Drought resistance related gene TaSINA-3B obtained based on ABA sensitivity of wheat seedling root system and application of drought resistance related gene TaSINA-3B

By reducing the content of TaSINA-3B protein in wheat and/or knocking out its encoding gene, CRISPR/Cas9 technology is used to regulate the drought resistance of wheat, solving the problem of insufficient drought resistance in wheat roots, and significantly improving the drought resistance and water absorption capacity of wheat.

CN120272489APending Publication Date: 2025-07-08INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510401797.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-01
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

The prior art is difficult to effectively improve the drought resistance of wheat, especially in terms of root growth and water absorption capacity.

Method used

By reducing the content of TaSINA-3B protein in wheat and/or reducing the expression of its encoding gene, the TaSINA-3B gene is knocked out using genome editing systems such as CRISPR/Cas9 to regulate drought resistance in wheat.

Benefits of technology

It significantly improves the drought resistance of wheat, enhances the root system's ability to absorb water, and improves the drought resistance and stress resistance of plants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005340008730000111
    Figure BDA0005340008730000111
  • Figure BDA0005340008730000121
    Figure BDA0005340008730000121
  • Figure BDA0005340008730000131
    Figure BDA0005340008730000131
Patent Text Reader

Abstract

The invention discloses a drought-resistant related gene TaSINA-3B obtained based on ABA sensitivity of a wheat seedling root system and application of the drought-resistant related gene TaSINA-3B, and belongs to the technical field of genetic engineering. The technical problem to be solved by the invention is how to improve the drought resistance of wheat. In order to solve the technical problem, the invention provides a method for improving the drought resistance of wheat, the method can comprise the step of reducing the content of TaSINA-3B protein in receptor wheat and / or reducing the expression quantity of a TaSINA-3B protein coding gene in the receptor wheat so as to improve the drought resistance of the receptor wheat, and the TaSINA-3B protein can be the protein with the amino acid sequence shown as the 1st-292th site of SEQ ID NO: 2. Genetic engineering verification shows that the TaSINA-3B protein and the coding gene thereof can regulate and control the drought resistance of plants and have great production and application potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the technical field of genetic engineering, and specifically relates to a drought-resistant related gene TaSINA-3B obtained based on the ABA sensitivity of wheat seedling roots and its application. Background Art

[0002] Drought is one of the key limiting factors restricting global food production. Research shows that food production reduction caused by drought accounts for about half of the total global food production reduction. Wheat, as one of the three major staple food crops for humans and also the main food crop in arid and semi-arid regions, is deeply affected by drought (Gale 2002, Interim Science Council SECRETARIAT FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS, p1-27). In view of this, the development of water-saving agriculture is of crucial significance for ensuring food production increase and water resource conservation, and it is also particularly critical for wheat cultivation and yield improvement. Among many agricultural water-saving measures, biological water-saving, with its economy and high efficiency, has become one of the most potential ways, promising to bring new vitality to wheat cultivation in arid and semi-arid regions and relieve the pressure on food production.

[0003] ABA, as an important plant hormone, plays a crucial role throughout the plant's life cycle. During the seed germination stage, ABA can inhibit the premature germination of seeds, maintain seed dormancy, and ensure seed germination under suitable environmental conditions. During the vegetative growth stage of plants, ABA participates in regulating physiological processes such as root growth, leaf stomatal movement, and photosynthesis in plants. Especially in terms of root growth, the role of ABA is particularly important. The root system is an important organ for plants to absorb water and nutrients, and its growth and development status directly affects the growth and yield of plants. ABA can regulate the growth direction, length, and number of branches of the root system, enabling it to better adapt to different soil environments. Under drought stress conditions, the content of ABA in plants will increase rapidly, thereby promoting the growth and development of the root system, enhancing the water absorption capacity of the root system, and improving the drought resistance of plants. In addition, ABA can also maintain the ion balance in plants and enhance the resistance of plants to adversity such as salinity by regulating the absorption and transport of ions in the root system. However, the process of root depth identification is cumbersome and difficult to directly apply even though it is closely related to drought resistance. With the rapid development of wheat genomics and high-throughput sequencing technology, the number of wheat polymorphic markers has been increasing day by day. The number of SNP markers contained in the developed Wheat 660KSN Parray has reached more than 600,000. Therefore, conducting a genome-wide association study by combining high-throughput gene chip technology is expected to discover high-quality molecular markers for the detection of root depth. On this basis, establishing a high-throughput detection method has extremely high theoretical and application value, which will provide strong technical support for the breeding of drought-resistant wheat varieties and the development of water-saving agriculture, and further promote the sustainable development of the wheat industry in arid and semi-arid regions. Summary of the Invention

[0004] The technical problem to be solved by this application is: how to improve the drought resistance of wheat. To solve this technical problem, the present application provides the following technical solutions:

[0005] The present application provides a method for improving the drought resistance of wheat. The method may include reducing the content of TaSINA-3B protein in the recipient wheat and / or reducing the expression level of the TaSINA-3B protein-encoding gene in the recipient wheat to improve the drought resistance of the recipient wheat.

