Gene AaBRC1 for regulating and controlling growth of plant lateral branches and application of gene AaBRC1

Abstract

The invention discloses a gene AaBRC1 for regulating and controlling plant lateral branch development and application, and the gene AaBRC1 is related to plant lateral branch development and is used for regulating and controlling plant types. The nucleotide sequence of the AaBRC1 gene is as shown in SEQ ID No. 1, and the amino acid sequence of the gene coding protein is as shown in SEQ ID No. 2. According to the plant phenotype research after the AaBRC1 gene is knocked out, it is found that the number of lateral branches of the vaccinium bracteatum after the AaBRC1 gene is knocked out is remarkably increased, the length of the lateral branches of the vaccinium bracteatum is remarkably increased, and in other words, regulation and control of the plant type are achieved by inhibiting expression of the AaBRC1 gene; the research finds that the method plays an important role in research and application of directional improvement of plant lateral branch development, and can be widely used for cultivating new varieties of cruciferous crops with different lateral branch states.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and particularly to a gene AaBRC1 for regulating plant lateral branch development and its application. Background Art

[0002] Anthurium andraeanum Linden mainly includes two varieties: Calabrese and Sprouting. Calabrese is the most widely cultivated type, characterized by a thick main stem, large and compact flower heads. The Sprouting type is characterized by small, relatively loose flower heads and many lateral flower heads (Zachary et al., 2020). The number of lateral branches is an important trait of Anthurium andraeanum. There is a relationship of nutrient competition and distribution between the main branch and the lateral branches, and their biomass is negatively correlated. Excessive lateral branches can lead to a 30% reduction in the yield of the main flower head (Takahashi et al., 2019). Therefore, for Calabrese Anthurium andraeanum with the main flower as the product organ, it is necessary to have no or few lateral branches. While for the Sprouting type of Anthurium andraeanum, both the main flower branch and the lateral branches are harvested, and it is necessary to have more lateral branches.

[0003] The development of lateral branches mainly includes two key processes: the initiation and differentiation of axillary meristems and the elongation of lateral buds. The process of lateral branch development is highly plastic and is jointly determined by internal factors (genetic factors, endogenous hormones) and external factors (environmental factors) (Wang et al., 2018; Luo et al., 2021). Key genes, epigenetic factors, hormones and the environment together form a complex and precise network to regulate the growth and development of lateral branches.

[0004] The maize TEOSINTE BRANCHED ONE gene TB1 was strongly selected during the domestication of teosinte into cultivated maize, and its enhanced expression reduced branching (Doebley et al., 1997). It has been reported that the TCP family transcription factor BRANCHED1 (BRC1) is a hub for multiple lateral branch regulatory signaling pathways. It is highly expressed in axillary buds and can inhibit the growth of lateral branches without changing the number of axillary buds (Luo et al., 2021). Arabidopsis BRC1 is an orthologous gene of TB1, and its function is very conserved. In addition, in many important crops such as wheat, cucumber, tomato, pea, and potato, BRC1 has also been confirmed to have a role in regulating branching (Dixon et al., 2020; Xia et al., 2021). In cucumber, CsBRC1 inhibits axillary bud formation by directly inhibiting the function of the auxin efflux carrier CsPIN3 (Shen et al., 2019). In pea, PsBRC1 regulates the growth of axillary buds by integrating SL and CK signals (Braun et al., 2011).

[0005] However, the current research on the genetic regulation of Anthurium lateral branches is still blank, and there is no research on the role of the BRC1 gene in regulating the growth and development of Anthurium lateral branches. Summary of the Invention

[0006] The present invention provides a gene AaBRC1 for regulating plant lateral branch development and its application. By identifying the function of the AaBRC1 gene at the molecular level, it is concluded that the AaBRC1 gene plays an important role in the growth and development of lateral branches.

[0007] To solve the above technical problems, the present invention provides a gene AaBRC1 for regulating plant lateral branch development. The nucleotide sequence of the gene AaBRC1 is shown in SEQ ID No.1, specifically:

[0008]

[0009] To solve the above technical problems, the present invention also provides a coding protein of gene AaBRC1 for regulating plant lateral branch development, and the amino acid sequence of the coding protein is shown in SEQ ID No. 2.

