an important mechanism for mammals to reduce polyspermy. Oocyte cortical granules were stained with PNA-FITC. The results were as Figure 8 shown. Compared with the control group, the percentage of oocytes with abnormal distribution of cortical granules in the miR-31 mimics group was significantly decreased, p < 0.05; the percentage of oocytes with abnormal distribution of cortical granules in the miR-31 inhibitor group was significantly increased, p < 0.05. It indicated that overexpression of miR-31 promoted the peripheral distribution of cortical granules in oocytes.

[0121] 2.9. Effects of miR-31 on mitochondria of mature oocytes.

[0122] After transfection of COCs, the mitochondria of oocytes were stained, and the results are as Figure 9 shown. Compared with the control group, the mitochondrial fluorescence level in the miR-31 mimics group was significantly increased, while the mitochondrial fluorescence level in the miR-31 inhibitor group was significantly decreased.

[0123] 2.10. Effects of miR-31 on mitochondrial membrane potential of mature oocytes.

[0124] After transfection of COCs, JC-1 was used for staining, and the results are as Figure 10 shown. Compared with the control group, the mitochondrial membrane potential in the miR-31 mimics group was significantly increased, while the mitochondrial membrane potential in the miR-31 inhibitor group was significantly decreased.

[0125] 2.11. Effects of miR-31 on ATP level of mature oocytes.

[0126] Oocytes were stained with BODIPY FL ATP. The results are as Figure 11 shown. Compared with the control group, the ATP level in the miR-31 mimics group of oocytes was significantly increased, while the ATP level in the miR-31 inhibitor group was significantly decreased.

[0127] 2.12. Effects of miR-31 on oxidative stress level of mature oocytes.

[0128] After transfection of COCs, a reactive oxygen species detection kit was used for staining, and the results are as Figure 12 shown. Compared with the control group, the ROS level in the miR-31 mimics group was significantly decreased. Although the ROS level in the miR-31 inhibitor group of oocytes slightly increased, there was no significant difference. The glutathione level in oocytes was detected by fluorescence staining. Compared with the control group, the GSH level in the miR-31 mimics group was significantly increased, while the GSH level in the miR-31 inhibitor group of oocytes was significantly decreased. The expressions of antioxidant-related genes SOD1 and GPX4 in oocytes were detected by qRT-PCR. Compared with the control group, the expression levels of SOD1 and GPX4 in the miR-31 mimics group of oocytes were significantly increased, while the expression levels of SOD1 and GPX4 in the miR-31 inhibitor group were significantly decreased. It indicates that overexpression of miR-31 can improve the antioxidant ability of oocytes.

[0129] 2.13. Conservation analysis of miR-31.

[0130] Using the miRBase database, the miR-31 sequences of different mammals were compared. The mature miR-31 sequences are highly conserved among many mammals, including pigs, humans, mice, cattle, horses, rabbits, dogs, and chickens, etc., as shown in Table 4. Among different species, there are some differences in the sequences of miRNA-31, but the seed sequences are the same.

[0131] Table 4 Sequence alignment of miR-31 Note: In Table 4, the bold font is the seed sequence.

[0132] 2.14 Prediction of target genes of miR-31.

[0133] Using target gene prediction software such as starBase and miRDB to predict the target genes of miR-31, it was found that miR-31 targets the MAPK8, RIPK1, and ACSL4 genes. As Figure 13 shown.

[0134] 2.15 Verification of target genes of miR-31.

[0135] To further verify the targeting relationship between miR-31 and MAPK8, RIPK1, and ACSL4, after transfection of COCs, the cumulus cells under different treatments were collected, and the expression levels of MAPK8, RIPK1, and ACSL4 were detected by qRT-PCR. The results are as Figure 14 shown. Compared with the control group, the mRNA levels of MAPK8 and RIPK1 in the miR-31 mimics group were significantly decreased, and there was no significant difference in the expression level of ACSL4; the mRNA levels of MAPK8, RIPK1, and ACSL4 in the miR-31 inhibitor group were significantly increased. It was preliminarily determined that MAPK8, RIPK1, and ACSL4 might be the target genes of miR-31.

[0136] 2.16 Effects of miR-31 on the protein levels of target genes and related pathways.

[0137] To further confirm the effect of miR-31 on the in vitro maturation process of oocytes, after transfection of COCs, the cumulus cells under different treatments were collected, and the expression levels of P-MAPK8 and P-JNK / JNK in the cumulus cells were detected by WB. The results are as Figure 15As shown, compared with the control group, the protein level of MAPK8 in the miR-31 mimics group was significantly decreased, and the protein level of P-MAPK8 in the miR-31 inhibitor group was significantly increased. Compared with the control group, the level of P-JNK / JNK in the miR-31 mimics group was significantly decreased, and the level of PJNK / JNK in the miR-31 inhibitor group was significantly increased.

[0138] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope recorded in this specification.

[0139] The above-described embodiments only represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention.

Claims

1. Application of porcine cumulus cell miR-31 in improving the quality of oocyte maturation, characterized in that, The nucleotide sequence of the porcine cumulus cell miR-31 is shown as SEQ ID NO.

1.

2. The application according to claim 1, wherein The improvement of oocyte maturation quality includes: at least one of improving the cumulus cell expansion level, enhancing the mitochondrial membrane potential of oocytes, improving the antioxidant stress of oocytes, and inhibiting oocyte apoptosis.

3. The application according to claim 2, characterized in that, The improvement of the cumulus cell expansion level includes: at least one of increasing the expression level of the PTGS2 gene in cumulus cells and increasing the expression level of the PTX3 gene in cumulus cells.

4. The application according to claim 2, wherein The improvement of the antioxidant stress of oocytes includes: at least one of increasing the glutathione content of oocytes, increasing the expression level of the SOD1 gene in oocytes, and increasing the expression level of the GPX4 gene in oocytes.

5. A recombinant overexpression vector containing the nucleotide sequence recited in claim 1.

6. A host cell containing the recombinant overexpression vector recited in claim 5.

7. A product for preparing to improve the quality of oocyte maturation, characterized in that, The product includes any one of the nucleotide sequence recited in claim 1, the recombinant overexpression vector recited in claim 5, or the host cell recited in claim 7.

8. The product according to claim 7, wherein, The product further includes pharmaceutically acceptable excipients.

9. The product according to claim 8, wherein, The pharmaceutically acceptable excipients are one or several of diluents, disintegrants, precipitation inhibitors, glidants, binders, dispersants, suspending agents, isotonic agents, thickeners, emulsifiers, preservatives, and stabilizers.

10. The product according to claim 7, characterized in that, The acceptable dosage forms of the product include one of tablets, capsules, granules, injections, pills, powders, ointments, and oral liquids.