[0006] The TaSINA-3B protein may be at least one of the following:

[0007] A1), a protein with an amino acid sequence of positions 1-292 of SEQ ID NO: 2;

[0008] A2), a protein obtained by substituting, deleting, and / or adding amino acid residues to the amino acid sequence shown in A1), having more than 70% identity with the amino acid sequence shown in A1), and being related to the drought resistance of wheat;

[0009] A3), a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

[0010] In the present application, the protein may be derived from wheat.

[0011] The above-mentioned protein can be artificially synthesized, or its coding gene can be synthesized first and then obtained through biological expression.

[0012] The present application also provides a method for preparing a target wheat with improved drought resistance, which may include reducing the content of the TaSINA-3B protein in the recipient wheat and / or reducing the expression level of the coding gene of the TaSINA-3B protein in the recipient wheat to obtain a target wheat with improved drought resistance.

[0013] Furthermore, the coding gene of the TaSINA-3B protein may be at least one of the following:

[0014] g1), a DNA molecule whose coding sequence of the coding strand is positions 1 to 897 of SEQ ID NO: 1;

[0015] g2), a DNA molecule whose nucleotide sequence of the coding strand is SEQ ID NO: 3;

[0016] g3), a DNA molecule having more than 70% identity with the DNA molecule of g1) or g2) and regulating wheat drought resistance.

[0017] Furthermore, the reduction of the content of the TaSINA-3B protein in the recipient wheat and / or the reduction of the expression level of the coding gene of the TaSINA-3B protein in the recipient wheat can be achieved by at least one of the following:

[0018] B1), knocking out the coding gene of the TaSINA-3B protein in the recipient wheat through a genome editing system; the genome editing system includes an sgRNA with a target site at positions 1-19 of SEQ ID NO: 4, an sgRNA with a target site at positions 1-19 of SEQ ID NO: 5, and the effector protein Cas9 of CRISPR / Cas9;

[0019] B2), mutating the gene in the recipient wheat, and the mutation includes deleting 148 deoxyribonucleotides at positions 1277-1424 of SEQ ID NO: 3 in the recipient wheat.

[0020] The present application also provides the application of the TaSINA-3B protein and / or biomaterials related to the TaSINA-3B protein, and the application may be any one of the following:

[0021] C1), application in regulating wheat drought resistance;

[0022] C2), Application in the preparation of products for regulating wheat drought resistance;

[0023] C3), Application in wheat breeding or wheat assisted breeding;

[0024] C4), Application in the preparation of products for wheat breeding or wheat assisted breeding.

[0025] Furthermore, the biological material can be at least one of the following:

[0026] D1), A nucleic acid molecule that inhibits or reduces the expression of the TaSINA-3B protein-encoding gene;

[0027] D2), An expression cassette and / or construct containing the nucleic acid molecule described in D1);

[0028] D3), A recombinant vector containing the nucleic acid molecule described in D1) or a recombinant vector containing the expression cassette and / or construct described in D2);

[0029] D4), A recombinant microorganism containing the nucleic acid molecule described in D1), a recombinant microorganism containing the expression cassette and / or construct described in D2), or a recombinant microorganism containing the recombinant vector described in D3);

[0030] D5), A transgenic wheat cell line containing the nucleic acid molecule described in D1), a transgenic wheat cell line containing the expression cassette and / or construct described in D2), or a transgenic wheat cell line containing the recombinant vector described in D3);

[0031] D6), A transgenic wheat tissue containing the nucleic acid molecule described in D1), a transgenic wheat tissue containing the expression cassette and / or construct described in D2), or a transgenic wheat tissue containing the recombinant vector described in D3);

[0032] D7), A transgenic wheat organ containing the nucleic acid molecule described in D1), a transgenic wheat organ containing the expression cassette and / or construct described in D2), or a transgenic wheat organ containing the recombinant vector described in D3);

[0033] D8), A nucleic acid molecule encoding the TaSINA-3B protein;

[0034] D9), An expression cassette and / or construct, recombinant vector, recombinant microorganism, transgenic wheat cell line, transgenic wheat tissue, and / or transgenic wheat organ containing the nucleic acid molecule described in D8).

[0035] Furthermore, the nucleic acid molecule described in D1) can be an RNA targeting the coding gene of the TaSINA-3B protein or a DNA encoding the RNA.

[0036] Further, the target site sequence of the nucleic acid molecule may be positions 1-19 of SEQ ID NO: 4 and / or positions 1-19 of SEQ ID NO: 5.

[0037] Further, D8) the nucleic acid molecule may be a DNA molecule described in any one of the following g1)-g3):

[0038] g1), a DNA molecule whose coding sequence of the coding strand is SEQ ID NO: 2;

[0039] g2), a DNA molecule whose nucleotide sequence of the coding strand is positions 1838-5807 of SEQ ID NO: 1;

[0040] g3), a DNA molecule having more than 70% identity with the DNA molecule described in g1) or g2) and regulating wheat drought resistance.