[0010] To solve the above technical problems, the present invention also provides an application of gene AaBRC1 or the coding protein of gene AaBRC1 in regulating plant lateral branch development.

[0011] In a preferred embodiment of the present invention, the regulation of plant lateral branch development includes an increase in the number of lateral branches, or an increase in the number of lateral branches and an increase in the length of the lateral branches.

[0012] In a preferred embodiment of the present invention, it includes obtaining plants with an increase in the number of lateral branches, or an increase in the number of lateral branches and an increase in the length of the lateral branches by knocking out, silencing or directionally mutating the AaBRC1 gene.

[0013] In a preferred embodiment of the present invention, the method for knocking out the AaBRC1 gene includes knocking out the AaBRC1 gene by using DNA homologous recombination technology, Cre / LoxP technology or CRISPR / Cas9 technology.

[0014] In a preferred embodiment of the present invention, the plant is a cruciferous plant, specifically Anthurium andraeanum.

[0015] To solve the above technical problems, the present invention also provides a plant breeding method, which is to obtain plants with a higher number of lateral branches than the original plants by inhibiting the expression of the AaBRC1 gene in the plants.

[0016] The beneficial effects of the present invention are as follows: Through the phenotypic study of plants after knocking out the AaBRC1 gene, it is found that the number of lateral branches of Anthurium andraeanum after knocking out the AaBRC1 gene increases significantly and the length increases significantly, that is, the regulation of the plant architecture is achieved by inhibiting the expression of the AaBRC1 gene; the research of the present invention plays an important role in the research and application of directionally improving plant lateral branch development, and can be widely used to cultivate new varieties of cruciferous crops with different lateral branch states. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 is a schematic structural diagram of the recombinant vector pCas9-AaBRC1;

[0018] Figure 2 is a schematic diagram of the sequencing analysis of the target site mutation of the AaBRC1 gene; in the figure, WT is the wild type; T0#1, T0#3 and T0#11 are T0 generation gene editing lines; the PAM sequence is marked in blue, the target is marked in green, and the insertions and deletions are marked in red;

[0019] Figure 3 This is a statistical comparison chart of the number of lateral branches of the T1 generation after self-pollination and seed retention of the wild-type Anthurium andraeanum plant (WT), and the T0 generation of the edited Anthurium andraeanum plants L461-#1 and L461-#3 after knocking out the AaBRC1 gene.

[0020] Figure 4 This is a statistical comparison chart of the number of lateral branches of the T1 generation after self-pollination and seed retention of the wild-type Anthurium andraeanum plant (WT), and the T0 generation of the edited Anthurium andraeanum plants L461-#1 and L461-#3 after knocking out the AaBRC1 gene. Specific implementation manners

[0021] The following elaborates on the preferred embodiments of the present invention in conjunction with the accompanying drawings, so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby making a clearer and more definite definition of the protection scope of the present invention.

[0022] The implementation of the present invention will use botanical conventional techniques, microorganisms, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination, and bioinformatics techniques that are obvious to those skilled in the art. These techniques have been fully explained in the published literature. In addition, for the methods such as DNA extraction, construction of phylogenetic trees, gene editing methods, construction of gene editing vectors, and obtaining gene-edited plants adopted by the present invention, except for the methods adopted in the following embodiments, the methods disclosed in the existing literature can be used to achieve them. The terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule", or "polynucleotide" used herein mean isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures. These nucleic acids or polynucleotides include gene coding sequences, antisense sequences, and regulatory sequences in non-coding regions, but are not limited thereto. These terms include a gene. "Gene" or "gene sequence" is widely used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in the genomic sequence, and / or include the coding sequence in cDNA, and / or include cDNA and its regulatory sequences. In a particular embodiment, for example, regarding an isolated nucleic acid sequence, it is preferably defaulted to be cDNA.

[0023] In addition, for a more intuitive understanding of the technical solution of the present invention, some professional terms involved in the present invention are explained as follows:

[0024] "Mutant" refers to an individual that has undergone mutation and has the characteristic of a phenotype different from that of the wild type.