[0041] Further, the recombinant microorganism may specifically be yeast, bacteria, algae, and fungi.

[0042] Further, the plant tissue may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, and anthers.

[0043] Further, the transgenic plant organ may be the root, stem, leaf, flower, fruit, and seed of a transgenic plant.

[0044] Further, the transgenic plant cell line, transgenic plant tissue, and transgenic plant organ may or may not include propagation materials.

[0045] The above biological materials are also the protection content of this application.

[0046] This application also provides a composition for genome editing of the RTN3 protein-coding gene, and the composition includes an sgRNA with a target site of positions 1-19 of SEQ ID NO: 4, an sgRNA with a target site of positions 1-19 of SEQ ID NO: 5, and the effector protein Cas9 of CRISPR / Cas9.

[0047] The beneficial technical effects achieved by this application:

[0048] The purpose of this application is to provide a method for evaluating the sensitivity of wheat seedling roots based on ABA treatment. By standardizing the experimental process and data analysis, the sensitivity of wheat seedling roots to ABA is quantified, providing a scientific basis for screening stress-resistant varieties. And the drought resistance-related protein TaSINA-3B and its coding gene are screened according to this method.

[0049] Experiments have shown that overexpression of the TaSINA-3B gene in plants significantly inhibits the drought resistance of plants, while knocking out the TaSINA-3B gene can significantly improve the drought resistance of plants. This indicates that the TaSINA-3B protein and its encoding gene can regulate the drought resistance of plants and have great potential for production and application. Brief Description of the Drawings

[0050] Figure 1 : Schematic diagram of the seed germination experiment.

[0051] Figure 2 : Schematic diagram of the inclined placement of the seed germination bag.

[0052] Figure 3 : Schematic diagram of the root growth environment, showing the use of a light incubator and a black plastic bag.

[0053] Figure 4 : Schematic diagram of the root length measurement of the experimental group and the control group.

[0054] Figure 5 : Sequence changes in the gene-edited lines.

[0055] Figure 6 : Results of drought resistance detection. Detailed Implementation Manner

[0056] I. Terms in this application:

[0057] Examples of resources that describe many of the terms related to molecular biology used herein can be found in the following documents: Alberts et al., Molecular Biology of The Cell, 5th Edition, Garland Science Publishing, Inc.: New York, 2007; Rieger et al., Glossary of Genetics: Classical and Molecular, 5th Edition, Springer-Verlag: New York, 1991; King et al., A Dictionary of Genetics, 6th Edition, Oxford University Press: New York, 2002; and Lewin, Genes IX, Oxford University Press: New York, 2007.

[0058] Any references cited herein, including, for example, all patents, published patent applications, and non-patent publications, are hereby incorporated by reference in their entirety.

[0059] For the convenience of understanding this application, several terms and abbreviations used herein are defined as follows:

[0060] In the present application, "identity" refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence (or nucleotide sequence) can be determined using homology search sites on the Internet, such as the BLAST web page on the NCBI home page website. For example, in the advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search, the identity of a pair of amino acid sequences can be calculated, and then the identity value (%) can be obtained.

[0061] Specifically, the identity of more than 70% can be the identity of more than 75%. Specifically, the identity of more than 75% can be the identity of more than 80%. Specifically, the identity of more than 80% can be the identity of more than 85%. Specifically, the identity of more than 85% can be the identity of more than 90%. Specifically, the identity of more than 90% can be the identity of more than 91%, more than 92%, more than 93%, more than 94%, more than 95%, more than 96%, more than 97%, more than 98%, or more than 99%. More specifically, the identity of more than 70% can be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity.

[0062] When used in a list of two or more items, the term "and / or" means that any one of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either A or B or both, i.e., A alone, B alone, or a combination of A and B. The expression "A, B, and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B, and C.

[0063] As used herein, "plant" includes explants, plant parts, seedlings, plantlets, or whole plants at any stage of regeneration or development.

[0064] As used herein, "plant part" can refer to any organ or entire tissue of a plant, such as meristems, shoot organs / structures (e.g., leaves, stems, or nodes), roots, flowers or flower organs / structures (e.g., flowers, bracts, sepals, petals, stamens, carpels, anthers, and ovules), seeds (e.g., embryos, endosperm, and seed coats), fruits (e.g., mature ovaries), propagules, or other plant tissues (e.g., vascular tissue, dermal tissue, ground tissue, etc.) or any part thereof. The plant parts of the present application can be viable, non-viable, renewable, and / or non-renewable. "Propagule" can include any plant part that can grow into an entire plant.