[0025] "Expression vectors" refer to vectors that, on the basis of the basic framework of a cloning vector, have expression elements (such as promoters, RBS, terminators, etc.) added to enable the expression of the target gene.

[0026] The anthurium material used in the following examples is CX33. It is an inbred line cultivated and preserved by the applicant's laboratory of this invention and can be distributed to the public for verification tests within twenty years from the application date.

[0027] Example 1

[0028] Cloning of the anthurium AaBRC1 gene

[0029] A total of 3 BRC1 family homologous genes were identified in anthurium. Approximately 1 g of anthurium flower ball samples were taken, added with liquid nitrogen and ground thoroughly. mRNA was extracted using the TIANGEN Plant Total RNA Extraction Kit (DP432). Using this mRNA as a template, the first strand of cDNA was synthesized using the TIANGEN Transcription Kit.

[0030] Using the first strand of the above cDNA as a template, fluorescence quantitative PCR analysis was carried out and it was found that the AaBRC1 gene was highly expressed in the flower ball.

[0031] The following forward primer and reverse primer were designed for PCR amplification.

[0032] The forward primer and reverse primer are:

[0033] AaBRC1-F: ATGTGTAGTTTGTCAGCGAACATGT;

[0034] AaBRC1-R: CTAGAGTTTCTCCGGATTAGGAGTA.

[0035] Using the first strand of the above cDNA as a template, PCR amplification was carried out using the above forward primer and reverse primer, and a sequence of the anthurium AaBRC1 gene was obtained and cloned into the pGEM-T vector.

[0036] Amplification conditions: The PCR system was 10 μl, including 3 μl of ddH2O, 0.5 μl each of the forward primer and reverse primer, 1 μl of DNA template, and 5 μl of 3G Taq Master Mix for PAGE (Red Dye) (product number: P115-02).

[0037] The PCR program was pre-denaturation at 98 °C for 5 min; denaturation at 95 °C for 15 s; annealing at 55 - 58 °C for 15 s; extension at 72 °C for 30 - 45 s; final extension at 72 °C for 5 min; the number of cycles was 32 - 35 times, and the product was stored at 4 °C.

[0038] The CDS sequence of the cloned Anthurium andraeanum AaBRC1 gene is shown in SEQ ID No.3, with a total of 1278 bp. This gene encodes a protein of 426 amino acids, and the sequence is shown in SEQ ID No.2.

[0039] Furthermore, using young leaves of Anthurium andraeanum as materials, genomic DNA was extracted by the CTAB method. Using this genomic DNA as a template, PCR amplification was performed with the above forward and reverse primers to obtain the genomic fragment of AaBRC1. The DNA sequence of the AaBRC1 gene is shown in SEQ ID No.1, with a full length of 1826 bp, containing 4 exons and 3 introns. This indicates that the AaBRC1 gene can be obtained by PCR amplification technology.

[0040] Example 2

[0041] Construction of the Anthurium andraeanum AaBRC1 gene editing vector pCas9 - AaBRC1

[0042] For the Anthurium andraeanum AaBRC1 gene, the highly specific sgRNA target (AGCTTCCACCAACGCTTCCAAGG) of the AaBRC1 gene was predicted by CRSPR - Cas9 using the CRISPOR online website (http: / / crispor.tefor.net / ). Using the modified vector pBWA_V_HU - CASPYL (containing the Cas9 gene, the sgRNA backbone driven by the U6 promoter, and the Bar resistance marker) as a template, the vector was linearized by digestion with BsaI.

[0043] The annealed and synthesized sgRNA double - stranded oligonucleotide was ligated to the linearized vector and transformed into Escherichia coli DH5α competent cells. Positive clones were screened by Bar resistance. After verification by Sanger sequencing that the sgRNA was correctly inserted, the recombinant vector pCas9 - AaBRC1 was obtained (the structural schematic diagram is shown in Figure 1 shown.

[0044] Example 3

[0045] Obtaining mutant Anthurium andraeanum plants by Agrobacterium - mediated transformation

[0046] In this example, by the method of Agrobacterium - mediated transformation of the hypocotyls of Anthurium andraeanum, transgenic explants expressing CRSPR - Cas9 were obtained, and then plants with mutations in the Anthurium andraeanum AaBRC1 gene were screened out. The specific operation method is as follows:

[0047] (1) Obtaining Anthurium andraeanum explants

[0048] Select mature, plump, and disease-free Anthurium andraeanum seeds, disinfect them with 75% alcohol for 3 minutes, then with 8% sodium hypochlorite solution for 10 minutes, and then wash them with sterile water 2 - 3 times. After sterilization, blot the excess water from the seeds in a laminar flow hood and sow them on the germination medium. Cultivate for 7 days under the condition of 16 h light / 8 h darkness, cut the hypocotyls of Anthurium andraeanum into 1 cm lengths, and use them as the recipients for Agrobacterium-mediated transformation.

[0049] (2) Genetic transformation of Anthurium andraeanum

[0050] Cultivate the Agrobacterium containing the pCas9-AaBRC1 plasmid until OD600 = 0.6, and resuspend it with liquid MS medium as the infection solution. Infect the Anthurium andraeanum explants for 10 minutes, and then incubate them in the co-culture medium in the dark at 25 °C for 36 hours; subsequently, transfer the explants to the selection medium containing 10 mg / L Basta concentration, and under the condition of 16 h light / 8 h darkness, replace the selection medium every 14 days. When the resistant buds grow to about 2 - 3 cm in length, cut off the resistant buds and transfer them to the seedling-growing medium, cultivate for 25 days under the condition of 16 h light / 8 h darkness, and then place them in the rooting medium to cultivate for 20 days. Transfer the plants with well-developed roots to nutrient soil for cultivation. After PCR detection of the Bar and Cas9 genes, a total of 12 transgenic plants were obtained.

[0051] (3) Obtaining of Anthurium andraeanum AaBRC1 gene-edited plants

[0052] Extract the genomic DNA of the 12 obtained transgenic plants, amplify the Anthurium andraeanum AaBRC1 gene and perform first-generation sequencing to detect whether there are mutations at the target sites. The typical mutation characteristics are insertions, deletions, or double peaks. A total of 4 AaBRC1 gene-edited plants were detected. The AaBRC1 gene-edited plants flowered 3 months after transplantation, and seeds were harvested 5 months later.

[0053] Example 4

[0054] Analysis of the number and length of lateral branches of Anthurium andraeanum AaBRC1 gene-edited plants

[0055] To clarify the effect of AaBRC1 gene mutation on the growth and development of lateral branches of Anthurium andraeanum, select the edited lines T0 generation L461-#1 and L461-#3 for self-crossing and seed preservation; after identification, the mutations caused by gene editing were stably inherited to the T1 generation plants, and the phenotypic traits of the T1 generation homozygous edited plants were observed and measured.

[0056] As shown in the appendix Figure 3 As shown, count the number of lateral branches. The number of lateral branches of L461-#1#-T1 and L461-#3#-T1 is more than 7, the wild-type control is 4 - 5, and the number of lateral branches of the mutants is significantly increased.

[0057] As shown in the appendix Figure 4As shown, the average total length of the lateral branches of L461-#1#-T1 and L461-#3#-T1 is more than 20 cm, which is significantly longer than that of the wild-type control with an average total lateral branch length of 10 cm. In summary, compared with the wild-type control, the number of lateral branches of the AaBRC1 mutant is significantly increased and the lateral branch length is significantly longer, indicating that the AaBRC1 gene is involved in the growth and development of Anthurium andraeanum lateral branches.

[0058] In summary, the present invention uses the CRISPR / Cas9 technology to knockout the AaBRC1 gene of Anthurium andraeanum, and through the phenotypic analysis of the edited plants, it is clear that this gene inhibits the lateral branch development of Anthurium andraeanum.

[0059] The research results further confirm the conserved function of the BRC1 gene in regulating the lateral branch development of crops, and also provide reference ideas and methods for improving the traits of cruciferous vegetables by molecular biology means.