[0065] A plant cell is a biological cell of a plant, which is taken from a plant or derived from a culture obtained by culturing cells taken from a plant. As used herein, a "transgenic plant cell" refers to any plant cell transformed with a stably integrated recombinant DNA molecule, construct, expression cassette, or sequence. Transgenic plant cells can include the originally transformed plant cells, transgenic plant cells regenerated or developed from R0 generation transgenic plant cells, transgenic plant cells cultured from another transgenic plant cell, or transgenic plant cells of any progeny plant or offspring derived from the transformed R0 generation plant, including cells of plant seeds or embryos, or cultured plant cells, callus cells, etc.

[0066] As used herein, an "expression cassette" refers to at least a transcribable DNA, which is operably linked to one or more regulatory elements, usually at least a promoter and a 3' UTR (such as a terminator).

[0067] The term "construct" means any recombinant DNA molecule or recombinant RNA molecule. The recombinant DNA molecule can be a plasmid, cosmid, virus, phage, or linear or circular DNA. A construct usually includes one or more expression cassettes.

[0068] As is commonly understood in the art, the term "promoter" generally can refer to a DNA that contains an RNA polymerase binding site, a transcription start site, and / or a TATA box and aids or promotes the transcription of transcribable DNA. A promoter can be artificially synthesized, altered, or derived from a known or naturally occurring promoter. A promoter can also include a chimeric promoter that comprises a combination of two or more heterologous sequences. Thus, the promoters of the present application can include variants of promoter sequences that are compositionally similar but not identical to other promoter sequences provided herein.

[0069] Promoters can be classified according to various criteria related to the expression patterns of associated coding or transcribable sequences or genes (including transgenes) operably linked to the promoter, such as constitutive, developmental, tissue-specific, inducible, etc. Promoters that drive expression in all or most tissues of a plant are called "constitutive" promoters. Promoters that drive expression during certain periods or stages of development are called "developmental" promoters. Promoters that drive enhanced expression in certain tissues of a plant relative to other plant tissues are called "tissue-enhanced" or "tissue-preferred" promoters. Thus, a "tissue-preferred" promoter causes relatively high or preferential expression in a specific tissue of a plant, but has a lower expression level in other tissues of the plant. Promoters that are expressed within a specific tissue of a plant and are rarely or not expressed in other plant tissues are called "tissue-specific" promoters. An "inducible" promoter is a promoter that initiates transcription in response to environmental stimuli (such as cold, drought, or light) or other stimuli (such as wounding or chemical application). Promoters can also be classified according to their origin, such as heterologous, homologous, chimeric, synthetic, etc.

[0070] The term "transcribable DNA" refers to DNA that can be transcribed into an RNA molecule.

[0071] The term "operably linked" can refer to a functional linkage between a promoter and transcribable DNA such that the promoter functions to initiate transcription of the transcribable DNA. The term "operably linked" also refers to a functional linkage between other regulatory elements and a gene of interest to regulate the transcription and / or expression of the gene of interest.

[0072] As used herein, the term "vector" means any construct that can be used for transformation purposes, i.e., to introduce heterologous DNA into a host cell. Such as plasmids, cosmids, viruses, bacteriophages, or linear or circular DNA.

[0073] In this application, "editing" or "genome editing" refers to the use of targeted genome editing techniques to generate targeted mutations, deletions, inversions, or substitutions of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 1000, or at least 1500 nucleotides of an endogenous plant genomic nucleic acid sequence.

[0074] In the present application, "editing" or "genome editing" also encompasses the targeted insertion or site-directed integration of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 750, at least 1000 or at least 1500 nucleotides into the endogenous genome of a plant using a targeted genome editing technique.

[0075] In the present application, a "target site" for genome editing refers to the position of a polynucleotide sequence within the plant genome that is targeted and cleaved by a site-specific nuclease to introduce a double-strand break (or single-strand nick) into the nucleic acid backbone of the polynucleotide sequence and / or its complementary DNA strand. The site-specific nuclease can bind to the target site, for example, via a non-coding guide RNA (such as, but not limited to, a CRISPR RNA (crRNA) or a single-stranded guide RNA (sgRNA)). The non-coding guide RNA provided herein can be complementary to the target site (e.g., complementary to the strand of a double-stranded nucleic acid molecule or to the chromosome of the target site). A "target site" also refers to the position of a polynucleotide sequence within the plant genome that is bound and cleaved by another site-specific nuclease, which may not be guided by a non-coding RNA molecule, such as a meganuclease, a zinc finger nuclease (ZFN), or a transcription activator-like effector nuclease (TALEN), to introduce a double-strand break (or single-strand nick) into the polynucleotide sequence and / or its complementary DNA strand.