[0060] In the present invention, the AaBRC1 gene sequence was cloned from the full-length cDNA library of Anthurium andraeanum, and the gene editing vector pCas9-AaBRC1 targeting the AaBRC1 gene was constructed with this sequence. Then, this plasmid was transformed into Anthurium andraeanum to obtain the gene-edited plants of AaBRC1. Through the comparative analysis of the number of lateral branches, it was proved that the number of lateral branches of Anthurium andraeanum after knocking out AaBRC1 increased significantly and the length increased significantly; it shows that the AaBRC1 gene is involved in the growth and development of Anthurium andraeanum lateral branches, and the number of lateral branches of Anthurium andraeanum can be increased by knocking out the AaBRC1 gene.

[0061] The discovery and application of this gene provide gene resources and germplasm basis for the research on the growth and development of Anthurium andraeanum lateral branches, and will play an important role in the research and application of directional improvement of plant lateral branch development, and can be widely used to cultivate new varieties of cruciferous crops with different lateral branch states. The AaBRC1 gene and its encoded protein also provide a scientific basis for further studying the molecular mechanism of plant senescence.

[0062] In addition, there is no particular limitation on the plants applicable to the present invention, as long as they are suitable for gene transformation operations, such as various crops, flower plants, or forestry plants, etc. The plants described above can be (but are not limited to): dicotyledonous plants, monocotyledonous plants, gymnosperms, Brassicales, cruciferous plants. As a preferred method, the "plant" includes but is not limited to: Anthurium andraeanum, and any plant with this gene or a homologous gene is applicable. The "plant" mentioned in the present invention includes the whole plant, its parental and progeny plants, and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues, and organs, and the target gene or nucleic acid exists in these different parts. The "plant" mentioned here also includes plant cells, suspension cultures, callus, embryos, meristematic regions, gametophytes, sporophytes, pollen, and microspores. Similarly, each of the aforementioned objects contains the target gene / nucleic acid.

[0063] The present invention includes any plant cell, or any plant obtained or obtainable by the methods therein, as well as all plant parts and their propagules. This patent also encompasses transfected cells, tissues, organs or whole plants obtained by any of the aforementioned methods. The only requirement is that the offspring exhibit the same genotypic or phenotypic characteristics, and the offspring obtained using the methods in this patent have the same characteristics. The present invention also extends to the harvestable parts of the plants as described above, but is not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. It further relates to other derivatives after the plants are harvested, such as dried granules or powders, oils, fats and fatty acids, starches or proteins. The present invention also relates to foods or food additives obtained from the relevant plants.

[0064] The above are only embodiments of the present invention, and do not limit the patent scope of the present invention accordingly. Any equivalent structural or equivalent process transformations made by using the content of the specification and drawings of the present invention, or directly or indirectly applied in other relevant technical fields, are equally included in the patent protection scope of the present invention.

Claims

1. A gene AaBRC1 that regulates the development of plant lateral branches, characterized in that, The nucleotide sequence of the gene AaBRC1 is shown in SEQ ID No.

1.

2. The encoded protein of the gene according to claim 1, characterized in that, The amino acid sequence of the encoded protein is shown in SEQ ID No.

2.

3. Use of the gene AaBRC1 according to claim 1 and the encoded protein according to claim 2 in regulating the lateral branch development of plants.

4. The application according to claim 3, characterized in that, The regulation of the lateral branch development of plants includes an increase in the number of lateral branches, or an increase in the number of lateral branches and an increase in the length of the lateral branches.

5. The application according to claim 4, characterized in that, It includes obtaining plants with an increased number of lateral branches and an increased length of the lateral branches by knocking out, silencing or directed mutagenesis of the AaBRC1 gene.

6. The application according to claim 5, wherein The method for knocking out the AaBRC1 gene includes knocking out the AaBRC1 gene by using DNA homologous recombination technology, Cre / LoxP technology or CRISPR / Cas9 technology.

7. The application according to claim 3, characterized in that The plant is a cruciferous plant.

8. The application according to claim 7, wherein The plant is Anthurium andraeanum.

9. A plant breeding method, characterized in that, The method is to obtain plants with a higher number of lateral branches than the plant by inhibiting the expression of the AaBRC1 gene in the plant.

10. The method according to claim 9, wherein The inhibition of the expression of the AaBRC1 gene in the plant is knocking out, silencing or directed mutagenesis of the AaBRC1 gene.

Images