[0076] In the present application, the term "guide RNA" or "gRNA" refers to a short RNA sequence that comprises (1) a structural or scaffold RNA sequence required for binding or interacting with an RNA-guided nuclease and / or with other RNA molecules (e.g., tracrRNA), and (2) an RNA sequence that is identical or complementary to a target sequence or target site (referred to herein as the "guide sequence"). A "single-guide RNA" (or "sgRNA") is an RNA molecule that comprises a tracrRNA and a crRNA covalently linked by a linker sequence, which can be expressed as a single RNA transcript or molecule. The guide RNA comprises a guide or targeting sequence (the "guide sequence") that is identical or complementary to a target site within the plant genome, e.g., at or near a GA oxidase gene. A protospacer adjacent motif (PAM) may be present in the genome immediately 5' and upstream of the genomic target site sequence complementary to the targeting sequence of the guide RNA, i.e., as is known in the art downstream (3') of the sense (+) strand of the genomic target site (relative to the targeting sequence of the guide RNA). The genomic PAM sequence on the sense (+) strand adjacent to the target site (relative to the targeting sequence of the guide RNA) may comprise 5′-NGG-3'. However, the corresponding sequence of the guide RNA (i.e., immediately downstream (3') of the targeting sequence of the guide RNA) is generally not complementary to the genomic PAM sequence. The guide RNA is typically a non-coding RNA molecule that does not encode a protein.

[0077] In the present application, an "RNA-guided nuclease" refers to an RNA-guided DNA endonuclease associated with the CRISPR system. Non-limiting examples of RNA-guided nucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also referred to as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, homologs thereof or modified forms thereof. In one aspect of the embodiments, the RNA-guided nuclease is Cas9. In one aspect of the embodiments, the RNA-guided nuclease comprises N-terminal and C-terminal nuclear localization sequences (NLSs).

[0078] In some embodiments of the present application, the composition for genome editing can be co-delivered with a DNA molecule comprising a selectable or screenable marker gene.

[0079] Furthermore, the Cas9 protein described in this application is not limited to a specific protein, as long as it can be used in combination with the sgRNA of this application. Further, the Cas9 protein described herein is selected from Streptococcus pyogenes Cas9 (spCas9, type II-A subtype), spCas9HF (high-fidelity), nickase Cas9 (nCas9), Staphylococcus aureus Cas9 (saCas9, type II-A subtype), Neisseria meningitidis Cas9 (NmCas9, type II-C subtype), Francisella novicida Cas9 (FnCas9, type II-B subtype), Streptococcus thermophilus Cas9 (St1Cas9, St3Cas9), Campylobacter jejuni Cas9 (CjCas9), and Treponema sp. Cas9, as well as Cas9 orthologs of other organisms but not limited thereto. The Cas9 protein may also include high-fidelity Cas9 mutants (such as: SpCas9-HF1, eSpCas9-1.1, and TrueCut TM HiFiCas9 protein), etc.

[0080] II. Technical solutions provided by this application

[0081] This application provides a method for evaluating the sensitivity of wheat seedling roots based on ABA treatment. By standardizing the experimental process and data analysis, the sensitivity of wheat seedling roots to ABA is quantified, providing a scientific basis for screening stress-resistant varieties. Experiments have shown that overexpressing the TaSINA-3B gene in plants will significantly inhibit the drought resistance of plants, while knocking out the TaSINA-3B gene can significantly improve the drought resistance of plants. This indicates that the TaSINA-3B protein and its encoding gene can regulate the drought resistance of plants and have great potential for production applications.

[0082] The following further describes this application in detail in combination with specific embodiments. The provided embodiments are only for clarifying this application and not for limiting the scope of this application. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements and do not limit this application in any way.

[0083] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0084] Plasmids pCBC-MT1T2 and pBUE414 are described in the following literature: Plant Biotechnol J. 2021 Dec 24; 20(5): 862–875. doi: 10.1111 / pbi.13765; TaMOR is essential for root initiation and improvement of root system architecture in wheat; Chaonan Li, Jingyi Wang, Long Li, Jialu Li, Mengjia Zhuang, Bo Li, Qiaoru Li, Junfang Huang, Yan Du, Jinping Wang, Zipei Fan, Xinguo Mao, Ruilian Jing. The above materials can be obtained from the applicant, and the obtained materials can only be used for the experimental verification of this application and cannot be used for other purposes.

[0085] In the quantitative tests in the following examples, unless otherwise specified, three replicates are set, and the results are averaged.

[0086] The following examples use GraphPad Prism statistical software to process the data. The experimental results are expressed as mean ± standard deviation, and the t-test is used. P < 0.05 (*) indicates significant difference.

[0087] Example 1. Development process of TaSINA-3B gene

[0088] A natural population consisting of 323 wheat germplasms (Table 1) was used for the seed germination experiment. The seeds were placed in an incubator at 25 °C and germinated in the dark for 42 hours. The schematic diagram of the seed germination experiment is as Figure 1 shown. Subsequently, the seeds with the same growth vigor were put into seed germination bags, with 2 wheat varieties placed in each bag and 3 seeds of each variety. The specific operations are as follows:

[0089] 1.1. ABA treatment

[0090] 30 mL of 10 μM ABA solution and 30 mL of deionized water were added to the seed germination bags of the experimental group and the control group, respectively.

[0091] Tilt the seed germination bag and place it in a light incubator at an angle of 20 degrees to the ground (22 hours of light at 25 °C; 2 hours of darkness at 22 °C) to simulate the root growth environment. The schematic diagram of the inclined placement of the seed germination bag is as shown in Figure 2 shown. The schematic diagram showing the use of a light incubator and a black plastic bag for the root growth environment is as shown in Figure 3 shown.

[0092] 1.2 Root growth measurement

[0093] After 6 days of growth, measure the root lengths of the experimental group and the control group.

[0094] Analyze the root length data by Best Linear Unbiased Prediction (BLUP), and calculate the ratio of the root length of the experimental group to the root length of the control group for the same germplasm, which represents the sensitivity (SL) of wheat seedling roots to ABA. The schematic diagram of root length measurement for two wheat materials with large differences in ABA sensitivity is as shown in Figure 4 shown.

[0095] 1.3 Gene function analysis

[0096] Identify and screen the resistance gene TaSINA-3B gene sensitive to ABA through GWAS, and further analyze its expression pattern and haplotype distribution.

[0097] Example 2 Functional verification of TaSINA-3B protein and its encoding gene

[0098] In the B genome of wheat Fielder and wheat Chinese Spring, the TaSINA-3B gene is a DNA molecule with a nucleotide sequence as shown in SEQ ID NO: 3, and its coding sequence is a DNA molecule with a nucleotide sequence as shown in nucleotides 1 to 879 of SEQ ID NO: 1, encoding the TaSINA-3B protein with an amino acid sequence as shown in SEQ ID NO: 2. Further use molecular biology techniques to verify the response of TaSINA-3B to drought.

[0099] 2.1 Construction of recombinant gene editing vector and genetic transformation

[0100] 1 Construction of recombinant gene editing vector

[0101] 1) Prediction of editing sites and primer design

[0102] Predict the editing sites of the TaSINA-3B gene with the help of an online website (http: / / www.e-crisp.org / E-CRISP / ), and the finally selected target sites are as follows:

[0103] Target 1: GTGAAGACACTCTACTACAagg (SEQ ID NO: 4, where positions 1-19 of SEQ ID NO: 4 are the target site sequence and positions 20-22 are the PAM sequence; located at positions 1261 to 1281 of TaSINA-3B gene SEQ ID NO: 3);

[0104] Target 2: GATCACAAGTGGAAATCCAagg (SEQ ID NO: 5, where positions 1-19 of SEQ ID NO: 5 are the target site sequence and positions 20-22 are the PAM sequence; located at positions 1387 to 1408 of TaSINA-3B gene SEQ ID NO: 3).

[0105] Four primers were designed. The specific primer sequences are as follows:

[0106] Forward primer F: 5’-aataatggtctcaggcgGTGAAGACACTCTACTACA-3’;

[0107] Forward primer F0: 5’-gGTGAAGACACTCTACTACAgttttagagctagaaatagc-3’;

[0108] Reverse primer R: 5’-attattggtctctaaacTGGATTTCCACTTGTGATC-3’;

[0109] 2) Construction of recombinant vector

[0110] (1) Using the pCBC-MT1T2 plasmid as a template, PCR was amplified using the above 4 primers to obtain a DNA fragment containing the vector linker and the target site, and gel recovery purification was performed. The sequencing results showed that the nucleotide sequence of the DNA fragment was as shown in SEQ ID NO: 6.

[0111] (2) The pBUE414 vector and the DNA fragment shown in SEQ ID NO: 6 were digested with BsaI endonuclease, and the digested DNA fragment was ligated with the digested vector using T4 Ligase overnight. The obtained ligation product was transferred into DH5α Escherichia coli competent cells for culture.

[0112] (3) Use the vector primers pBUE414-seq-F and pBUE414-seq-R to perform PCR amplification on the target gene fragment to screen for positive clones. The bacterial liquid was sent to the company for sequencing, and the gene knockout vector with correct sequencing was named pBUE414-TaSINA-3B. The sequencing results showed that the structure of the pBUE414-TaSINA-3B knockout vector was: the DNA fragment shown in SEQ ID NO: 6 was digested with BsaI endonuclease and replaced the fragment between the restriction enzyme cleavage sites of BsaI in the pBUE414 vector (the small fragment between the two BsaI cleavage sites), while keeping other sequences of the pBUE414 vector unchanged. The resulting recombinant vector was named the pBUE414-TaSINA-3B knockout vector. The pBUE414-TaSINA-3B knockout vector can express Cas9 and two sgRNAs targeting the above-mentioned target 1 and target 2.

[0113] The sequences of primers pBUE414-seq-F and pBUE414-seq-R are as follows (5'-3')

[0114] pBUE414-seq-F: TTTCCCAGTCACGACGTTGT;

[0115] pBUE414-seq-R: ATCTCTAGAGAGGGGCACGA.

[0116] After the pBUE414-TaSINA-3B knockout vector is introduced into the recipient, the two guide RNAs (i.e., the two sgRNAs) transcribed can target the target sequence near the PAM of the recipient genome through base complementary pairing, that is, target the TaSINA-3B gene. The Cas9 protein causes a double-strand break in the DNA near the TaSINA-3B gene target. Through the organism's own DNA damage repair response mechanism, gene mutations occur in the sheared region during the repair process, thus achieving the knockout of the TaSINA-3B gene.

[0117] 2. Genetic transformation and positive identification of the recombinant gene editing vector

[0118] The constructed TaSINA-3B gene-editing wheat vector was introduced into Agrobacterium tumefaciens EHA105. Subsequently, through the Agrobacterium-mediated genetic transformation method, this vector was transformed into wheat Fielder. After obtaining gene-edited plants, specific primers were synthesized for the editing sites, and the target genes were amplified separately. The amplification products were sent for sequencing to identify the gene editing situation. After screening and identification, finally, homozygous TaSINA-3B gene-edited transgenic wheat was obtained, named the tasina line. To further confirm the effect of gene editing, a pair of specific primers for the TaSINA-3B genome, F (5′-GGCCACCGGTGGCTAAAATC-3′) and R (5′-GTGCACCTGGAACCAAGACG-3′), were used for amplification. The sequencing results showed that compared with the wild-type wheat Fielder, the following changes occurred in the two chromosomes of the tasina line: a deletion of 148 deoxyribonucleotides at positions 1277-1424 of SEQ ID NO: 3 of the TaSINA-3B gene, thus achieving the knockout of the TaSINA-3B gene ( Figure 5 ).

[0119] 2.2. Drought tolerance identification

[0120] Using the homozygous gene-knockout line tasina prepared in 2.1 and the recipient wheat Fielde (as a negative control, labeled as WT) as germplasm materials. The specific experimental steps are as follows:

[0121] 1) Seed pretreatment: Treat the wheat seeds to be tested with 1% hydrogen peroxide for 1 day to break seed dormancy and prepare for subsequent germination.

[0122] 2) Seedling planting: Select seedlings with consistent germination and growth, and plant them in plastic boxes of the same specification of 56 cm × 38 cm × 11 cm. Sow 30 seeds for each line, and then bury the plastic boxes in outdoor soil, ensuring that the height of the plastic boxes is flush with the ground to simulate the natural growth environment.

[0123] 3) Drought treatment and data statistics: When the seedlings grow to the three-leaf and one-heart stage, apply drought treatment to the drought treatment group, that is, stop watering. After 18 days of drought treatment, rewater all plants. Three days after rewatering, count the survival rate. Set three independent biological replicates to ensure the reliability of the experimental results.

[0124] The formula for calculating the seedling survival rate is: Survival rate (%) = Number of surviving plants / Number of planted plants (30) × 100%.

[0125] The experimental results are as Figure 6As shown, after 18 days of drought treatment, the phenotypes of the gene knockout homozygous line tasina line and the recipient wheat Fielder were significantly different. After rewatering, the survival rate of the TaSINA-3B gene knockout line was significantly higher than that of the wild type. This result indicates that the TaSINA-3B gene can regulate the drought resistance of wheat seedlings at the seedling stage. The drought resistance of the recipient wheat can be improved by knocking out the TaSINA-3B gene in the recipient wheat, reducing the expression level of the TaSINA-3B gene in the recipient wheat, and / or reducing the content of the TaSINA-3B protein encoded by the TaSINA-3B gene. Knocking out the TaSINA-3B gene in the recipient wheat, reducing the expression level of the TaSINA-3B gene in the recipient wheat, and / or reducing the content of the TaSINA-3B protein encoded by the TaSINA-3B gene can obtain the target wheat with improved drought resistance, and the drought resistance of the target wheat is higher than that of the recipient wheat.

[0126] Table 1 Natural population of 323 wheat germplasms

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133] The above details the present application. For those skilled in the art, without departing from the purpose and scope of the present application and without unnecessary experiments, the present application can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present application are given, it should be understood that the present application can be further improved. In short, according to the principle of the present application, the present application is intended to include any changes, uses, or improvements to the present application, including changes made using conventional techniques known in the art that depart from the scope disclosed in the present application.

Claims

1. A method for improving the drought resistance of wheat, characterized in that: The method includes reducing the content of TaSINA-3B protein in recipient wheat and / or reducing the expression level of the TaSINA-3B protein-encoding gene in recipient wheat to improve the drought resistance of recipient wheat. The TaSINA-3B protein is at least one of the following: A1), a protein with an amino acid sequence of positions 1-292 of SEQ ID NO: 2; A2), a protein obtained by substitution, deletion, and / or addition of amino acid residues to the amino acid sequence shown in A1), having more than 70% identity with the amino acid sequence shown in A1), and being related to wheat drought resistance; A3), a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

2. A method for preparing target wheat with improved drought resistance, characterized in that: The method includes reducing the content of the TaSINA-3B protein described in claim 1 in recipient wheat and / or reducing the expression level of the TaSINA-3B protein-encoding gene in recipient wheat to obtain target wheat with improved drought resistance.

3. The method according to claim 1 or 2, characterized in that: The TaSINA-3B protein-encoding gene is at least one of the following: g1), a DNA molecule with a coding sequence of positions 1 to 897 of SEQ ID NO: 1 in the coding strand; g2), a DNA molecule with a nucleotide sequence of SEQ ID NO: 3 in the coding strand; g3), a DNA molecule having more than 70% identity with the DNA molecule described in g1) or g2) and regulating wheat drought resistance.

4. The method according to any one of claims 1 to 3, characterized in that: The reduction of the content of TaSINA-3B protein in recipient wheat and / or the reduction of the expression level of the TaSINA-3B protein-encoding gene in recipient wheat is achieved by at least one of the following: B1), knocking out the TaSINA-3B protein-encoding gene in the recipient wheat through a genome editing system; the genome editing system includes an sgRNA with a target site of positions 1-19 of SEQ ID NO: 4, an sgRNA with a target site of positions 1-19 of SEQ ID NO: 5, and the effector protein Cas9 of CRISPR / Cas9; B2), mutating the gene in recipient wheat, and the mutation includes deleting 148 deoxyribonucleotides at positions 1277-1424 of SEQ ID NO: 3 in recipient wheat.

5. Use of the TaSINA-3B protein and / or biological material related to the TaSINA-3B protein as described in claim 1, characterized in that: The application is any one of the following: C1), application in regulating wheat drought resistance; C2), application in preparing products for regulating wheat drought resistance; C3), application in wheat breeding or wheat assisted breeding; C4), application in preparing products for wheat breeding or wheat assisted breeding.

6. The application according to claim 5, characterized in that: The biological material is any one of the following: D1), a nucleic acid molecule that inhibits or reduces the expression of the TaSINA-3B protein-encoding gene; D2), an expression cassette and / or construct containing the nucleic acid molecule described in D1); D3), a recombinant vector containing the nucleic acid molecule described in D1) or a recombinant vector containing the expression cassette and / or construct described in D2); D4), a recombinant microorganism containing the nucleic acid molecule described in D1), a recombinant microorganism containing the expression cassette and / or construct described in D2), or a recombinant microorganism containing the recombinant vector described in D3). D5), a transgenic wheat cell line containing the nucleic acid molecule described in D1), a transgenic wheat cell line containing the expression cassette and / or construct described in D2), or a transgenic wheat cell line containing the recombinant vector described in D3); D6), a transgenic wheat tissue containing the nucleic acid molecule described in D1), a transgenic wheat tissue containing the expression cassette and / or construct described in D2), or a transgenic wheat tissue containing the recombinant vector described in D3); D7), a transgenic wheat organ containing the nucleic acid molecule described in D1), a transgenic wheat organ containing the expression cassette and / or construct described in D2), or a transgenic wheat organ containing the recombinant vector described in D3); D8), a nucleic acid molecule encoding the TaSINA-3B protein; D9), an expression cassette and / or construct, a recombinant vector, a recombinant microorganism, a transgenic wheat cell line, a transgenic wheat tissue, and / or a transgenic wheat organ containing the nucleic acid molecule described in D8).

7. The application according to claim 6, wherein: The nucleic acid molecule described in D1) is an RNA targeting the coding gene of the TaSINA-3B protein described in claim 1 or a DNA encoding the RNA.

8. The application according to claim 4, wherein: The target site sequence of the nucleic acid molecule described in D1) is positions 1-19 of SEQ ID NO: 4 and / or positions 1-19 of SEQ ID NO:

5.

9. The application according to claim 2, characterized in that: The nucleic acid molecule described in D8) is a DNA molecule as described in any one of the following g1)-g3): g1), a DNA molecule whose coding sequence of the coding strand is SEQ ID NO: 2; g2), a DNA molecule whose nucleotide sequence of the coding strand is positions 1838-5807 of SEQ ID NO: 1; g3), a DNA molecule having more than 70% identity with the DNA molecule described in g1) or g2) and regulating wheat drought resistance.

10. A substance as described in at least one of the following: E1) The biological material described in any one of claims 5-9; E2) A composition for genome editing of the RTN3 protein coding gene, the composition comprising an sgRNA with a target site at positions 1-19 of SEQ ID NO: 4, an sgRNA with a target site at positions 1-19 of SEQ ID NO: 5, and the effector protein Cas9 of CRISPR / Cas9.

Citation Information

Patent Citations

  • Paddy drought resistance gene OsSINAT5 and encoding protein and application thereof

    CN101445553A

  • Plant having enhanced resistance to environmental stress

    US20120227135A1